Abhimanyu Garg

Q: What Schools Are Affiliated With Abhimanyu Garg

Abhimanyu Garg is affiliated with the following schools: Texas Christian University, Stanford University, University of Texas Southwestern Medical Center

Abhimanyu Garg's AcademicInfluence.com Rankings

Abhimanyu Garg

Computer Science

#5341

World Rank

#5641

Historical Rank

Computational Linguistics

#722

World Rank

#734

Historical Rank

Machine Learning

#1381

World Rank

#1402

Historical Rank

Artificial Intelligence

#1616

World Rank

#1646

Historical Rank

computer-science Degrees

Download Badge

Computer Science

Abhimanyu Garg's Degrees

PhD Computer Science Stanford University
Masters Computer Science Stanford University
Bachelors Computer Science Stanford University

Similar Degrees You Can Earn

Why Is Abhimanyu Garg Influential?

(Suggest an Edit or Addition)

(See a Problem?)

Abhimanyu Garg's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Leptin-replacement therapy for lipodystrophy. (2002) (1110)
Evidence-based nutrition principles and recommendations for the treatment and prevention of diabetes and related complications. (2002) (1071)
Beneficial effects of high dietary fiber intake in patients with type 2 diabetes mellitus. (2000) (1063)
Acquired and inherited lipodystrophies. (2004) (824)
Relationships of generalized and regional adiposity to insulin sensitivity in men. (1995) (783)
Measurement of intracellular triglyceride stores by H spectroscopy: validation in vivo. (1999) (576)
The lipodystrophy protein seipin is found at endoplasmic reticulum lipid droplet junctions and is important for droplet morphology (2007) (531)
AGPAT2 is mutated in congenital generalized lipodystrophy linked to chromosome 9q34 (2002) (487)
Relationship between generalized and upper body obesity to insulin resistance in Asian Indian men. (1999) (447)
Clinical review#: Lipodystrophies: genetic and acquired body fat disorders. (2011) (440)
High-monounsaturated-fat diets for patients with diabetes mellitus: a meta-analysis. (1998) (435)
Comparison of a high-carbohydrate diet with a high-monounsaturated-fat diet in patients with non-insulin-dependent diabetes mellitus. (1988) (421)
Effects of varying carbohydrate content of diet in patients with non-insulin-dependent diabetes mellitus. (1994) (419)
Review: long-term impact of bariatric surgery on body weight, comorbidities, and nutritional status. (2006) (411)
Zinc metalloproteinase, ZMPSTE24, is mutated in mandibuloacral dysplasia. (2003) (389)
Nutrition principles and recommendations in diabetes. (2004) (377)
Relationship of Generalized and Regional Adiposity to Insulin Sensitivity in Men With NIDDM (1996) (326)
Evidence-based nutrition principles and recommendations for the treatment and prevention of diabetes and related complications. (2003) (324)
Nicotinic acid as therapy for dyslipidemia in non-insulin-dependent diabetes mellitus. (1990) (291)
PSMB8 encoding the β5i proteasome subunit is mutated in joint contractures, muscle atrophy, microcytic anemia, and panniculitis-induced lipodystrophy syndrome. (2010) (290)
Management of Dyslipidemia in NIDDM (1990) (273)
The Diagnosis and Management of Lipodystrophy Syndromes: A Multi-Society Practice Guideline (2016) (268)
Seipin is required for converting nascent to mature lipid droplets (2016) (261)
A Novel Heterozygous Mutation in Peroxisome Proliferator-Activated Receptor-γ Gene in a Patient with Familial Partial Lipodystrophy (2002) (252)
Partial lipodystrophy and insulin resistant diabetes in a patient with a homozygous nonsense mutation in CIDEC (2009) (250)
Comparison of Effects of High and Low Carbohydrate Diets on Plasma Lipoproteins and Insulin Sensitivity in Patients With Mild NIDDM (1992) (247)
Clinical Features and Metabolic and Autoimmune Derangements in Acquired Partial Lipodystrophy: Report of 35 Cases and Review of the Literature (2004) (244)
Phenotypic and genetic heterogeneity in congenital generalized lipodystrophy. (2003) (224)
Adipose tissue distribution pattern in patients with familial partial lipodystrophy (Dunnigan variety). (1999) (221)
Lipodystrophy in Human Immunodeficiency Virus-Infected Patients (2002) (221)
Molecular mechanisms of hepatic steatosis and insulin resistance in the AGPAT2-deficient mouse model of congenital generalized lipodystrophy. (2009) (207)
Relationship of anterior and posterior subcutaneous abdominal fat to insulin sensitivity in nondiabetic men. (1997) (207)
Adipose tissue dysfunction in obesity and lipodystrophy. (2006) (200)
Cholestyramine Therapy for Dyslipidemia in NonInsulin-dependent Diabetes Mellitus: A Short-Term, Double-Blind, Crossover Trial (1994) (199)
Serum adiponectin and leptin levels in patients with lipodystrophies. (2004) (196)
Regional adiposity and insulin resistance. (2004) (194)
Clinical Features and Metabolic Derangements in Acquired Generalized Lipodystrophy: Case Reports and Review of the Literature (2003) (192)
Sex steroid hormones, upper body obesity, and insulin resistance. (2002) (192)
A gene for congenital generalized lipodystrophy maps to human chromosome 9q34. (1999) (187)
Congenital generalized lipodystrophies—new insights into metabolic dysfunction (2015) (187)
LMNA mutations in atypical Werner's syndrome (2003) (178)
Lipodystrophies: disorders of adipose tissue biology. (2009) (175)
Lovastatin for lowering cholesterol levels in non-insulin-dependent diabetes mellitus. (1988) (166)
American Diabetes Association position statement: evidence-based nutrition principles and recommendations for the treatment and prevention of diabetes and related complications. (2002) (164)
Congenital generalized lipodystrophy: significance of triglyceride biosynthetic pathways (2003) (163)
Measurement of intracellular triglyceride stores by H spectroscopy: validation in vivo. (1999) (163)
Gender differences in the prevalence of metabolic complications in familial partial lipodystrophy (Dunnigan variety). (2000) (161)
Phenotypic heterogeneity in body fat distribution in patients with congenital generalized lipodystrophy caused by mutations in the AGPAT2 or seipin genes. (2003) (159)
Serum adiponectin and leptin levels in patients with lipodystrophies (2002) (158)
Relationship between lipoprotein levels and in vivo insulin action in normal young white men. (1988) (158)
Localization of the gene for familial partial lipodystrophy (Dunnigan variety) to chromosome 1q21–22 (1998) (156)
Genetic disorders of adipose tissue development, differentiation, and death. (2006) (153)
Genetic basis of lipodystrophies and management of metabolic complications. (2006) (149)
Multisystem dystrophy syndrome due to novel missense mutations in the amino-terminal head and alpha-helical rod domains of the lamin A/C gene. (2002) (149)
A novel heterozygous mutation in peroxisome proliferator-activated receptor-gamma gene in a patient with familial partial lipodystrophy. (2002) (135)
Lipodystrophy Syndromes. (2016) (130)
Genetic and phenotypic heterogeneity in patients with mandibuloacral dysplasia-associated lipodystrophy. (2003) (128)
Lipodystrophies: rare disorders causing metabolic syndrome. (2004) (126)
Laminopathies: multisystem dystrophy syndromes. (2006) (122)
Effect of leptin replacement on intrahepatic and intramyocellular lipid content in patients with generalized lipodystrophy. (2003) (121)
Phenotypic heterogeneity in patients with familial partial lipodystrophy (dunnigan variety) related to the site of missense mutations in lamin a/c gene. (2001) (121)
High‐Volume Exercise Program in Obese Bariatric Surgery Patients: A Randomized, Controlled Trial (2011) (120)
Update on dyslipidemia. (2007) (118)
Atypical progeroid syndrome due to heterozygous missense LMNA mutations. (2009) (117)
Hepatic steatosis, insulin resistance, and adipose tissue disorders. (2002) (113)
Peculiar distribution of adipose tissue in patients with congenital generalized lipodystrophy. (1992) (113)
Congenital generalized lipodystrophy, type 4 (CGL4) associated with myopathy due to novel PTRF mutations (2010) (113)
Lipodystrophy: lessons in lipid and energy metabolism (2006) (112)
Heterogeneity in adipose tissue metabolism: causes, implications and management of regional adiposity. (1995) (105)
Effect of high-carbohydrate or high-cis-monounsaturated fat diets on blood pressure: a meta-analysis of intervention trials. (2007) (105)
Insulin Resistance in the Pathogenesis of Dyslipidemia (1996) (104)
Gemfibrozil Alone and in Combination With Lovastatin for Treatment of Hypertriglyceridemia in NIDDM (1989) (101)
Autoantibodies against GPIHBP1 as a Cause of Hypertriglyceridemia (2017) (100)
Body fat distribution and metabolic derangements in patients with familial partial lipodystrophy associated with mandibuloacral dysplasia. (2002) (94)
Clinical review 153: Lipodystrophy in human immunodeficiency virus-infected patients. (2002) (91)
The clinical approach to the detection of lipodystrophy - an AACE consensus statement. (2013) (90)
An autosomal recessive syndrome of joint contractures, muscular atrophy, microcytic anemia, and panniculitis-associated lipodystrophy. (2010) (89)
Effect of High Carbohydrate Intake on Hyperglycemia, Islet Function, and Plasma Lipoproteins in NIDDM (1992) (88)
Deletion of GPIHBP1 causing severe chylomicronemia (2011) (88)
Comparison of efficacy and safety of leptin replacement therapy in moderately and severely hypoleptinemic patients with familial partial lipodystrophy of the Dunnigan variety. (2012) (83)
High-Fat and High-Carbohydrate Diets and Energy Balance (1996) (76)
Seipin: a mysterious protein. (2004) (74)
Estimating the prevalence of generalized and partial lipodystrophy: findings and challenges (2017) (72)
Functional characterization of human 1-acylglycerol-3-phosphate acyltransferase isoform 8: cloning, tissue distribution, gene structure, and enzymatic activity. (2006) (70)
Human 1-Acylglycerol-3-phosphate O-Acyltransferase Isoforms 1 and 2 (2011) (66)
Whole exome sequencing identifies de novo heterozygous CAV1 mutations associated with a novel neonatal onset lipodystrophy syndrome (2015) (66)
Cardiac steatosis and left ventricular hypertrophy in patients with generalized lipodystrophy as determined by magnetic resonance spectroscopy and imaging. (2013) (65)
Enzymatic activities of the human AGPAT isoform 3 and isoform 5: localization of AGPAT5 to mitochondria[S] (2011) (65)
Risk factors for diabetes in familial partial lipodystrophy, Dunnigan variety. (2003) (64)
Focal Segmental Glomerulosclerosis in Patients with Mandibuloacral Dysplasia Owing to ZMPSTE24 Deficiency (2006) (62)
Leptin, its receptor and obesity. (1996) (61)
Inherited lipodystrophies and hypertriglyceridemia (2009) (61)
A novel syndrome of mandibular hypoplasia, deafness, and progeroid features associated with lipodystrophy, undescended testes, and male hypogonadism. (2010) (61)
Natural History of Congenital Generalized Lipodystrophy: A Nationwide Study From Turkey. (2016) (60)
A novel homozygous Ala529Val LMNA mutation in Turkish patients with mandibuloacral dysplasia. (2005) (60)
LMNA mutations in atypical Werner's syndrome (2003) (58)
Hepatic Steatosis, Insulin Resistance, and Adipose Tissue Disorders (2002) (58)
Lipodystrophies, dyslipidaemias and atherosclerotic cardiovascular disease. (2019) (57)
Thiazolidinedione-associated congestive heart failure and pulmonary edema. (2003) (57)
Genetic basis of congenital generalized lipodystrophy (2004) (56)
Treatment of diabetic dyslipidemia. (1998) (54)
Functional characterization of the human 1-acylglycerol-3-phosphate-O-acyltransferase isoform 10/glycerol-3-phosphate acyltransferase isoform 3. (2009) (54)
Enzymatic activity of naturally occurring 1-acylglycerol-3-phosphate-O-acyltransferase 2 mutants associated with congenital generalized lipodystrophy. (2005) (54)
Caveolin-1: a new locus for human lipodystrophy. (2008) (54)
High—Monounsaturated Fat Diet for Diabetic Patients: Is it time to change the current dietary recommendations? (1994) (53)
Low Prevalence of Mutations in Known Loci for Autosomal Dominant Hypercholesterolemia in a Multiethnic Patient Cohort (2012) (52)
Genotype-phenotype relationships in patients with type I hyperlipoproteinemia. (2014) (51)
Enzymatic activity of the human 1-acylglycerol-3-phosphate-O-acyltransferase isoform 11: upregulated in breast and cervical cancers[S] (2010) (50)
Functional characterization of human 1-acylglycerol-3-phosphate-O-acyltransferase isoform 9: cloning, tissue distribution, gene structure, and enzymatic activity. (2007) (49)
Severe mandibuloacral dysplasia-associated lipodystrophy and progeria in a young girl with a novel homozygous Arg527Cys LMNA mutation. (2008) (49)
Early onset mandibuloacral dysplasia due to compound heterozygous mutations in ZMPSTE24 (2010) (48)
Effect of subcutaneous leptin replacement therapy on bone metabolism in patients with generalized lipodystrophy. (2002) (45)
The ongoing saga of obestatin: is it a hormone? (2007) (45)
Leptin ameliorates insulin resistance and hepatic steatosis in Agpat2−/− lipodystrophic mice independent of hepatocyte leptin receptors[S] (2014) (45)
Sitosterolemia presenting with severe hypercholesterolemia and intertriginous xanthomas in a breastfed infant: case report and brief review. (2014) (44)
Novel subtype of congenital generalized lipodystrophy associated with muscular weakness and cervical spine instability (2008) (44)
Bi-allelic POLR3A Loss-of-Function Variants Cause Autosomal-Recessive Wiedemann-Rautenstrauch Syndrome. (2018) (43)
Severe Islet Amyloidosis in Congenital Generalized Lipodystrophy (1996) (43)
Defining hypercalciuria in nephrolithiasis. (2011) (40)
Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy (2017) (40)
A Novel Generalized Lipodystrophy-Associated Progeroid Syndrome Due to Recurrent Heterozygous LMNA p.T10I Mutation (2018) (39)
Statins for all patients with type 2 diabetes: not so soon (2004) (37)
Nutrient and Food Intake in Obese Women on a Low-Fat or Low-Calorie Diet (1996) (36)
Mutations in the seipin and AGPAT2 genes clustering in consanguineous families with Berardinelli-Seip congenital lipodystrophy from two separate geographical regions of Brazil. (2004) (36)
Management of Dyslipidemia in IPPM Patients (1994) (35)
A homozygous mutation in the lamin A/C gene associated with a novel syndrome of arthropathy, tendinous calcinosis, and progeroid features. (2006) (35)
Effects of dietary carbohydrates on metabolism of calcium and other minerals in normal subjects and patients with noninsulin-dependent diabetes mellitus. (1990) (34)
A truncated species of apolipoprotein B, B-83, associated with hypobetalipoproteinemia. (1992) (33)
Body fat distribution and metabolic variables in patients with neonatal progeroid syndrome (2007) (33)
Phenotypic heterogeneity in body fat distribution in patients with atypical Werner's syndrome due to heterozygous Arg133Leu lamin A/C mutation. (2005) (32)
Increased skeletal muscle volume in women with familial partial lipodystrophy, Dunnigan variety. (2013) (31)
Lipid-Lowering Therapy and Macrovascular Disease in Diabetes Mellitus (1992) (31)
Abnormal cholesterol distribution among lipoprotein fractions in normolipidemic patients with mild NIDDM. (1995) (30)
Non-Hodgkin's lymphoma in pregnancy. (1985) (30)
Efficacy and Safety of Metreleptin Therapy in Patients With Type 1 Diabetes: A Pilot Study (2017) (30)
Adipocyte biology and adipocytokines. (2004) (28)
Lipodystrophies: Genetic and Acquired Body Fat Disorders (2011) (28)
Extreme hypercholesterolemia presenting with pseudohyponatremia - a case report and review of the literature. (2015) (28)
Type 1 hyperlipoproteinemia and recurrent acute pancreatitis due to lipoprotein lipase antibody in a young girl with Sjogren's syndrome. (2011) (27)
AGPAT2 is essential for postnatal development and maintenance of white and brown adipose tissue (2016) (26)
Whole-exome sequencing identifies ADRA2A mutation in atypical familial partial lipodystrophy. (2016) (25)
Congenital generalized lipodystrophy: identification of novel variants and expansion of clinical spectrum (2016) (25)
Skeletal muscle morphology and exercise response in congenital generalized lipodystrophy. (2000) (25)
Mogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic (Agpat2−/−) or obese (ob/ob) mice (2016) (24)
Effect of a High-Fiber Diet Compared With a Moderate-Fiber Diet on Calcium and Other Mineral Balances in Subjects With Type 2 Diabetes (2009) (23)
A Novel Syndrome of Generalized Lipodystrophy Associated With Pilocytic Astrocytoma. (2015) (22)
Effect of a high-carbohydrate versus a high--cis-monounsaturated fat diet on blood pressure in patients with type 2 diabetes. (2005) (22)
Mislocalization of prelamin A Tyr646Phe mutant to the nuclear pore complex in human embryonic kidney 293 cells. (2007) (22)
Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants (2018) (22)
CLINICAL ENDOCRINOLOGY & METABOLISM (1992) (21)
Regional Body Fat Distribution in HIV-Infected Patients with Lipodystrophy (2005) (21)
Very Severe Hypertriglyceridemia in a Large US County Health Care System: Associated Conditions and Management (2019) (21)
Efficacy of Metreleptin Treatment in Familial Partial Lipodystrophy Due to PPARG vs LMNA Pathogenic Variants. (2019) (21)
Inseparable iduronic acid-containing proteoglycan PG(IdoA) preparations of human skin and post-burn scar tissues: evidence for elevated levels of PG(IdoA)-I in hypertrophic scar by N-terminal sequencing. (1996) (20)
Diabetic dyslipidemia and its therapy (1997) (20)
The prevalence and etiology of extreme hypertriglyceridemia in children: Data from a tertiary children's hospital. (2018) (19)
Spectrum of clinical manifestations in two young Turkish patients with congenital generalized lipodystrophy type 4. (2016) (19)
Metabolic, Reproductive, and Neurologic Abnormalities in Agpat1-Null Mice (2017) (18)
Blepharoptosis and external ophthalmoplegia associated with long-term antiretroviral therapy. (2008) (18)
De novo heterozygous FBN1 mutations in the extreme C‐terminal region cause progeroid fibrillinopathy (2014) (18)
Dyslipoproteinemia and diabetes. (1998) (18)
Premature coronary heart disease and autosomal dominant hypercholesterolemia: Increased risk in women with LDLR mutations. (2016) (16)
Comparison of nutrient intakes in South Asians with type 2 diabetes mellitus and controls living in the United States. (2018) (16)
Cholic acid for hepatic steatosis in patients with lipodystrophy: a randomized, controlled trial. (2013) (16)
Treatment of dyslipidemia in patients with NIDDM (1995) (16)
The Role of Body Fat Distribution in Insulin Resistance (1999) (16)
Type 1 hyperlipoproteinemia in a child with large homozygous deletion encompassing GPIHBP1. (2016) (15)
What is the role of alternative biomarkers for coronary heart disease? (2011) (14)
Lipodystrophy: An Unusual Diagnosis in a Case of Oligomenorrhea and Hirsutism (2009) (14)
Extreme hypertriglyceridemia, pseudohyponatremia, and pseudoacidosis in a neonate with lipoprotein lipase deficiency due to segmental uniparental disomy. (2017) (14)
Dyslipidemias: Pathophysiology, evaluation and management (2015) (13)
Treatment of dyslipidemia in non-insulin-dependent diabetes mellitus with lovastatin. (1988) (13)
Hepatic Gluconeogenesis Is Enhanced by Phosphatidic Acid Which Remains Uninhibited by Insulin in Lipodystrophic Agpat2−/− Mice* (2014) (13)
Insights into lipid accumulation in skeletal muscle in dysferlin-deficient mice[S] (2019) (12)
Orlistat Therapy for Children With Type 1 Hyperlipoproteinemia: A Randomized Clinical Trial (2018) (11)
Insulin Resistance and Atherosclerosis: An overview (1996) (11)
Serum low-density lipoprotein cholesterol response to modification of saturated fat intake: recent insights. (1997) (10)
Molecular Characterization of Familial Hypercholesterolemia in a North American Cohort. (2019) (10)
Juvenile‐onset generalized lipodystrophy due to a novel heterozygous missense LMNA mutation affecting lamin C (2017) (10)
Postmortem Findings in a Young Man With Congenital Generalized Lipodystrophy, Type 4 Due to CAVIN1 Mutations. (2018) (10)
Characterization of the Mouse and Human Monoacylglycerol O-Acyltransferase 1 (Mogat1) Promoter in Human Kidney Proximal Tubule and Rat Liver Cells (2016) (9)
Type 1 Hyperlipoproteinemia Due to Compound Heterozygous Rare Variants in GCKR. (2016) (9)
Efficacy of dietary fiber in lowering serum cholesterol. (1994) (9)
Progeroid syndrome patients with ZMPSTE24 deficiency could benefit when treated with rapamycin and dimethylsulfoxide (2017) (8)
Lipodystrophies and Diabetes (2003) (8)
Iduronic acid-rich proteoglycans (PGIdoA) and human post-burn scar maturation: isolation and characterization. (1995) (8)
Erratum: Gemfibrozil alone and in combination with lovastatin for treatment of hypertriglyceridemia in NIDDM (Diabetes (1989) 38 (364-72)) (1990) (8)
Diagnostic value of Anthropometric Measurements for Familial Partial Lipodystrophy, Dunnigan variety. (2020) (8)
Absence of AGPAT2 impairs brown adipogenesis, increases IFN stimulated gene expression and alters mitochondrial morphology. (2020) (7)
Effect of a high-carbohydrate vs a high-cis-monounsaturated fat diet on lipid and lipoproteins in individuals with and without type 2 diabetes (2004) (7)
JCL roundtable: Diagnosis and clinical management of lipodystrophy. (2016) (6)
HMGA1, a novel locus for type 2 diabetes mellitus. (2011) (6)
Marked lowering of high-density lipoprotein cholesterol levels due to high dose bexarotene therapy. (2015) (5)
Severe Liver Injury Associated With High-Dose Atorvastatin Therapy (2021) (5)
Multisystem Progeroid Syndrome With Lipodystrophy, Cardiomyopathy, and Nephropathy Due to an LMNA p.R349W Variant (2020) (5)
A novel autosomal recessive lipodystrophy syndrome due to homozygous LMNA variant (2019) (5)
Autoantibodies against GPIHBP 1 as a Cause of Hypertriglyceridemia (2017) (5)
A novel paraneoplastic syndrome with acquired lipodystrophy and chronic inflammatory demyelinating polyneuropathy in an adolescent male with craniopharyngioma (2018) (4)
Cirrhosis‐induced pseudoglucagonoma syndrome in a patient with Type 2 Diabetes: an autopsy study (2011) (4)
Efficacy and safety of volanesorsen for the treatment of metabolic complications in patients with familial partial lipodystrophy: results of the BROADEN study (2020) (4)
The relationships between macronutrient and micronutrient intakes and type 2 diabetes mellitus in South Asians: A review. (2019) (4)
The effect of dietary intervention on serum lipid levels in type 2 diabetes mellitus (2002) (4)
Aplastic anaemia in pregnancy (1982) (4)
Human AGPAT isoforms 1 and 2 : Biochemical characterization and their inability to rescue hepatic steatosis in Agpat 2-/-lipodystrophic mice (2011) (4)
Lipodystrophy for the Diabetologist—What to Look For (2022) (4)
Activation of Sphingolipid Pathway in the Livers of Lipodystrophic Agpat2−/− Mice (2017) (4)
Dual Infection with Mycobacterium tuberculosis and Mycobacterium leprae at Same Site in an Immunocompetent Patient: An Unusual Presentation (2017) (4)
Low Prevalence of Mutations in Known Loci for Autosomal Dominant Hypercholesterolemia in a Multi-Ethnic Patient Cohort Running title : (2012) (3)
Assessment of efficacy and safety of volanesorsen for treatment of metabolic complications in patients with familial partial lipodystrophy: Results of the BROADEN study: Volanesorsen in FPLD; The BROADEN Study. (2022) (3)
Erratum to “Laminopathies: Multisystem dystrophy syndromes” [Mol. Genet. Metab. 87 (2006) 289–302] (2006) (3)
Therapeutic perspectives in hyperlipidemic patients with diabetes mellitus. (1990) (3)
Heterozygous Null LDLR Mutation in a Familial Hypercholesterolemia Patient With an Atypical Presentation Because of Alcohol Abuse (2017) (3)
The Effect of Dietary Counseling on Nutrient Intakes in Gastric Banding Surgery Patients (2013) (3)
Congenital generalized lipodystrophy (2016) (3)
Compound heterozygous familial hypercholesterolemia in a Chinese boy with a de novo and transmitted low-density lipoprotein receptor mutation. (2018) (3)
NICOTINIC ACID IN NIDDM. AUTHOR'S REPLY (1990) (3)
Reference Module in Biomedical Research (2014) (2)
Eruptive Xanthomas Masquerading as Molluscum Contagiosum (2014) (2)
Effect of a High Fiber Diet Compared to a Moderate Fiber Diet on Calcium and Other Mineral Balance in Subjects with Type 2 Diabetes Mellitus (2009) (2)
Optimum dietary therapy for patients with non-insulin-dependent diabetes mellitus (1996) (2)
Decreased caveolae in AGPAT2 lacking adipocytes is independent of changes in cholesterol or sphingolipid levels: A whole cell and plasma membrane lipidomic analysis of adipogenesis. (2021) (2)
Dietary Monounsaturated Fatty Acids for Patients with Diabetes Mellitus (1993) (2)
Caveolar Dysfunction and Lipodystrophies. (2021) (2)
Lack of cardiovascular disease among old order amish with familial defective apolipoprotein B. (2011) (2)
Treating dyslipidemia in patients with non-insulin-dependent diabetes mellitus (1988) (2)
CLINICAL CASE SEMINAR Postmortem Findings in Congenital Generalized Lipodystrophy (1995) (2)
LMNA mutations identify a new genetic subset of subjects with progeroid features of werner syndrome (2003) (1)
Approach to Diagnosing a Pediatric Patient With Severe Insulin Resistance in Low- or Middle-income Countries (2021) (1)
Phenotypic Differences Among Familial Partial Lipodystrophy Due to LMNA or PPARG Variants (2022) (1)
Update - Treatment of diabetes mellitus (1984) (1)
SUN-LB111 Comparison of Phenotype and Metabolic Abnormalities Among Familial Partial Lipodystrophy Due to LMNA or PPARG Variants (2020) (1)
Estimating Quality of Life of Patients with Lipodystrophy (2015) (1)
Letters to the EditorThiazolidinedione-Associated Congestive Heart Failure and Pulmonary Edema: In Response (2004) (1)
Abstract: 147 CHREBP MEDIATES THE DEVELOPMENT OF HEPATIC STEATOSIS IN THE APGAT2 DEFICIENT MICE (2009) (1)
High monounsaturated fat diet for non-insulin-dependent diabetes mellitus. (1989) (1)
Total reversal of weight loss from adjustable gastric banding surgery associated with excessive intake of energy dense liquid and solid foods: A case report. (2011) (1)
Chapter 91 – Genetic Lipodystrophies (2013) (1)
Associated with Lipodystrophy, Undescended Testes, and Male Hypogonadism A Novel Syndrome of Mandibular Hypoplasia, Deafness, and Progeroid Features (2010) (1)
High-carbohydrate, low-fat diet? Negative. (1992) (1)
Autosomal recessive progeroid syndrome due to homozygosity for a TOMM7 variant (2022) (1)
Bile Acid Sequestrants: Risk–Benefits and Role in Treating Dyslipidemias (2015) (1)
Chapter 23 – Lipodystrophies (2016) (1)
Lipodystrophies and dyslipidemias (2015) (1)
UPDATE Update on Dyslipidemia (2007) (1)
The Effect of Dietary Counseling on Nutrient Intakes in Bariatric Surgery Patients (2011) (0)
Use of leptin for treatment of lipoatropr predisposition towards the treatment (2002) (0)
Lipodystrophies, dyslipidaemias and atherosclerotic vascular disease (2019) (0)
Molecular basis of lipodystrophies and other disorders or adipose tissue (2002) (0)
High volume cardiorespiratory endurance exercise (CREE) improves physical fitness in obese bariatric surgery patients in a randomized controlled trial (2010) (0)
SUN-135 Dual Energy X-Ray Absorptiometry (DEXA) as a Diagnostic Tool for Familial Partial Lipodystrophy, Dunnigan Variety (FPLD2) (2019) (0)
Novel Heterozygous LMNA Variants Causing Familial Partial Lipodystrophy, Dunnigan Variety (2021) (0)
Not all patients with type 2 diabetes may need statins (2004) (0)
Classification of non-hiv lipodystrophy in the us using electronic Medical Record (EMR) Data And Physician Notes (2015) (0)
Abnormal White Matter and Gray Matter Maturation in Premature Neonates with Periventricular Hemorrhagic Infarction: A Diffusion Tensor Imaging Study (2009) (0)
"Hypothyroidism: The Cardiovascular Perspective" (2012) (0)
High cholesterol in diabetic patients: How can it be lowered? (1992) (0)
Cholic Acid for Hepatic Steatosis in Patients with Lipodystrophy: A Randomized, 1 (2013) (0)
What LDL target to aim for in diabetic patients (1999) (0)
Atypical diabetes mellitus: beginning of precision medicine (2018) (0)
Face-sparing Congenital Generalized Lipodystrophy Type 1 Associated With Nonclassical Congenital Adrenal Hyperplasia. (2022) (0)
CHAPTER 7 MONOGENIC FORMS OF DIABETES (2016) (0)
Phenotypic and Genetic Heterogeneity in Congenital Generalized Lipodystrophy C ONGENITAL GENERALIZED LIPODYSTROPHY [CGL; Berardinelli-Seip syndrome, Online Mendelian Inheritance (2003) (0)
The use of leptin to treat lipoatrophy in humans, and method for determining a predisposition to this treatment (2002) (0)
Restrictive dermopathy due to ZMPSTE24 deficiency. (2023) (0)
Poster session 2 (2011) (0)
Nicotinic Acid in NIDDM-Reply (1990) (0)
Insulin resistance and atherosclerosis. (1996) (0)
VARYING CARBOHYDRATES INTAKE IN NIDDM. AUTHOR'S REPLY (1994) (0)
Use of leptin for the treatment of human lipoatrophy and method the determining predisposition to such treatment. (2002) (0)
Diet-Responsive Hypercholesterolemia With Cardiofaciocutaneous Syndrome Type 3 (2021) (0)
Novel Lipid-Lowering Agents (2015) (0)
A Case of Klippel Trenaunay Syndrome with Vein of Servelle (2019) (0)
Dietary recommendations for patients with non-insulin-dependent diabetes mellitus. (1991) (0)
Varying Carbohydrate Intake in NIDDM-Reply (1994) (0)
Familial Partial Lipodystrophy Presenting as Extreme Hypertriglyceridemia and Acute Pancreatitis (2022) (0)
Familial Hypercholesterolemia: A Role for Genetic Screening in Women†∗ (2014) (0)
A New Lipodystrophy Syndrome (2014) (0)
Abstract 20361: Statin-Induced Myopathy in Patients With Familial Hypercholesterolemia (2014) (0)
SAT-087 Familial Generalized Lipodystrophy in Two Siblings Due to Homozygous p.Arg545His LMNA Mutation (2019) (0)
076 The association between acculturation and dietary patterns of South Asian immigrants to Canada (2011) (0)
Lipodystrophies. (2020) (0)
A Novel Syndrome With Short Stature, Mandibular Hypoplasia, and Osteoporosis May Be Associated With a PRRT3 Variant (2020) (0)
CTCTCCTGGGCATCACTAGA CAAGTCCACAGTCTGGCTCT Dagk 1 GGCTGAGAAGACCAAGTCAA TCTAGATATTCGGCCACTCG Dagk 2 GCCACCTACCACAATCTGTC AACTAGAAGCGGATGTGTGC Dagk 3 GAATGTTCTCTGTGCCTGCT CCTAAGCAGGAGGACTTTCC Dagk 4 AGCGAAAAGTGTGACTTTGG TCAAACACCTGGACTGGATT Dagk 5 AGTGTTGCATGGTGAGGAAT CTCATCTTTCAGCCGAGTGT Dagk 6 GTCTTG (2014) (0)
Factors 9 and 13 Cooperate to Maintain Mammalian Neuronal Differentiation (2020) (0)
MON-695 Multiple Recurrent Lipomatoses with Thiazolidinedione Therapy in Familial Partial Lipodystrophy, Dunnigan Variety (FPLD2) (2020) (0)
Restrictive dermopathy due to ZMPSTE24 deficiency. (2023) (0)
Cardiovascular actions of fish oils and omega-3 fatty acids (1991) (0)
A unique model for evaluating obesity cardiomyopathy: Can less mean more? (2012) (0)
Use of leptin for the treatment of human lipoatrophy and method for determining the predisposition to behandlinngen (2002) (0)
A Novel Autosomal Recessive, Progeroid syndrome with Short Stature, Mandibular Hypoplasia, Osteoporosis and Short Eyebrows due to a Homozygous Mutation in PRRT3 (2019) (0)
Mandibuloacral Dysplasia: 28 years follow-up in a female patient (2004) (0)
Atypical Forms of Type 2 Diabetes (2008) (0)
Characterizing familial partial lipodystrophy: Baseline data of the BROADEN study (2020) (0)
SAT-572 Extremely Elevated Plasma Lipoprotein X Level Secondary to Alcoholic Cholestasis (2020) (0)
Effect of 6 Months Therapy with Metreleptin in an African American Boy with Congenital Generalised Lipodystrophy (2015) (0)

This paper list is powered by the following services:

What Schools Are Affiliated With Abhimanyu Garg?

Abhimanyu Garg is affiliated with the following schools:

Abhimanyu Garg's Academic­Influence.com Rankings

Abhimanyu Garg's Degrees

Similar Degrees You Can Earn

Why Is Abhimanyu Garg Influential?

Abhimanyu Garg's Published Works

Published Works

What Schools Are Affiliated With Abhimanyu Garg?

Abhimanyu Garg's AcademicInfluence.com Rankings