Abhimanyu Garg
#126,458
Most Influential Person Now
Researcher
Abhimanyu Garg's AcademicInfluence.com Rankings
Abhimanyu Gargcomputer-science Degrees
Computer Science
#5341
World Rank
#5641
Historical Rank
Computational Linguistics
#722
World Rank
#734
Historical Rank
Machine Learning
#1381
World Rank
#1402
Historical Rank
Artificial Intelligence
#1616
World Rank
#1646
Historical Rank

Download Badge
Computer Science
Abhimanyu Garg's Degrees
- PhD Computer Science Stanford University
- Masters Computer Science Stanford University
- Bachelors Computer Science Stanford University
Similar Degrees You Can Earn
Why Is Abhimanyu Garg Influential?
(Suggest an Edit or Addition)Abhimanyu Garg's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Leptin-replacement therapy for lipodystrophy. (2002) (1110)
- Evidence-based nutrition principles and recommendations for the treatment and prevention of diabetes and related complications. (2002) (1071)
- Beneficial effects of high dietary fiber intake in patients with type 2 diabetes mellitus. (2000) (1063)
- Acquired and inherited lipodystrophies. (2004) (824)
- Relationships of generalized and regional adiposity to insulin sensitivity in men. (1995) (783)
- Measurement of intracellular triglyceride stores by H spectroscopy: validation in vivo. (1999) (576)
- The lipodystrophy protein seipin is found at endoplasmic reticulum lipid droplet junctions and is important for droplet morphology (2007) (531)
- AGPAT2 is mutated in congenital generalized lipodystrophy linked to chromosome 9q34 (2002) (487)
- Relationship between generalized and upper body obesity to insulin resistance in Asian Indian men. (1999) (447)
- Clinical review#: Lipodystrophies: genetic and acquired body fat disorders. (2011) (440)
- High-monounsaturated-fat diets for patients with diabetes mellitus: a meta-analysis. (1998) (435)
- Comparison of a high-carbohydrate diet with a high-monounsaturated-fat diet in patients with non-insulin-dependent diabetes mellitus. (1988) (421)
- Effects of varying carbohydrate content of diet in patients with non-insulin-dependent diabetes mellitus. (1994) (419)
- Review: long-term impact of bariatric surgery on body weight, comorbidities, and nutritional status. (2006) (411)
- Zinc metalloproteinase, ZMPSTE24, is mutated in mandibuloacral dysplasia. (2003) (389)
- Nutrition principles and recommendations in diabetes. (2004) (377)
- Relationship of Generalized and Regional Adiposity to Insulin Sensitivity in Men With NIDDM (1996) (326)
- Evidence-based nutrition principles and recommendations for the treatment and prevention of diabetes and related complications. (2003) (324)
- Nicotinic acid as therapy for dyslipidemia in non-insulin-dependent diabetes mellitus. (1990) (291)
- PSMB8 encoding the β5i proteasome subunit is mutated in joint contractures, muscle atrophy, microcytic anemia, and panniculitis-induced lipodystrophy syndrome. (2010) (290)
- Management of Dyslipidemia in NIDDM (1990) (273)
- The Diagnosis and Management of Lipodystrophy Syndromes: A Multi-Society Practice Guideline (2016) (268)
- Seipin is required for converting nascent to mature lipid droplets (2016) (261)
- A Novel Heterozygous Mutation in Peroxisome Proliferator-Activated Receptor-γ Gene in a Patient with Familial Partial Lipodystrophy (2002) (252)
- Partial lipodystrophy and insulin resistant diabetes in a patient with a homozygous nonsense mutation in CIDEC (2009) (250)
- Comparison of Effects of High and Low Carbohydrate Diets on Plasma Lipoproteins and Insulin Sensitivity in Patients With Mild NIDDM (1992) (247)
- Clinical Features and Metabolic and Autoimmune Derangements in Acquired Partial Lipodystrophy: Report of 35 Cases and Review of the Literature (2004) (244)
- Phenotypic and genetic heterogeneity in congenital generalized lipodystrophy. (2003) (224)
- Adipose tissue distribution pattern in patients with familial partial lipodystrophy (Dunnigan variety). (1999) (221)
- Lipodystrophy in Human Immunodeficiency Virus-Infected Patients (2002) (221)
- Molecular mechanisms of hepatic steatosis and insulin resistance in the AGPAT2-deficient mouse model of congenital generalized lipodystrophy. (2009) (207)
- Relationship of anterior and posterior subcutaneous abdominal fat to insulin sensitivity in nondiabetic men. (1997) (207)
- Adipose tissue dysfunction in obesity and lipodystrophy. (2006) (200)
- Cholestyramine Therapy for Dyslipidemia in NonInsulin-dependent Diabetes Mellitus: A Short-Term, Double-Blind, Crossover Trial (1994) (199)
- Serum adiponectin and leptin levels in patients with lipodystrophies. (2004) (196)
- Regional adiposity and insulin resistance. (2004) (194)
- Clinical Features and Metabolic Derangements in Acquired Generalized Lipodystrophy: Case Reports and Review of the Literature (2003) (192)
- Sex steroid hormones, upper body obesity, and insulin resistance. (2002) (192)
- A gene for congenital generalized lipodystrophy maps to human chromosome 9q34. (1999) (187)
- Congenital generalized lipodystrophies—new insights into metabolic dysfunction (2015) (187)
- LMNA mutations in atypical Werner's syndrome (2003) (178)
- Lipodystrophies: disorders of adipose tissue biology. (2009) (175)
- Lovastatin for lowering cholesterol levels in non-insulin-dependent diabetes mellitus. (1988) (166)
- American Diabetes Association position statement: evidence-based nutrition principles and recommendations for the treatment and prevention of diabetes and related complications. (2002) (164)
- Congenital generalized lipodystrophy: significance of triglyceride biosynthetic pathways (2003) (163)
- Measurement of intracellular triglyceride stores by H spectroscopy: validation in vivo. (1999) (163)
- Gender differences in the prevalence of metabolic complications in familial partial lipodystrophy (Dunnigan variety). (2000) (161)
- Phenotypic heterogeneity in body fat distribution in patients with congenital generalized lipodystrophy caused by mutations in the AGPAT2 or seipin genes. (2003) (159)
- Serum adiponectin and leptin levels in patients with lipodystrophies (2002) (158)
- Relationship between lipoprotein levels and in vivo insulin action in normal young white men. (1988) (158)
- Localization of the gene for familial partial lipodystrophy (Dunnigan variety) to chromosome 1q21–22 (1998) (156)
- Genetic disorders of adipose tissue development, differentiation, and death. (2006) (153)
- Genetic basis of lipodystrophies and management of metabolic complications. (2006) (149)
- Multisystem dystrophy syndrome due to novel missense mutations in the amino-terminal head and alpha-helical rod domains of the lamin A/C gene. (2002) (149)
- A novel heterozygous mutation in peroxisome proliferator-activated receptor-gamma gene in a patient with familial partial lipodystrophy. (2002) (135)
- Lipodystrophy Syndromes. (2016) (130)
- Genetic and phenotypic heterogeneity in patients with mandibuloacral dysplasia-associated lipodystrophy. (2003) (128)
- Lipodystrophies: rare disorders causing metabolic syndrome. (2004) (126)
- Laminopathies: multisystem dystrophy syndromes. (2006) (122)
- Effect of leptin replacement on intrahepatic and intramyocellular lipid content in patients with generalized lipodystrophy. (2003) (121)
- Phenotypic heterogeneity in patients with familial partial lipodystrophy (dunnigan variety) related to the site of missense mutations in lamin a/c gene. (2001) (121)
- High‐Volume Exercise Program in Obese Bariatric Surgery Patients: A Randomized, Controlled Trial (2011) (120)
- Update on dyslipidemia. (2007) (118)
- Atypical progeroid syndrome due to heterozygous missense LMNA mutations. (2009) (117)
- Hepatic steatosis, insulin resistance, and adipose tissue disorders. (2002) (113)
- Peculiar distribution of adipose tissue in patients with congenital generalized lipodystrophy. (1992) (113)
- Congenital generalized lipodystrophy, type 4 (CGL4) associated with myopathy due to novel PTRF mutations (2010) (113)
- Lipodystrophy: lessons in lipid and energy metabolism (2006) (112)
- Heterogeneity in adipose tissue metabolism: causes, implications and management of regional adiposity. (1995) (105)
- Effect of high-carbohydrate or high-cis-monounsaturated fat diets on blood pressure: a meta-analysis of intervention trials. (2007) (105)
- Insulin Resistance in the Pathogenesis of Dyslipidemia (1996) (104)
- Gemfibrozil Alone and in Combination With Lovastatin for Treatment of Hypertriglyceridemia in NIDDM (1989) (101)
- Autoantibodies against GPIHBP1 as a Cause of Hypertriglyceridemia (2017) (100)
- Body fat distribution and metabolic derangements in patients with familial partial lipodystrophy associated with mandibuloacral dysplasia. (2002) (94)
- Clinical review 153: Lipodystrophy in human immunodeficiency virus-infected patients. (2002) (91)
- The clinical approach to the detection of lipodystrophy - an AACE consensus statement. (2013) (90)
- An autosomal recessive syndrome of joint contractures, muscular atrophy, microcytic anemia, and panniculitis-associated lipodystrophy. (2010) (89)
- Effect of High Carbohydrate Intake on Hyperglycemia, Islet Function, and Plasma Lipoproteins in NIDDM (1992) (88)
- Deletion of GPIHBP1 causing severe chylomicronemia (2011) (88)
- Comparison of efficacy and safety of leptin replacement therapy in moderately and severely hypoleptinemic patients with familial partial lipodystrophy of the Dunnigan variety. (2012) (83)
- High-Fat and High-Carbohydrate Diets and Energy Balance (1996) (76)
- Seipin: a mysterious protein. (2004) (74)
- Estimating the prevalence of generalized and partial lipodystrophy: findings and challenges (2017) (72)
- Functional characterization of human 1-acylglycerol-3-phosphate acyltransferase isoform 8: cloning, tissue distribution, gene structure, and enzymatic activity. (2006) (70)
- Human 1-Acylglycerol-3-phosphate O-Acyltransferase Isoforms 1 and 2 (2011) (66)
- Whole exome sequencing identifies de novo heterozygous CAV1 mutations associated with a novel neonatal onset lipodystrophy syndrome (2015) (66)
- Cardiac steatosis and left ventricular hypertrophy in patients with generalized lipodystrophy as determined by magnetic resonance spectroscopy and imaging. (2013) (65)
- Enzymatic activities of the human AGPAT isoform 3 and isoform 5: localization of AGPAT5 to mitochondria[S] (2011) (65)
- Risk factors for diabetes in familial partial lipodystrophy, Dunnigan variety. (2003) (64)
- Focal Segmental Glomerulosclerosis in Patients with Mandibuloacral Dysplasia Owing to ZMPSTE24 Deficiency (2006) (62)
- Leptin, its receptor and obesity. (1996) (61)
- Inherited lipodystrophies and hypertriglyceridemia (2009) (61)
- A novel syndrome of mandibular hypoplasia, deafness, and progeroid features associated with lipodystrophy, undescended testes, and male hypogonadism. (2010) (61)
- Natural History of Congenital Generalized Lipodystrophy: A Nationwide Study From Turkey. (2016) (60)
- A novel homozygous Ala529Val LMNA mutation in Turkish patients with mandibuloacral dysplasia. (2005) (60)
- LMNA mutations in atypical Werner's syndrome (2003) (58)
- Hepatic Steatosis, Insulin Resistance, and Adipose Tissue Disorders (2002) (58)
- Lipodystrophies, dyslipidaemias and atherosclerotic cardiovascular disease. (2019) (57)
- Thiazolidinedione-associated congestive heart failure and pulmonary edema. (2003) (57)
- Genetic basis of congenital generalized lipodystrophy (2004) (56)
- Treatment of diabetic dyslipidemia. (1998) (54)
- Functional characterization of the human 1-acylglycerol-3-phosphate-O-acyltransferase isoform 10/glycerol-3-phosphate acyltransferase isoform 3. (2009) (54)
- Enzymatic activity of naturally occurring 1-acylglycerol-3-phosphate-O-acyltransferase 2 mutants associated with congenital generalized lipodystrophy. (2005) (54)
- Caveolin-1: a new locus for human lipodystrophy. (2008) (54)
- High—Monounsaturated Fat Diet for Diabetic Patients: Is it time to change the current dietary recommendations? (1994) (53)
- Low Prevalence of Mutations in Known Loci for Autosomal Dominant Hypercholesterolemia in a Multiethnic Patient Cohort (2012) (52)
- Genotype-phenotype relationships in patients with type I hyperlipoproteinemia. (2014) (51)
- Enzymatic activity of the human 1-acylglycerol-3-phosphate-O-acyltransferase isoform 11: upregulated in breast and cervical cancers[S] (2010) (50)
- Functional characterization of human 1-acylglycerol-3-phosphate-O-acyltransferase isoform 9: cloning, tissue distribution, gene structure, and enzymatic activity. (2007) (49)
- Severe mandibuloacral dysplasia-associated lipodystrophy and progeria in a young girl with a novel homozygous Arg527Cys LMNA mutation. (2008) (49)
- Early onset mandibuloacral dysplasia due to compound heterozygous mutations in ZMPSTE24 (2010) (48)
- Effect of subcutaneous leptin replacement therapy on bone metabolism in patients with generalized lipodystrophy. (2002) (45)
- The ongoing saga of obestatin: is it a hormone? (2007) (45)
- Leptin ameliorates insulin resistance and hepatic steatosis in Agpat2−/− lipodystrophic mice independent of hepatocyte leptin receptors[S] (2014) (45)
- Sitosterolemia presenting with severe hypercholesterolemia and intertriginous xanthomas in a breastfed infant: case report and brief review. (2014) (44)
- Novel subtype of congenital generalized lipodystrophy associated with muscular weakness and cervical spine instability (2008) (44)
- Bi-allelic POLR3A Loss-of-Function Variants Cause Autosomal-Recessive Wiedemann-Rautenstrauch Syndrome. (2018) (43)
- Severe Islet Amyloidosis in Congenital Generalized Lipodystrophy (1996) (43)
- Defining hypercalciuria in nephrolithiasis. (2011) (40)
- Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy (2017) (40)
- A Novel Generalized Lipodystrophy-Associated Progeroid Syndrome Due to Recurrent Heterozygous LMNA p.T10I Mutation (2018) (39)
- Statins for all patients with type 2 diabetes: not so soon (2004) (37)
- Nutrient and Food Intake in Obese Women on a Low-Fat or Low-Calorie Diet (1996) (36)
- Mutations in the seipin and AGPAT2 genes clustering in consanguineous families with Berardinelli-Seip congenital lipodystrophy from two separate geographical regions of Brazil. (2004) (36)
- Management of Dyslipidemia in IPPM Patients (1994) (35)
- A homozygous mutation in the lamin A/C gene associated with a novel syndrome of arthropathy, tendinous calcinosis, and progeroid features. (2006) (35)
- Effects of dietary carbohydrates on metabolism of calcium and other minerals in normal subjects and patients with noninsulin-dependent diabetes mellitus. (1990) (34)
- A truncated species of apolipoprotein B, B-83, associated with hypobetalipoproteinemia. (1992) (33)
- Body fat distribution and metabolic variables in patients with neonatal progeroid syndrome (2007) (33)
- Phenotypic heterogeneity in body fat distribution in patients with atypical Werner's syndrome due to heterozygous Arg133Leu lamin A/C mutation. (2005) (32)
- Increased skeletal muscle volume in women with familial partial lipodystrophy, Dunnigan variety. (2013) (31)
- Lipid-Lowering Therapy and Macrovascular Disease in Diabetes Mellitus (1992) (31)
- Abnormal cholesterol distribution among lipoprotein fractions in normolipidemic patients with mild NIDDM. (1995) (30)
- Non-Hodgkin's lymphoma in pregnancy. (1985) (30)
- Efficacy and Safety of Metreleptin Therapy in Patients With Type 1 Diabetes: A Pilot Study (2017) (30)
- Adipocyte biology and adipocytokines. (2004) (28)
- Lipodystrophies: Genetic and Acquired Body Fat Disorders (2011) (28)
- Extreme hypercholesterolemia presenting with pseudohyponatremia - a case report and review of the literature. (2015) (28)
- Type 1 hyperlipoproteinemia and recurrent acute pancreatitis due to lipoprotein lipase antibody in a young girl with Sjogren's syndrome. (2011) (27)
- AGPAT2 is essential for postnatal development and maintenance of white and brown adipose tissue (2016) (26)
- Whole-exome sequencing identifies ADRA2A mutation in atypical familial partial lipodystrophy. (2016) (25)
- Congenital generalized lipodystrophy: identification of novel variants and expansion of clinical spectrum (2016) (25)
- Skeletal muscle morphology and exercise response in congenital generalized lipodystrophy. (2000) (25)
- Mogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic (Agpat2−/−) or obese (ob/ob) mice (2016) (24)
- Effect of a High-Fiber Diet Compared With a Moderate-Fiber Diet on Calcium and Other Mineral Balances in Subjects With Type 2 Diabetes (2009) (23)
- A Novel Syndrome of Generalized Lipodystrophy Associated With Pilocytic Astrocytoma. (2015) (22)
- Effect of a high-carbohydrate versus a high--cis-monounsaturated fat diet on blood pressure in patients with type 2 diabetes. (2005) (22)
- Mislocalization of prelamin A Tyr646Phe mutant to the nuclear pore complex in human embryonic kidney 293 cells. (2007) (22)
- Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants (2018) (22)
- CLINICAL ENDOCRINOLOGY & METABOLISM (1992) (21)
- Regional Body Fat Distribution in HIV-Infected Patients with Lipodystrophy (2005) (21)
- Very Severe Hypertriglyceridemia in a Large US County Health Care System: Associated Conditions and Management (2019) (21)
- Efficacy of Metreleptin Treatment in Familial Partial Lipodystrophy Due to PPARG vs LMNA Pathogenic Variants. (2019) (21)
- Inseparable iduronic acid-containing proteoglycan PG(IdoA) preparations of human skin and post-burn scar tissues: evidence for elevated levels of PG(IdoA)-I in hypertrophic scar by N-terminal sequencing. (1996) (20)
- Diabetic dyslipidemia and its therapy (1997) (20)
- The prevalence and etiology of extreme hypertriglyceridemia in children: Data from a tertiary children's hospital. (2018) (19)
- Spectrum of clinical manifestations in two young Turkish patients with congenital generalized lipodystrophy type 4. (2016) (19)
- Metabolic, Reproductive, and Neurologic Abnormalities in Agpat1-Null Mice (2017) (18)
- Blepharoptosis and external ophthalmoplegia associated with long-term antiretroviral therapy. (2008) (18)
- De novo heterozygous FBN1 mutations in the extreme C‐terminal region cause progeroid fibrillinopathy (2014) (18)
- Dyslipoproteinemia and diabetes. (1998) (18)
- Premature coronary heart disease and autosomal dominant hypercholesterolemia: Increased risk in women with LDLR mutations. (2016) (16)
- Comparison of nutrient intakes in South Asians with type 2 diabetes mellitus and controls living in the United States. (2018) (16)
- Cholic acid for hepatic steatosis in patients with lipodystrophy: a randomized, controlled trial. (2013) (16)
- Treatment of dyslipidemia in patients with NIDDM (1995) (16)
- The Role of Body Fat Distribution in Insulin Resistance (1999) (16)
- Type 1 hyperlipoproteinemia in a child with large homozygous deletion encompassing GPIHBP1. (2016) (15)
- What is the role of alternative biomarkers for coronary heart disease? (2011) (14)
- Lipodystrophy: An Unusual Diagnosis in a Case of Oligomenorrhea and Hirsutism (2009) (14)
- Extreme hypertriglyceridemia, pseudohyponatremia, and pseudoacidosis in a neonate with lipoprotein lipase deficiency due to segmental uniparental disomy. (2017) (14)
- Dyslipidemias: Pathophysiology, evaluation and management (2015) (13)
- Treatment of dyslipidemia in non-insulin-dependent diabetes mellitus with lovastatin. (1988) (13)
- Hepatic Gluconeogenesis Is Enhanced by Phosphatidic Acid Which Remains Uninhibited by Insulin in Lipodystrophic Agpat2−/− Mice* (2014) (13)
- Insights into lipid accumulation in skeletal muscle in dysferlin-deficient mice[S] (2019) (12)
- Orlistat Therapy for Children With Type 1 Hyperlipoproteinemia: A Randomized Clinical Trial (2018) (11)
- Insulin Resistance and Atherosclerosis: An overview (1996) (11)
- Serum low-density lipoprotein cholesterol response to modification of saturated fat intake: recent insights. (1997) (10)
- Molecular Characterization of Familial Hypercholesterolemia in a North American Cohort. (2019) (10)
- Juvenile‐onset generalized lipodystrophy due to a novel heterozygous missense LMNA mutation affecting lamin C (2017) (10)
- Postmortem Findings in a Young Man With Congenital Generalized Lipodystrophy, Type 4 Due to CAVIN1 Mutations. (2018) (10)
- Characterization of the Mouse and Human Monoacylglycerol O-Acyltransferase 1 (Mogat1) Promoter in Human Kidney Proximal Tubule and Rat Liver Cells (2016) (9)
- Type 1 Hyperlipoproteinemia Due to Compound Heterozygous Rare Variants in GCKR. (2016) (9)
- Efficacy of dietary fiber in lowering serum cholesterol. (1994) (9)
- Progeroid syndrome patients with ZMPSTE24 deficiency could benefit when treated with rapamycin and dimethylsulfoxide (2017) (8)
- Lipodystrophies and Diabetes (2003) (8)
- Iduronic acid-rich proteoglycans (PGIdoA) and human post-burn scar maturation: isolation and characterization. (1995) (8)
- Erratum: Gemfibrozil alone and in combination with lovastatin for treatment of hypertriglyceridemia in NIDDM (Diabetes (1989) 38 (364-72)) (1990) (8)
- Diagnostic value of Anthropometric Measurements for Familial Partial Lipodystrophy, Dunnigan variety. (2020) (8)
- Absence of AGPAT2 impairs brown adipogenesis, increases IFN stimulated gene expression and alters mitochondrial morphology. (2020) (7)
- Effect of a high-carbohydrate vs a high-cis-monounsaturated fat diet on lipid and lipoproteins in individuals with and without type 2 diabetes (2004) (7)
- JCL roundtable: Diagnosis and clinical management of lipodystrophy. (2016) (6)
- HMGA1, a novel locus for type 2 diabetes mellitus. (2011) (6)
- Marked lowering of high-density lipoprotein cholesterol levels due to high dose bexarotene therapy. (2015) (5)
- Severe Liver Injury Associated With High-Dose Atorvastatin Therapy (2021) (5)
- Multisystem Progeroid Syndrome With Lipodystrophy, Cardiomyopathy, and Nephropathy Due to an LMNA p.R349W Variant (2020) (5)
- A novel autosomal recessive lipodystrophy syndrome due to homozygous LMNA variant (2019) (5)
- Autoantibodies against GPIHBP 1 as a Cause of Hypertriglyceridemia (2017) (5)
- A novel paraneoplastic syndrome with acquired lipodystrophy and chronic inflammatory demyelinating polyneuropathy in an adolescent male with craniopharyngioma (2018) (4)
- Cirrhosis‐induced pseudoglucagonoma syndrome in a patient with Type 2 Diabetes: an autopsy study (2011) (4)
- Efficacy and safety of volanesorsen for the treatment of metabolic complications in patients with familial partial lipodystrophy: results of the BROADEN study (2020) (4)
- The relationships between macronutrient and micronutrient intakes and type 2 diabetes mellitus in South Asians: A review. (2019) (4)
- The effect of dietary intervention on serum lipid levels in type 2 diabetes mellitus (2002) (4)
- Aplastic anaemia in pregnancy (1982) (4)
- Human AGPAT isoforms 1 and 2 : Biochemical characterization and their inability to rescue hepatic steatosis in Agpat 2-/-lipodystrophic mice (2011) (4)
- Lipodystrophy for the Diabetologist—What to Look For (2022) (4)
- Activation of Sphingolipid Pathway in the Livers of Lipodystrophic Agpat2−/− Mice (2017) (4)
- Dual Infection with Mycobacterium tuberculosis and Mycobacterium leprae at Same Site in an Immunocompetent Patient: An Unusual Presentation (2017) (4)
- Low Prevalence of Mutations in Known Loci for Autosomal Dominant Hypercholesterolemia in a Multi-Ethnic Patient Cohort Running title : (2012) (3)
- Assessment of efficacy and safety of volanesorsen for treatment of metabolic complications in patients with familial partial lipodystrophy: Results of the BROADEN study: Volanesorsen in FPLD; The BROADEN Study. (2022) (3)
- Erratum to “Laminopathies: Multisystem dystrophy syndromes” [Mol. Genet. Metab. 87 (2006) 289–302] (2006) (3)
- Therapeutic perspectives in hyperlipidemic patients with diabetes mellitus. (1990) (3)
- Heterozygous Null LDLR Mutation in a Familial Hypercholesterolemia Patient With an Atypical Presentation Because of Alcohol Abuse (2017) (3)
- The Effect of Dietary Counseling on Nutrient Intakes in Gastric Banding Surgery Patients (2013) (3)
- Congenital generalized lipodystrophy (2016) (3)
- Compound heterozygous familial hypercholesterolemia in a Chinese boy with a de novo and transmitted low-density lipoprotein receptor mutation. (2018) (3)
- NICOTINIC ACID IN NIDDM. AUTHOR'S REPLY (1990) (3)
- Reference Module in Biomedical Research (2014) (2)
- Eruptive Xanthomas Masquerading as Molluscum Contagiosum (2014) (2)
- Effect of a High Fiber Diet Compared to a Moderate Fiber Diet on Calcium and Other Mineral Balance in Subjects with Type 2 Diabetes Mellitus (2009) (2)
- Optimum dietary therapy for patients with non-insulin-dependent diabetes mellitus (1996) (2)
- Decreased caveolae in AGPAT2 lacking adipocytes is independent of changes in cholesterol or sphingolipid levels: A whole cell and plasma membrane lipidomic analysis of adipogenesis. (2021) (2)
- Dietary Monounsaturated Fatty Acids for Patients with Diabetes Mellitus (1993) (2)
- Caveolar Dysfunction and Lipodystrophies. (2021) (2)
- Lack of cardiovascular disease among old order amish with familial defective apolipoprotein B. (2011) (2)
- Treating dyslipidemia in patients with non-insulin-dependent diabetes mellitus (1988) (2)
- CLINICAL CASE SEMINAR Postmortem Findings in Congenital Generalized Lipodystrophy (1995) (2)
- LMNA mutations identify a new genetic subset of subjects with progeroid features of werner syndrome (2003) (1)
- Approach to Diagnosing a Pediatric Patient With Severe Insulin Resistance in Low- or Middle-income Countries (2021) (1)
- Phenotypic Differences Among Familial Partial Lipodystrophy Due to LMNA or PPARG Variants (2022) (1)
- Update - Treatment of diabetes mellitus (1984) (1)
- SUN-LB111 Comparison of Phenotype and Metabolic Abnormalities Among Familial Partial Lipodystrophy Due to LMNA or PPARG Variants (2020) (1)
- Estimating Quality of Life of Patients with Lipodystrophy (2015) (1)
- Letters to the EditorThiazolidinedione-Associated Congestive Heart Failure and Pulmonary Edema: In Response (2004) (1)
- Abstract: 147 CHREBP MEDIATES THE DEVELOPMENT OF HEPATIC STEATOSIS IN THE APGAT2 DEFICIENT MICE (2009) (1)
- High monounsaturated fat diet for non-insulin-dependent diabetes mellitus. (1989) (1)
- Total reversal of weight loss from adjustable gastric banding surgery associated with excessive intake of energy dense liquid and solid foods: A case report. (2011) (1)
- Chapter 91 – Genetic Lipodystrophies (2013) (1)
- Associated with Lipodystrophy, Undescended Testes, and Male Hypogonadism A Novel Syndrome of Mandibular Hypoplasia, Deafness, and Progeroid Features (2010) (1)
- High-carbohydrate, low-fat diet? Negative. (1992) (1)
- Autosomal recessive progeroid syndrome due to homozygosity for a TOMM7 variant (2022) (1)
- Bile Acid Sequestrants: Risk–Benefits and Role in Treating Dyslipidemias (2015) (1)
- Chapter 23 – Lipodystrophies (2016) (1)
- Lipodystrophies and dyslipidemias (2015) (1)
- UPDATE Update on Dyslipidemia (2007) (1)
- The Effect of Dietary Counseling on Nutrient Intakes in Bariatric Surgery Patients (2011) (0)
- Use of leptin for treatment of lipoatropr predisposition towards the treatment (2002) (0)
- Lipodystrophies, dyslipidaemias and atherosclerotic vascular disease (2019) (0)
- Molecular basis of lipodystrophies and other disorders or adipose tissue (2002) (0)
- High volume cardiorespiratory endurance exercise (CREE) improves physical fitness in obese bariatric surgery patients in a randomized controlled trial (2010) (0)
- SUN-135 Dual Energy X-Ray Absorptiometry (DEXA) as a Diagnostic Tool for Familial Partial Lipodystrophy, Dunnigan Variety (FPLD2) (2019) (0)
- Novel Heterozygous LMNA Variants Causing Familial Partial Lipodystrophy, Dunnigan Variety (2021) (0)
- Not all patients with type 2 diabetes may need statins (2004) (0)
- Classification of non-hiv lipodystrophy in the us using electronic Medical Record (EMR) Data And Physician Notes (2015) (0)
- Abnormal White Matter and Gray Matter Maturation in Premature Neonates with Periventricular Hemorrhagic Infarction: A Diffusion Tensor Imaging Study (2009) (0)
- "Hypothyroidism: The Cardiovascular Perspective" (2012) (0)
- High cholesterol in diabetic patients: How can it be lowered? (1992) (0)
- Cholic Acid for Hepatic Steatosis in Patients with Lipodystrophy: A Randomized, 1 (2013) (0)
- What LDL target to aim for in diabetic patients (1999) (0)
- Atypical diabetes mellitus: beginning of precision medicine (2018) (0)
- Face-sparing Congenital Generalized Lipodystrophy Type 1 Associated With Nonclassical Congenital Adrenal Hyperplasia. (2022) (0)
- CHAPTER 7 MONOGENIC FORMS OF DIABETES (2016) (0)
- Phenotypic and Genetic Heterogeneity in Congenital Generalized Lipodystrophy C ONGENITAL GENERALIZED LIPODYSTROPHY [CGL; Berardinelli-Seip syndrome, Online Mendelian Inheritance (2003) (0)
- The use of leptin to treat lipoatrophy in humans, and method for determining a predisposition to this treatment (2002) (0)
- Restrictive dermopathy due to ZMPSTE24 deficiency. (2023) (0)
- Poster session 2 (2011) (0)
- Nicotinic Acid in NIDDM-Reply (1990) (0)
- Insulin resistance and atherosclerosis. (1996) (0)
- VARYING CARBOHYDRATES INTAKE IN NIDDM. AUTHOR'S REPLY (1994) (0)
- Use of leptin for the treatment of human lipoatrophy and method the determining predisposition to such treatment. (2002) (0)
- Diet-Responsive Hypercholesterolemia With Cardiofaciocutaneous Syndrome Type 3 (2021) (0)
- Novel Lipid-Lowering Agents (2015) (0)
- A Case of Klippel Trenaunay Syndrome with Vein of Servelle (2019) (0)
- Dietary recommendations for patients with non-insulin-dependent diabetes mellitus. (1991) (0)
- Varying Carbohydrate Intake in NIDDM-Reply (1994) (0)
- Familial Partial Lipodystrophy Presenting as Extreme Hypertriglyceridemia and Acute Pancreatitis (2022) (0)
- Familial Hypercholesterolemia: A Role for Genetic Screening in Women†∗ (2014) (0)
- A New Lipodystrophy Syndrome (2014) (0)
- Abstract 20361: Statin-Induced Myopathy in Patients With Familial Hypercholesterolemia (2014) (0)
- SAT-087 Familial Generalized Lipodystrophy in Two Siblings Due to Homozygous p.Arg545His LMNA Mutation (2019) (0)
- 076 The association between acculturation and dietary patterns of South Asian immigrants to Canada (2011) (0)
- Lipodystrophies. (2020) (0)
- A Novel Syndrome With Short Stature, Mandibular Hypoplasia, and Osteoporosis May Be Associated With a PRRT3 Variant (2020) (0)
- CTCTCCTGGGCATCACTAGA CAAGTCCACAGTCTGGCTCT Dagk 1 GGCTGAGAAGACCAAGTCAA TCTAGATATTCGGCCACTCG Dagk 2 GCCACCTACCACAATCTGTC AACTAGAAGCGGATGTGTGC Dagk 3 GAATGTTCTCTGTGCCTGCT CCTAAGCAGGAGGACTTTCC Dagk 4 AGCGAAAAGTGTGACTTTGG TCAAACACCTGGACTGGATT Dagk 5 AGTGTTGCATGGTGAGGAAT CTCATCTTTCAGCCGAGTGT Dagk 6 GTCTTG (2014) (0)
- Factors 9 and 13 Cooperate to Maintain Mammalian Neuronal Differentiation (2020) (0)
- MON-695 Multiple Recurrent Lipomatoses with Thiazolidinedione Therapy in Familial Partial Lipodystrophy, Dunnigan Variety (FPLD2) (2020) (0)
- Restrictive dermopathy due to ZMPSTE24 deficiency. (2023) (0)
- Cardiovascular actions of fish oils and omega-3 fatty acids (1991) (0)
- A unique model for evaluating obesity cardiomyopathy: Can less mean more? (2012) (0)
- Use of leptin for the treatment of human lipoatrophy and method for determining the predisposition to behandlinngen (2002) (0)
- A Novel Autosomal Recessive, Progeroid syndrome with Short Stature, Mandibular Hypoplasia, Osteoporosis and Short Eyebrows due to a Homozygous Mutation in PRRT3 (2019) (0)
- Mandibuloacral Dysplasia: 28 years follow-up in a female patient (2004) (0)
- Atypical Forms of Type 2 Diabetes (2008) (0)
- Characterizing familial partial lipodystrophy: Baseline data of the BROADEN study (2020) (0)
- SAT-572 Extremely Elevated Plasma Lipoprotein X Level Secondary to Alcoholic Cholestasis (2020) (0)
- Effect of 6 Months Therapy with Metreleptin in an African American Boy with Congenital Generalised Lipodystrophy (2015) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Abhimanyu Garg?
Abhimanyu Garg is affiliated with the following schools: