Charles Dumontet
#131,057
Most Influential Person Now
Researcher
Charles Dumontet's AcademicInfluence.com Rankings
Charles Dumontetcomputer-science Degrees
Computer Science
#5764
World Rank
#6084
Historical Rank
Computational Linguistics
#874
World Rank
#887
Historical Rank
Machine Learning
#1646
World Rank
#1668
Historical Rank
Artificial Intelligence
#1882
World Rank
#1914
Historical Rank

Charles Dumontetmathematics Degrees
Mathematics
#6271
World Rank
#8718
Historical Rank
Measure Theory
#1234
World Rank
#1565
Historical Rank

Download Badge
Computer Science Mathematics
Charles Dumontet's Degrees
- PhD Computer Science Université Paris Cité
- Masters Computer Science Université Paris Cité
- Bachelors Mathematics Université Paris Cité
Similar Degrees You Can Earn
Why Is Charles Dumontet Influential?
(Suggest an Edit or Addition)Charles Dumontet's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Microtubule-binding agents: a dynamic field of cancer therapeutics (2010) (1385)
- Strategies and challenges for the next generation of antibody–drug conjugates (2017) (1231)
- Lenalidomide maintenance after stem-cell transplantation for multiple myeloma. (2012) (1017)
- Genetic abnormalities and survival in multiple myeloma: the experience of the Intergroupe Francophone du Myélome. (2007) (879)
- Advances in the development of nucleoside and nucleotide analogues for cancer and viral diseases (2013) (826)
- Maintenance therapy with thalidomide improves survival in patients with multiple myeloma. (2006) (662)
- Mechanisms of action of and resistance to antitubulin agents: microtubule dynamics, drug transport, and cell death. (1999) (559)
- Breast cancer subtypes and response to docetaxel in node-positive breast cancer: use of an immunohistochemical definition in the BCIRG 001 trial. (2009) (511)
- Nucleoside analogues and nucleobases in cancer treatment. (2002) (491)
- Mucosa-associated lymphoid tissue lymphoma is a disseminated disease in one third of 158 patients analyzed. (2000) (491)
- Nucleoside analogues: mechanisms of drug resistance and reversal strategies (2001) (469)
- The Absence of Human Equilibrative Nucleoside Transporter 1 Is Associated with Reduced Survival in Patients With Gemcitabine-Treated Pancreas Adenocarcinoma (2004) (395)
- Mucosa-associated lymphoid tissue gastrointestinal and nongastrointestinal lymphoma behavior: analysis of 108 patients. (1997) (381)
- Incidence, predictive factors, and outcome of lymphoma transformation in follicular lymphoma patients. (1997) (324)
- Subclinical late cardiomyopathy after doxorubicin therapy for lymphoma in adults. (2004) (315)
- Is class III beta-tubulin a predictive factor in patients receiving tubulin-binding agents? (2008) (310)
- Preclinical Activity of the Type II CD20 Antibody GA101 (Obinutuzumab) Compared with Rituximab and Ofatumumab In Vitro and in Xenograft Models (2013) (289)
- Primary thyroid lymphoma is a heterogeneous disease. (2002) (284)
- Class III β-tubulin expression in tumor cells predicts response and outcome in patients with non–small cell lung cancer receiving paclitaxel (2005) (243)
- SAR650984, A Novel Humanized CD38-Targeting Antibody, Demonstrates Potent Antitumor Activity in Models of Multiple Myeloma and Other CD38+ Hematologic Malignancies (2014) (243)
- Modulation by flavonoids of cell multidrug resistance mediated by P-glycoprotein and related ABC transporters (2002) (230)
- Levels of gemcitabine transport and metabolism proteins predict survival times of patients treated with gemcitabine for pancreatic adenocarcinoma. (2012) (223)
- Elderly patients with aggressive non-Hodgkin's lymphoma: disease presentation, response to treatment, and survival--a Groupe d'Etude des Lymphomes de l'Adulte study on 453 patients older than 69 years. (1997) (220)
- Dysregulation of Ribosome Biogenesis and Translational Capacity Is Associated with Tumor Progression of Human Breast Cancer Cells (2009) (215)
- Mantle cell lymphoma: a retrospective study of 121 cases (1998) (204)
- Expression of Class III β-Tubulin Is Predictive of Patient Outcome in Patients with Non–Small Cell Lung Cancer Receiving Vinorelbine-Based Chemotherapy (2005) (193)
- Primary anaplastic large-cell lymphoma in adults: clinical presentation, immunophenotype, and outcome. (1997) (187)
- Antimitotic and antiproliferative activities of chalcones: forward structure-activity relationship. (2008) (165)
- Factors associated with successful mobilization of peripheral blood progenitor cells in 200 patients with lymphoid malignancies (1998) (158)
- The ribonucleotide reductase large subunit (RRM1) as a predictive factor in patients with cancer. (2011) (155)
- Tubulin detyrosination is a frequent occurrence in breast cancers of poor prognosis. (2001) (155)
- In vivo mechanisms of resistance to cytarabine in acute myeloid leukaemia (2002) (153)
- Common resistance mechanisms to deoxynucleoside analogues in variants of the human erythroleukaemic line K562 (1999) (150)
- Chemoresistance in non-small cell lung cancer. (2005) (149)
- The role of 2‐deoxy‐2‐[F‐18]fluoro‐D‐glucose positron emission tomography in disseminated carcinoma of unknown primary site (2007) (149)
- Treatment of splenic marginal zone B-cell lymphoma: an analysis of 81 patients. (2002) (149)
- Class III β-Tubulin Expression and Benefit from Adjuvant Cisplatin/Vinorelbine Chemotherapy in Operable Non–Small Cell Lung Cancer: Analysis of NCIC JBR.10 (2007) (148)
- High CD34+ Cell Counts Decrease Hematologic Toxicity of Autologous Peripheral Blood Progenitor Cell Transplantation (1998) (143)
- Triptolide is an inhibitor of RNA polymerase I and II–dependent transcription leading predominantly to down-regulation of short-lived mRNA (2009) (140)
- Recent advances in the discovery of flavonoids and analogs with high‐affinity binding to P‐glycoprotein responsible for cancer cell multidrug resistance (2002) (135)
- Potential mechanisms of resistance to cytarabine in AML patients. (2002) (131)
- Antibody–Drug Conjugates: The Last Decade (2020) (130)
- Preclinical Studies on the Mechanism of Action and the Anti-Lymphoma Activity of the Novel Anti-CD20 Antibody GA101 (2011) (126)
- Resistance mechanisms in human sarcoma mutants derived by single-step exposure to paclitaxel (Taxol). (1996) (125)
- Endocrine resistance associated with activated ErbB system in breast cancer cells is reversed by inhibiting MAPK or PI3K/Akt signaling pathways (2010) (121)
- Biopsy proven and biopsy negative temporal arteritis: differences in clinical spectrum at the onset of the disease (1999) (119)
- Expression of class III beta tubulin in non-small cell lung cancer is correlated with resistance to taxane chemotherapy. (2002) (117)
- Gemcitabine as a single agent in the treatment of relapsed or refractory low‐grade non‐Hodgkin's lymphoma (2001) (112)
- Ixabepilone: targeting βIII-tubulin expression in taxane-resistant malignancies (2009) (112)
- Tumor necrosis factor ligand-receptor system can predict treatment outcome in lymphoma patients. (1997) (111)
- High CD34(+) cell counts decrease hematologic toxicity of autologous peripheral blood progenitor cell transplantation. (1998) (105)
- Expression of a non‐functional p53 affects the sensitivity of cancer cells to gemcitabine (2002) (100)
- A20/TNFAIP3, a new estrogen-regulated gene that confers tamoxifen resistance in breast cancer cells (2007) (97)
- Intensive therapy with peripheral stem cell transplantation in 16 patients with mantle cell lymphoma. (1997) (96)
- C-Isoprenylation of flavonoids enhances binding affinity toward P-glycoprotein and modulation of cancer cell chemoresistance. (2001) (96)
- Phase I studies of AVE9633, an anti-CD33 antibody-maytansinoid conjugate, in adult patients with relapsed/refractory acute myeloid leukemia (2012) (95)
- Expression of class III {beta}-tubulin is predictive of patient outcome in patients with non-small cell lung cancer receiving vinorelbine-based chemotherapy. (2005) (95)
- Expression of high Km 5'-nucleotidase in leukemic blasts is an independent prognostic factor in adults with acute myeloid leukemia. (2001) (94)
- Frequency and significance of anemia in non-Hodgkin's lymphoma patients. (1998) (92)
- Adipose cells promote resistance of breast cancer cells to trastuzumab-mediated antibody-dependent cellular cytotoxicity (2015) (90)
- Multidrug-resistant Human Sarcoma Cells with a Mutant P-Glycoprotein, Altered Phenotype, and Resistance to Cyclosporins* (1997) (89)
- Interaction of PRMT1 with BTG/TOB proteins in cell signalling: molecular analysis and functional aspects (2002) (86)
- Deoxycytidine kinase and cN‐II nucleotidase expression in blast cells predict survival in acute myeloid leukaemia patients treated with cytarabine (2003) (86)
- Review of recent studies on resistance to cytotoxic deoxynucleoside analogues. (2007) (85)
- Thalidomide in patients with advanced multiple myeloma: a study of 83 patients--report of the Intergroupe Francophone du Myélome (IFM). (2002) (85)
- Decreased mutation rate for cellular resistance to doxorubicin and suppression of mdr1 gene activation by the cyclosporin PSC 833. (1995) (85)
- Novel mechanism of resistance to paclitaxel (Taxol) in human K562 leukemia cells by combined selection with PSC 833. (1995) (84)
- Drug resistance associated with loss of p53 involves extensive alterations in microtubule composition and dynamics (2003) (80)
- Quantitative analysis of nucleoside transporter and metabolism gene expression in chronic lymphocytic leukemia (CLL): identification of fludarabine-sensitive and -insensitive populations. (2005) (80)
- Microtubule-associated parameters as predictive markers of docetaxel activity in advanced breast cancer patients: results of a pilot study. (2002) (78)
- Jatrophane diterpenes as modulators of multidrug resistance. Advances of structure-activity relationships and discovery of the potent lead pepluanin A. (2004) (77)
- Adipocytes promote breast cancer resistance to chemotherapy, a process amplified by obesity: role of the major vault protein (MVP) (2019) (77)
- The role of betaIII tubulin in predicting chemoresistance in non-small cell lung cancer. (2010) (76)
- Small Molecule Inhibitors of ERCC1-XPF Protein-Protein Interaction Synergize Alkylating Agents in Cancer Cells (2013) (76)
- Phase I/II trial of a P-glycoprotein inhibitor, Zosuquidar.3HCl trihydrochloride (LY335979), given orally in combination with the CHOP regimen in patients with non-Hodgkin's lymphoma (2007) (76)
- Resistance to gemcitabine in a human follicular lymphoma cell line is due to partial deletion of the deoxycytidine kinase gene (2004) (75)
- Alteration of Natural Killer cell phenotype and function in obese individuals. (2017) (75)
- Engineering therapeutic bispecific antibodies using CrossMab technology. (2019) (74)
- Problems Related to Resistance to Cytarabine in Acute Myeloid Leukemia (2004) (74)
- Low serum albumin levels and liver metastasis are powerful prognostic markers for survival in patients with carcinomas of unknown primary site (2006) (73)
- The fat and the bad: Mature adipocytes, key actors in tumor progression and resistance. (2017) (73)
- Jatrophane diterpenes from Euphorbia spp. as modulators of multidrug resistance in cancer therapy (2009) (73)
- Pharmacological inhibition of LIM kinase stabilizes microtubules and inhibits neoplastic growth. (2012) (72)
- Plasma levels of tumour necrosis factor and its soluble receptors correlate with clinical features and outcome of Hodgkin's disease patients. (1998) (71)
- The Antitumor Activity of Combinations of Cytotoxic Chemotherapy and Immune Checkpoint Inhibitors Is Model-Dependent (2018) (70)
- Simultaneous analysis of eight nucleoside triphosphates in cell lines by liquid chromatography coupled with tandem mass spectrometry. (2009) (70)
- Jatrophane diterpenes as P-glycoprotein inhibitors. First insights of structure-activity relationships and discovery of a new, powerful lead. (2003) (70)
- Characterization of a Gemcitabine-Resistant Murine Leukemic Cell Line (2004) (68)
- Subclavian and axillary involvement in temporal arteritis and polymyalgia rheumatica. (1990) (68)
- Increased expression of the large subunit of ribonucleotide reductase is involved in resistance to gemcitabine in human mammary adenocarcinoma cells (2005) (67)
- Factors that predict chemotherapy-induced myelosuppression in lymphoma patients: role of the tumor necrosis factor ligand-receptor system. (2000) (67)
- Identification of TACC1, NOV, and PTTG1 as new candidate genes associated with endocrine therapy resistance in breast cancer. (2008) (66)
- cN-II expression predicts survival in patients receiving gemcitabine for advanced non-small cell lung cancer. (2005) (65)
- Class III β-Tubulin Isotype Predicts Response in Advanced Breast Cancer Patients Randomly Treated Either with Single-Agent Doxorubicin or Docetaxel (2008) (62)
- mTOR inhibition reverses acquired endocrine therapy resistance of breast cancer cells at the cell proliferation and gene‐expression levels (2008) (61)
- Tubulin targets in the pathobiology and therapy of glioblastoma multiforme. I. class III β‐tubulin (2009) (61)
- Antimitotic activity of 5-hydroxy-7-methoxy-2-phenyl-4-quinolones. (2004) (60)
- Glucose metabolism in experimental hyperthyroidism: intact in vivo sensitivity to insulin with abnormal binding and increased glucose turnover. (1984) (60)
- High-dose chemotherapy with autologous hematopoietic stem-cell transplantation for advanced soft tissue sarcoma in adults. (2000) (60)
- Virtual Screening and Biological Evaluation of Inhibitors Targeting the XPA-ERCC1 Interaction (2012) (59)
- The fat and the bad: Mature adipocytes, key actors in tumor progression and resistance (2017) (58)
- The influence of comorbidities, age, and performance status on the prognosis and treatment of patients with metastatic carcinomas of unknown primary site (2006) (58)
- A revised nomenclature for the human and rodent alpha-tubulin gene family. (2007) (57)
- Monoclonal antibody therapy in multiple myeloma (2017) (56)
- Monoclonal antibodies in clinical oncology. (2008) (56)
- BMP4 regulation of human megakaryocytic differentiation is involved in thrombopoietin signaling. (2008) (56)
- Deregulation of TWIST-1 in the CD34+ compartment represents a novel prognostic factor in chronic myeloid leukemia. (2011) (55)
- A new P-glycoprotein inhibitor from the caper spurge (Euphorbia lathyris). (2003) (55)
- Thalidomide in patients with advanced multiple myeloma. (2000) (53)
- In B-cell chronic lymphocytic leukemias, 7q21 translocations lead to overexpression of the CDK6 gene. (2003) (53)
- Differentiation of human colon cancer cells changes the expression of β-tubulin isotypes and MAPs (1999) (52)
- Early diagnosis of ventilator-associated pneumonia. Is it possible to define a cutoff value of infected cells in BAL fluid? (1996) (52)
- Structure-activity relationship of natural and synthetic coumarins inhibiting the multidrug transporter P-glycoprotein. (2006) (51)
- Liquid chromatographic methods for the determination of endogenous nucleotides and nucleotide analogs used in cancer therapy: a review. (2010) (51)
- Pyrimidine nucleoside analogs in cancer treatment (2003) (51)
- A microarray to measure repair of damaged plasmids by cell lysates. (2008) (49)
- Germline Lysine-Specific Demethylase 1 (LSD1/KDM1A) Mutations Confer Susceptibility to Multiple Myeloma. (2018) (48)
- Class III β-tubulin is a marker of paclitaxel resistance in carcinomas of unknown primary site (2007) (48)
- Amifostine reduces mucosal damage after high-dose melphalan conditioning and autologous peripheral blood progenitor cell transplantation for patients with multiple myeloma (2002) (48)
- Infections following peripheral blood progenitor cell transplantation for lymphoproliferative malignancies: etiology and potential risk factors. (1999) (48)
- Autoimmune thrombocytopenic purpura after autologous stem cell transplantation (2003) (47)
- Prevention of high dose L-PAM-induced mucositis by cryotherapy. (1994) (46)
- Understanding and circumventing resistance to anticancer monoclonal antibodies (2009) (46)
- Mechanisms of action and resistance to tubulin-binding agents (2000) (46)
- Transfection of cells in suspension by ultrasound cavitation. (2010) (46)
- Expression of excision repair cross-complementation group 1 and class III beta-tubulin predict survival after chemotherapy for completely resected non-small cell lung cancer. (2008) (45)
- High dose chemotherapy with ABMT in soft tissue sarcomas: a report of 22 cases. (1992) (44)
- Dexamethasone down-regulates ABCG2 expression levels in breast cancer cells. (2008) (44)
- Rituximab in CD20 positive multiple myeloma (2007) (44)
- Genetic polymorphisms associated with outcome in multiple myeloma patients receiving high-dose melphalan (2010) (44)
- A predictive model for risk of early grade ≥ 3 infection in patients with multiple myeloma not eligible for transplant: analysis of the FIRST trial (2018) (43)
- The molecular make up of smoldering myeloma highlights the evolutionary pathways leading to multiple myeloma (2021) (43)
- Phase II study of gemcitabine-dexamethasone with or without cisplatin in relapsed or refractory mantle cell lymphoma. (2006) (42)
- BCIRG 001 Molecular Analysis: Prognostic Factors in Node-Positive Breast Cancer Patients Receiving Adjuvant Chemotherapy (2010) (42)
- Gemcitabine resistance due to deoxycytidine kinase deficiency can be reverted by fruitfly deoxynucleoside kinase, DmdNK, in human uterine sarcoma cells (2006) (41)
- How Can Immune Checkpoint Inhibitors Cause Hyperprogression in Solid Tumors? (2020) (41)
- The acridone derivative MBLI-87 sensitizes breast cancer resistance protein-expressing xenografts to irinotecan. (2011) (41)
- The prognostic value of cN-II and cN-III enzymes in adult acute myeloid leukemia. (2005) (40)
- The superoxide dismutase content in erythrocytes predicts short‐term toxicity of high‐dose cyclophosphamide (2001) (39)
- Characterization of an inhibitory dynamic pharmacophore for the ERCC1-XPA interaction using a combined molecular dynamics and virtual screening approach. (2009) (39)
- Increased expression of putative cancer stem cell markers in the bone marrow of prostate cancer patients is associated with bone metastasis progression (2013) (38)
- Primary cutaneous marginal zone lymphoma. (2010) (38)
- In vivo Model of Follicular Lymphoma Resistant to Rituximab (2009) (37)
- Selective modulation of P-glycoprotein activity by steroidal saponines from Paris polyphylla. (2009) (37)
- Inactivation of wild-type p53 by a dominant negative mutant renders MCF-7 cells resistant to tubulin-binding agent cytotoxicity (2001) (36)
- Drug resistance to cytotoxic nucleoside analogues. (2003) (36)
- ADP ribosylation factor like 2 (Arl2) protein influences microtubule dynamics in breast cancer cells. (2007) (36)
- Genome-wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (2015) (36)
- Outcome in Relation to Treatment Modalities in 48 Patients with Localized Gastric MALT Lymphoma: A Retrospective Study of Patients Treated During 1976-2001 (2003) (35)
- Treatment with lenograstim (glycosylated recombinant human granulocyte colony-stimulating factor) and orthotopic liver transplantation for glycogen storage disease type Ib. (1993) (33)
- Modified jatrophane diterpenes as modulators of multidrug resistance from Euphorbia dendroides L. (2003) (33)
- Differential expression of tubulin isotypes during the cell cycle. (1996) (33)
- Development of a sensitive and selective LC/MS/MS method for the simultaneous determination of intracellular 1-beta-D-arabinofuranosylcytosine triphosphate (araCTP), cytidine triphosphate (CTP) and deoxycytidine triphosphate (dCTP) in a human follicular lymphoma cell line. (2009) (33)
- ABCC11 expression is regulated by estrogen in MCF7 cells, correlated with estrogen receptor alpha expression in postmenopausal breast tumors and overexpressed in tamoxifen-resistant breast cancer cells. (2008) (33)
- Fully validated assay for the quantification of endogenous nucleoside mono- and triphosphates using online extraction coupled with liquid chromatography–tandem mass spectrometry (2014) (33)
- A fluorescent biomarker of the polyamine transport system to select patients with AML for F14512 treatment. (2010) (33)
- A Genome-Wide Association Study Identifies a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Patients with Multiple Myeloma (2016) (32)
- Novel pedigree analysis implicates DNA repair and chromatin remodeling in multiple myeloma risk (2017) (32)
- Zidovudine (AZT) has a bactericidal effect on enterobacteria and induces genetic modifications in resistant strains (2011) (32)
- Expression of Arl2 is associated with p53 localization and chemosensitivity in a breast cancer cell line (2008) (32)
- Genetics and molecular epidemiology of multiple myeloma: the rationale for the IMMEnSE consortium (review). (2011) (31)
- Frameshift mutation in the Dok1 gene in chronic lymphocytic leukemia (2004) (31)
- Profiles and prognostic values of LDH isoenzymes in patients with non-Hodgkin’s lymphoma (1999) (31)
- Monodisperse polysarcosine-based highly-loaded antibody-drug conjugates† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c9sc00285e (2019) (31)
- Maintenance Therapy with a Monthly Injection of Alemtuzumab Prolongs Response Duration in Patients with Refractory B-cell Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma (B-CLL/SLL) (2004) (30)
- 3‐Aryl‐4‐methyl‐2‐quinolones Targeting Multiresistant Staphylococcus aureus Bacteria (2013) (30)
- Hybrid Model of Erythropoiesis and Leukemia Treatment with Cytosine Arabinoside (2011) (30)
- Role of IMP-SELECTIVE 5′-NUCLEOTIDASE (cN-II) in HEMATOLOGICAL MALIGNANCIES (2003) (30)
- Simultaneous quantification of 5-FU, 5-FUrd, 5-FdUrd, 5-FdUMP, dUMP and TMP in cultured cell models by LC-MS/MS. (2009) (30)
- Prognostic value of immunophenotyping in elderly patients with acute myeloid leukemia (2008) (30)
- Identification, purification, and characterization of a non-heme lactoperoxidase in bovine milk. (1983) (30)
- Severe autoimmune hemolytic anemia in two patients treated with fludarabine for chronic lymphocytic leukemia. (1992) (29)
- Resistance to microtubule-targeted cytotoxins in a K562 leukemia cell variant associated with altered tubulin expression and polymerization. (2004) (29)
- Potent and fully noncompetitive peptidomimetic inhibitor of multidrug resistance P-glycoprotein. (2010) (29)
- Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients (2017) (29)
- High CD 34 1 Cell Counts Decrease Hematologic Toxicity of Autologous Peripheral Blood Progenitor Cell Transplantation (1998) (29)
- Risk of multiple myeloma is associated with polymorphisms within telomerase genes and telomere length (2015) (29)
- Recent Advances in the Discovery of Flavonoids and Analogues with High‐Affinity Binding to P‐Glycoprotein Responsible for Cancer Cell Multidrug Resistance (2002) (29)
- Factors predictive of early death in patients receiving high‐dose CHOP (ACVB regimen) for aggressive non‐Hodgkin's lymphoma: a GELA study (2002) (29)
- Synovial lipoma arborescens of the hip (1987) (29)
- Beta3-tubulin is induced by estradiol in human breast carcinoma cells through an estrogen-receptor dependent pathway. (2009) (28)
- Potential interactions between antitubulin agents and temperature: implications for modulation of multidrug resistance. (1998) (28)
- Prognostic Value of Immunophenotyping in Elderly Patients with Acute Myeloid Leukemia: A Single Institution Experience. (2007) (27)
- Epileptic seizures after autologous peripheral blood progenitor infusion in a patient treated with high-dose chemotherapy for myeloma (2002) (27)
- In vitro susceptibility of CD4+ and CD8+ T cell subsets to fludarabine. (2003) (26)
- Identification and characterization of inhibitors of cytoplasmic 5'-nucleotidase cN-II issued from virtual screening. (2013) (26)
- Exome sequencing identifies germline variants in DIS3 in familial multiple myeloma (2019) (26)
- Class III beta-tubulin is a marker of paclitaxel resistance in carcinomas of unknown primary site. (2007) (26)
- Giant cell arteritis and polymyalgia rheumatica: are pregnancies a protective factor? A prospective, multicentre case-control study. GRACG (Groupe de Recherche sur l'Artérite à Cellules Géantes). (1999) (26)
- Hepatitis C virus infection and B-cell non-Hodgkin's lymphoma: a cross-sectional study in Lyon, France (2004) (25)
- Methional derived from 4-methylthio-2-oxobutanoate is a cellular mediator of apoptosis in BAF3 lymphoid cells. (1995) (25)
- Acute silicosis due to inhalation of a domestic product. (1991) (24)
- Long-term outcome and sequelae in aggressive lymphoma patients treated with the LNH-80 regimen. (1992) (24)
- Influence of p53 and p21(WAF1) expression on sensitivity of cancer cells to cladribine. (2003) (24)
- Severe autoimmune cytopenias in treatment-naive hepatitis C virus infection: clinical description of 16 cases (2009) (24)
- Effect of kinase inhibitors on the therapeutic properties of monoclonal antibodies (2015) (24)
- Giant cell arteritis and polymyalgia rheumatica: role of viral infections. (2000) (24)
- Impact of polymorphic variation at 7p15.3, 3p22.1 and 2p23.3 loci on risk of multiple myeloma (2012) (24)
- ADP Ribosylation Factor Like 2 (Arl2) Regulates Breast Tumor Aggressivity in Immunodeficient Mice (2009) (24)
- A New Anti-CXCR4 Antibody That Blocks the CXCR4/SDF-1 Axis and Mobilizes Effector Cells (2016) (24)
- Tubulin binding cofactor C (TBCC) suppresses tumor growth and enhances chemosensitivity in human breast cancer cells (2010) (23)
- Structure-activity relationships for euphocharacins A-L, a new series of jatrophane diterpenes, as inhibitors of cancer cell P-glycoprotein. (2004) (23)
- Structural Insights into the Inhibition of Cytosolic 5′-Nucleotidase II (cN-II) by Ribonucleoside 5′-Monophosphate Analogues (2011) (23)
- Intensive radio-chemotherapy with peripheral blood stem cell transplantation in young patients with chronic lymphocytic leukemia. (1992) (23)
- High frequency of CD34+CD38-/low immature leukemia cells is correlated with unfavorable prognosis in acute myeloid leukemia (2017) (22)
- Reduced progression-free survival in elderly patients receiving intensification with autologous peripheral blood stem cell reinfusion for multiple myeloma (1998) (22)
- Special feature of mixed phosphotriester derivatives of cytarabine. (2009) (22)
- Gemcitabine is active against clinical multiresistant Staphylococcus aureus strains and is synergistic with gentamicin. (2012) (22)
- Gene therapy with Adv-IL-2 in unresectable digestive cancer: phase I-II study, intermediate report. (1999) (22)
- Substrate cycles and drug resistance to 1-beta-D-arabinofuranosylcytosine (araC) (2005) (21)
- BRAF and DIS3 Mutations Associate with Adverse Outcome in a Long-term Follow-up of Patients with Multiple Myeloma (2020) (21)
- Tissue-nonspecific alkaline phosphatase is an anti-inflammatory nucleotidase. (2020) (21)
- Differential Allelic Expression in Leukoblast from Patients with Acute Myeloid Leukemia Suggests Genetic Regulation of CDA, DCK, NT5C2, NT5C3, and TP53 (2008) (21)
- Modulation of P‐glycoprotein activity by acridones and coumarins from Citrus sinensis (2007) (21)
- Regulation and activity of cytosolic 5′‐nucleotidase II (2005) (21)
- Inhibition of IGF-1 Signalling Enhances the Apoptotic Effect of AS602868, an IKK2 Inhibitor, in Multiple Myeloma Cell Lines (2011) (21)
- Genetic Variants and Multiple Myeloma Risk: IMMEnSE Validation of the Best Reported Associations—An Extensive Replication of the Associations from the Candidate Gene Era (2014) (21)
- Protein abundance of class III beta-tubulin but not Delta2-alpha-tubulin or tau is related to paclitaxel response in carcinomas of unknown primary site. (2008) (21)
- Prognostic value of PINI index in patients with multiple myeloma (2012) (21)
- Synovial cyst of the hip causing iliac vein and femoral nerve compression. (1987) (20)
- CD73 inhibition by purine cytotoxic nucleoside analogue-based diphosphonates. (2018) (20)
- Do hENT1 and RRM1 predict the clinical benefit of gemcitabine in pancreatic cancer? (2013) (20)
- Spatial and Temporal Control of Cavitation Allows High In Vitro Transfection Efficiency in the Absence of Transfection Reagents or Contrast Agents (2015) (20)
- Cell proliferation and drug sensitivity of human glioblastoma cells are altered by the stable modulation of cytosolic 5'-nucleotidase II. (2015) (20)
- Determination of the enzymatic activity of cytosolic 5′-nucleotidase cN-II in cancer cells: development of a simple analytical method and related cell line models (2015) (20)
- Recent developments to improve the efficacy of cytotoxic nucleoside analogues. (2006) (20)
- mTOR inhibition reverses acquired endocrine therapy resistance of breast cancer cells at the cell proliferation and gene expression levels (2008) (20)
- Initial absolute lymphocyte count as a prognostic factor for outcome in acute myeloid leukemia (2014) (19)
- The purine analog fludarabine acts as a cytosolic 5'-nucleotidase II inhibitor. (2015) (19)
- Beta-tubulin III expression in prostate cancer (2010) (19)
- Nucleoside analogue delivery systems in cancer therapy (2007) (19)
- High efficacy with five days schedule of oral fludarabine phosphate and cyclophosphamide in patients with previously untreated chronic lymphocytic leukaemia (2008) (19)
- Structure-activity relationships of β-hydroxyphosphonate nucleoside analogues as cytosolic 5'-nucleotidase II potential inhibitors: synthesis, in vitro evaluation and molecular modeling studies. (2014) (18)
- Hormonal Therapy Resistance and Breast Cancer: Involvement of Adipocytes and Leptin (2019) (18)
- Isoprenoid flavonoids are new leads in the modulation of chemoresistance (2002) (18)
- Tubulin folding pathways: implication in the regulation of microtubule dynamics. (2007) (18)
- Oncogene- and drug resistance-associated alternative exon usage in acute myeloid leukemia (AML) (2015) (18)
- Sensitization of chronic lymphocytic leukemia cells to TRAIL-induced apoptosis by hyperthermia. (2007) (18)
- Multifocal progressive leukoencephalopathy occurring after refractory anemia and multiple infectious disorders consecutive to severe lymphopenia (2002) (17)
- Modeling the Colchicum autumnale Tubulin and a Comparison of Its Interaction with Colchicine to Human Tubulin (2017) (17)
- Common resistance mechanisms to nucleoside analogues in variants of the human erythroleukemic line K562. (1999) (17)
- Skin lesions in malignancy. Case 3. Yellow nail syndrome in non-Hodgkin's lymphoma. (2001) (17)
- The druggability of intracellular nucleotide-degrading enzymes (2016) (17)
- Heterogeneity of protein kinase C β2 expression in lymphoid malignancies (2007) (17)
- Cytosolic 5’-Nucleotidase II Interacts with the Leucin Rich Repeat of NLR Family Member Ipaf (2015) (17)
- Kinetics and organ distribution of [14C]-sialic acid-GM3 and [3H]-sphingosine-GM1 after intravenous injection in rats. (1992) (16)
- Doxorubicin Delivery into Tumor Cells by Stable Cavitation without Contrast Agents. (2017) (16)
- Development of gene therapy in association with clinically used cytotoxic deoxynucleoside analogues (2009) (16)
- A Tridimensional Model for NK Cell-Mediated ADCC of Follicular Lymphoma (2019) (16)
- An Open Label, Dose Escalation Study of AVE9633 Administered as a Single Agent by Intravenous (IV) Infusion Weekly for 2 Weeks in 4-Week Cycle to Patients with Relapsed or Refractory CD33-Positive Acute Myeloid Leukemia (AML). (2007) (16)
- Esophageal cancer cells resistant to T-DM1 display alterations in cell adhesion and the prostaglandin pathway (2018) (16)
- 2-[18F]Fludarabine, a Novel Positron Emission Tomography (PET) Tracer for Imaging Lymphoma: a Micro-PET Study in Murine Models (2014) (16)
- 5'-(3')-nucleotidase mRNA levels in blast cells are a prognostic factor in acute myeloid leukemia patients treated with cytarabine. (2004) (15)
- Identification of Noncompetitive Inhibitors of Cytosolic 5'-Nucleotidase II Using a Fragment-Based Approach. (2015) (15)
- Sensitization of ara‐C‐resistant lymphoma cells by a pronucleotide analogue (2003) (15)
- Multidrug resistance ABC transporter structure predictions by homology modeling approaches. (2011) (15)
- Benign recurrent cholestasis with normal gamma-glutamyl-transpeptidase activity. (1992) (15)
- A common variant within the HNF1B gene is associated with overall survival of multiple myeloma patients: Results from the IMMEnSE consortium and meta-analysis (2016) (15)
- Toxicities after peripheral blood progenitor cell transplantation for lymphoid malignancies: analysis of 300 cases in a single institution (1999) (15)
- Polymorphisms in xenobiotic transporters ABCB1, ABCG2, ABCC2, ABCC1, ABCC3 and multiple myeloma risk: a case–control study in the context of the International Multiple Myeloma rESEarch (IMMEnSE) consortium (2012) (15)
- Ungueotropic T-cell lymphoma. (2006) (15)
- Targeted therapies in metastatic melanoma: toward a clinical breakthrough? (2010) (14)
- Comprehensive investigation of genetic variation in the 8q24 region and multiple myeloma risk in the IMMEnSE consortium (2012) (14)
- Therapeutic Enhancement of ER Stress by Insulin-Like Growth Factor I Sensitizes Myeloma Cells to Proteasomal Inhibitors (2013) (14)
- Phase II study of 3-hour infusion of high dose paclitaxel in refractory and relapsed aggressive non-Hodgkin's lymphomas. Groupe d'Etude des Lymphomes de l'Adulte. (2000) (14)
- Vinorelbine induces beta3-tubulin gene expression through an AP-1 Site. (2009) (14)
- Compared Antitumor Activity of GA101 and Rituximab against the Human RL Follicular Lymphoma Xenografts in SCID Beige Mice. (2008) (14)
- F-ara-AMP is a substrate of cytoplasmic 5′-nucleotidase II (cN-II): HPLC and NMR studies of enzymatic dephosphorylation (2006) (14)
- [Distal metastases of bronchial cancers. Bone and soft tissue metastases]. (1990) (14)
- Erratum: Microtubule-binding agents: a dynamic field of cancer therapeutics (2010) (14)
- Methionine dependence of tumor cells: programmed cell survival? (1996) (14)
- Loss of KDM1A in GIP-dependent primary bilateral macronodular adrenal hyperplasia with Cushing's syndrome: a multicentre, retrospective, cohort study. (2021) (13)
- Inhibition of immune cell proliferation and cytokine production by lipoprotein-bound gangliosides (1994) (13)
- Neutrophils protect lymphoma cells against cytotoxic and targeted therapies through CD11b/ICAM-1 binding (2017) (13)
- Synthesis of new steroidal inhibitors of P-glycoprotein-mediated multidrug resistance and biological evaluation on K562/R7 erythroleukemia cells. (2015) (13)
- Identification and validation of seven genes, as potential markers, for the differential diagnosis of small B cell lymphomas (small lymphocytic lymphoma, marginal zone B cell lymphoma and mantle cell lymphoma) by cDNA macroarrays analysis (2002) (13)
- Evaluation of class III beta-tubulin (bTubIII) expression as a prognostic marker in patients with resectable non-small cell lung cancer (NSCLC) treated by perioperative chemotherapy (CT) in the phase III trial IFCT-0002. (2009) (13)
- Modulation of cancer cell multidrug resistance by an extract of Ficus citrifolia. (2001) (12)
- Paclitaxel-loaded microparticles for intratumoral administration via the TMT technique: preparation, characterization, and preliminary antitumoral evaluation. (2008) (12)
- Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents. (2016) (12)
- Advances in Bispecific Antibodies Engineering: Novel Concepts for Immunotherapies (2015) (12)
- Bortezomib influences the expression of malignant plasma cells membrane antigens. (2013) (12)
- Paclitaxel-Loaded Microparticles for Intratumoral Administration via the TMT Technique: Preparation, Characterization, and Preliminary Antitumoral Evaluation (2008) (12)
- Genetic polymorphisms in genes of class switch recombination and multiple myeloma risk and survival: an IMMEnSE study (2019) (12)
- The genomic landscape of plasma cells in systemic light chain amyloidosis. (2018) (12)
- Exatecan Antibody Drug Conjugates Based on a Hydrophilic Polysarcosine Drug-Linker Platform (2021) (12)
- Single nucleotide polymorphisms in ABCB1 and CBR1 can predict toxicity to R-CHOP type regimens in patients with diffuse non-Hodgkin lymphoma (2015) (12)
- Prognostic Index for Older Adult Patients with Newly Diagnosed Acute Myeloid Leukemia: The Edouard Herriot Hospital Experience (2008) (11)
- 31st Annual Meeting and Associated Programs of the Society for Immunotherapy of Cancer (SITC 2016): part two (2016) (11)
- Localization of putative binding sites for cyclic guanosine monophosphate and the anti-cancer drug 5-fluoro-2′-deoxyuridine-5′-monophosphate on ABCC11 in silico models (2013) (11)
- A p21/WAF1 mutation favors the appearance of drug resistance to paclitaxel in human noncancerous epithelial mammary cells (2006) (11)
- Type 2 diabetes-related variants influence the risk of developing multiple myeloma: results from the IMMEnSE consortium. (2015) (11)
- Expression of domains for protein–protein interaction of nucleotide excision repair proteins modifies cancer cell sensitivity to platinum derivatives and genomic stability (2014) (10)
- Apoptotic induction by anti-CD20 antibodies in chronic lymphocytic leukemia: comparison of rituximab and obinutuzumab (2014) (10)
- Peripheral blood stem cells harvested after chemotherapy and GM-CSF for treatment intensification in patients with advanced lymphoproliferative diseases. (1993) (10)
- Accumulation of lactosylceramide and overexpression of a PSC833-resistant P-glycoprotein in multidrug-resistant human sarcoma cells. (2011) (10)
- Heterogeneity of acute lymphoblastic leukemia in HIV-seropositive patients. (1994) (10)
- A phase II trial of miltefosine in patients with cutaneous T-cell lymphoma. (2006) (10)
- The Adipose Microenvironment Dysregulates the Mammary Myoepithelial Cells and Could Participate to the Progression of Breast Cancer (2021) (10)
- Sever immune thombocytopenic purpura and haemolytic anaemia in a hairy‐cell leukaemia patient (1995) (10)
- Beta-hydroxyphosphonate ribonucleoside analogues derived from 4-substituted-1,2,3-triazoles as IMP/GMP mimics: synthesis and biological evaluation (2016) (10)
- Silicosis due to inhalation of domestic cleaning powder (1991) (9)
- Silencing of Tubulin Binding Cofactor C Modifies Microtubule Dynamics and Cell Cycle Distribution and Enhances Sensitivity to Gemcitabine in Breast Cancer Cells (2011) (9)
- Higher percentage of CD34 + CD38− cells detected by multiparameter flow cytometry from leukapheresis products predicts unsustained complete remission in acute myeloid leukemia (2015) (9)
- International Society for Therapeutic Ultrasound Conference 2016 (2017) (9)
- Very low density lipoproteins and interleukin 2 enhance the immunogenicity of 9-O-acetyl-GD3 ganglioside in BALB/c mice. (1997) (9)
- [Antibody-drug conjugates in oncology: from the concept to trastuzumab emtansine (T-DM1)]. (2012) (9)
- Identification of miRSNPs associated with the risk of multiple myeloma (2017) (9)
- Pegfilgrastim Enhances the Antitumor Effect of Therapeutic Monoclonal Antibodies (2016) (9)
- Inhibition of P-glycoprotein-mediated multidrug efflux by aminomethylene and ketomethylene analogs of reversins. (2006) (9)
- Clinical and pharmacokinetic phase II study of fotemustine in refractory and relapsing multiple myeloma patients. (2003) (9)
- IL‐3 increases marrow and peripheral erythroid precursors in chronic pure red cell aplasia presenting in childhood (1995) (8)
- Regulation of tubulin expression: Multiple overlapping mechanisms (2009) (8)
- Adipocyte-conditioned medium induces resistance of breast cancer cells to lapatinib (2020) (8)
- Second autologous transplantation after failure of a first autologous transplant in 18 patients with non-Hodgkin's lymphoma. (2004) (8)
- Stably transfected adherent cancer cell models with decreased expression of 5′-nucleotidase cN-II (2016) (8)
- The cytosolic 5′-nucleotidase cN-II lowers the adaptability to glucose deprivation in human breast cancer cells (2017) (8)
- Deoxycholic acid derivatives as inhibitors of P-glycoprotein-mediated multidrug efflux (2016) (8)
- ABCC 11 expression is regulated by estrogen in MCF 7 cells , correlated with estrogen receptor a expression in postmenopausal breast tumors and overexpressed in tamoxifen-resistant breast cancer cells (2008) (8)
- Short Communication A revised nomenclature for the human and rodent α-tubulin gene family (2007) (8)
- The Novel Aurora Kinase Inhibitor AS703569 Shows Potent Anti-Tumor Activity in Acute Myeloid Leukemia (AML). (2007) (8)
- Leukocytosis and circulating blasts in older adults with newly diagnosed acute myeloid leukemia: are they valuable factors for therapeutic decision-making? (2011) (8)
- Enhanced migration of breast and lung cancer cells deficient for cN-II and CD73 via COX-2/PGE2/AKT axis regulation (2020) (7)
- Diagnostics of the AML with immunophenotypical data (2006) (7)
- Late autologous transplantation in chronic myelogenous leukemia with peripheral blood progenitor cells mobilized by G-CSF and interferon-α (2000) (7)
- Rare Circulating Cells in Familial Waldenström Macroglobulinemia Displaying the MYD88 L265P Mutation Are Enriched by Epstein-Barr Virus Immortalization (2015) (7)
- The cytosolic 5'-nucleotidase cN-II lowers the adaptability to glucose deprivation in human breast cancer cells. (2017) (7)
- Genetically determined telomere length and multiple myeloma risk and outcome (2021) (7)
- A heavy metal baseline score predicts outcome in acute myeloid leukemia (2020) (7)
- Lead optimization and biological evaluation of fragment-based cN-II inhibitors. (2019) (7)
- Impact of clinical practice guidelines on the management for carcinomas of unknown primary site: a controlled "before-after" study. (2009) (7)
- Platelet concentrate supernatants alter endothelial cell mRNA and protein expression patterns as a function of storage length (2018) (7)
- Functions of the multi‐interacting protein KIDINS220/ARMS in cancer and other pathologies (2018) (6)
- Progesterone–adenine hybrids as bivalent inhibitors of P-glycoprotein-mediated multidrug efflux: Design, synthesis, characterization and biological evaluation (2012) (6)
- MRP8/ABCC11 Expression Is Regulated by Dexamethasone in Breast Cancer Cells and Is Associated to Progesterone Receptor Status in Breast Tumors (2011) (6)
- [Tarsal bone metastasis of bladder carcinoma]. (1987) (6)
- In vitro antileukaemic activity of extracts from Daphne gnidium leaves against sensitive and multidrug resistant K562/R7 cells (2014) (6)
- Inclusion complexes of a nucleotide analogue with hydroxypropyl-beta-cyclodextrin (2009) (6)
- Identification of TACC 1 , NOV , and PTTG 1 as new candidate genes associated with endocrine therapy resistance in breast cancer (2009) (6)
- Design, synthesis and evaluation of progesterone-adenine hybrids as bivalent inhibitors of P-glycoprotein-mediated multidrug efflux. (2010) (6)
- Development of a confocal ultrasound device using an inertial cavitation control for transfection in-vitro (2015) (6)
- Transient Acute Myopia Induced by Antilymphocyte Globulins (1999) (6)
- Determination and quantification of intracellular fludarabine triphosphate, cladribine triphosphate and clofarabine triphosphate by LC-MS/MS in human cancer cells. (2017) (5)
- Prediction of gemcitabine benefit after curative-intent resection of pancreatic adenocarcinoma using HENT1 and dCK protein expression. (2011) (5)
- Characterization of T‐DM1‐resistant breast cancer cells (2020) (5)
- [Class III beta tubulin expression in nonsmall cell lung cancer]. (2010) (5)
- Evaluation of Microtubule Associated Parameters (MTAPs) as predictive markers for Advanced Breast Cancer (ABC) patients treated with docetaxel (2001) (5)
- Synthesis and Evaluation of a Molecularly Imprinted Polymer for Selective Solid-Phase Extraction of Irinotecan from Human Serum Samples (2012) (5)
- Minimally differentiated acute myeloid leukemia (FAB AML-M0): prognostic factors and treatment effects on survival--a retrospective study of 42 adult cases. (2011) (5)
- Sensitivity and gene expression profile of fresh human acute myeloid leukemia cells exposed ex vivo to AS602868 (2011) (5)
- Polymorphisms in regulators of xenobiotic transport and metabolism genes PXR and CAR do not affect multiple myeloma risk: a case–control study in the context of the IMMEnSE consortium (2013) (5)
- Human T-cell leukemia virus type I-induced proliferation of human thymocytes requires the presence of a comitogen. (1988) (4)
- Brachial plexus compression by an iatrogenic arteriovenous fistula (1987) (4)
- Jatrophane Diterpenes as Modulators of Multidrug Resistance. Advances of Structure—Activity Relationships and Discovery of the Potent Lead Pepluanin A. (2004) (4)
- In vitro modulation of multidrug resistance by pregnane steroids and in vivo inhibition of tumour development by 7α-OBz-11α(R)-OTHP-5β-pregnanedione in K562/R7 and H295R cell xenografts (2019) (4)
- The challenge of myeloma-related thromboembolic disease: can thrombin generation assay help physicians to better predict the thromboembolic risk and personalize anti-thrombotic prophylaxis? (2019) (4)
- [Pneumococcal cellulitis revealing a myeloma]. (2000) (4)
- Bacterial Deoxyribonucleoside Kinases are Poor Suicide Genes in Mammalian Cells (2009) (4)
- A label‐free mass spectrometry method for relative quantitation of β‐tubulin isotype expression in human tumor tissue (2012) (4)
- Granulocyte Colony-Stimulating Factor Nanocarriers for Stimulation of the Immune System (Part I): Synthesis and Biodistribution Studies. (2017) (4)
- TET2 exon 2 skipping is an independent favorable prognostic factor for cytogenetically normal acute myelogenous leukemia (AML): TET2 exon 2 skipping in AML. (2017) (4)
- Mobilization of CD34(+)CD38(-) hematopoietic stem cells after priming in acute myeloid leukemia. (2013) (4)
- LFB-R603, a Third-Generation Monoclonal Anti-CD20 Antibody Displays An Additive Antitumor Activity with Antileukemic Chemotherapeutic Agents in Mouse Xenograft Models (2011) (4)
- BCIRG 001 molecular analysis: Identification of prognostic factors in patients (pts) receiving adjuvant therapy for node- positive (N+) breast cancer (BC) (2007) (4)
- Piperidinyl-embeded chalcones possessing anti PI3Kδ inhibitory properties exhibit anti-atopic properties in preclinical models. (2018) (4)
- Real life management of patients hospitalized with multiple myeloma in France (2018) (4)
- [Antibody-drug conjugates in oncology. Recent success of an ancient concept]. (2019) (4)
- A prospective study of intensive induction therapy with high-dose consolidation in patients with aggressive non-Hodgkin's lymphoma and two or three adverse prognostic factors (2000) (4)
- Unexpected Growth-Promoting Effect of Oxaliplatin in Excision Repair Cross-Complementation Group 1 Transfected Human Colon Cancer Cells (2018) (4)
- Impact of clinical practice guidelines on the diagnostic strategy for carcinomas of unknown primary site: a controlled 'before-after' study. (2008) (3)
- [Can tumor hypoxia be turned into a chemotherapeutic advantage?]. (2008) (3)
- Payload diversification: a key step in the development of antibody–drug conjugates (2023) (3)
- Enhancing the activity of platinum-based drugs by improved inhibitors of ERCC1–XPF-mediated DNA repair (2021) (3)
- [Efflux pumps: their role in Staphylococcus aureus antibiotic resistance]. (2008) (3)
- Hepatic angiosarcoma in a patient with essential thrombocythaemia and Budd-Chiari syndrome. (1995) (3)
- Multidrug Resistance‐Associated Protein (MRP/ABCC Proteins) (2009) (3)
- [Antitubulin agents]. (2011) (3)
- [Gangliosides and cancer]. (1991) (3)
- [Immunotherapy and cancer: the role of monoclonal antibodies]. (1989) (3)
- CD73 and cN-II regulate the cellular response to chemotherapeutic and hypoxic stress in lung adenocarcinoma cells. (2021) (3)
- Abstract 4735: SAR650984: Characterization of a potent phase I humanized anti-CD38 antibody for the treatment of multiple myeloma and other hematologic malignancies. (2013) (3)
- A Two-complementary Method Assay for Screening New Reversal Agents of Cancer Cell Multidrug Resistance (2003) (3)
- IN VIVO SYNGENEIC TUMOR MODELS WITH ACQUIRED RESISTANCE TO ANTI-PD-1/PD-L1 THERAPIES. (2022) (3)
- [Metabolism, mechanism of action and resistance to cytotoxic nucleoside analogues]. (2005) (3)
- Analgesic and preventive effects of donepezil in animal models of chemotherapy-induced peripheral neuropathy: Involvement of spinal muscarinic acetylcholine M2 receptors. (2022) (3)
- Calcium Channel Blockers Impair the Antitumor Activity of Anti-CD20 Monoclonal Antibodies by Blocking EGR-1 Induction (2020) (3)
- Common gene variants within 3′‐untranslated regions as modulators of multiple myeloma risk and survival (2020) (3)
- Reply to “Clinical and therapeutic implications of BRAF mutation heterogeneity in metastatic melanoma” by Mesbah Ardakani et al. (2017) (3)
- [Antibody-drug conjugates in oncology. New strategies in development]. (2019) (2)
- [Rituximab: mechanism of action and resistance]. (2007) (2)
- Targeting the nucleotide metabolism proteins of the NUDIX family and SAMHD1 in cancer. (2020) (2)
- A polygenic risk score for multiple myeloma risk prediction (2021) (2)
- Enhanced Sensitivity of Idelalisib and Ibrutinib-Resistant Cell Lines to Anti-CD38 Antibodies (2020) (2)
- Corrigendum to "A revised nomenclature for the human and rodent α-tubulin gene family" [Genomics 90 (2007) 285-289] (DOI:10.1016/j.ygeno.2007.04.008) (2009) (2)
- Rituximab in CD20 Positive Multiple Myeloma: A Prospective Study from the IFM Group. (2006) (2)
- Netrin-1 expression and targeting in multiple myeloma (2019) (2)
- Gangliosides et cancer. (1991) (2)
- Preparation, characterization and in vitro evaluation of a new nucleotide analogue prodrug cyclodextrin inclusion complexes. (2009) (2)
- Les agents antitubulines (2011) (2)
- Analysis of the Sub-Clonal Structure of Smoldering Myeloma over Time Provides a New Means of Disease Monitoring and Highlights Evolutionary Trajectories Leading to Myeloma (2019) (2)
- Anti-Lymphoma Activity of the Novel Anti-CD 20 Antibody Preclinical Studies on the Mechanism of Action and the Updated (2011) (2)
- The Expression of Anti-Müllerian Hormone Type II Receptor (AMHRII) in Non-Gynecological Solid Tumors Offers Potential for Broad Therapeutic Intervention in Cancer (2021) (2)
- Expression quantitative trait loci of genes predicting outcome are associated with survival of multiple myeloma patients (2021) (2)
- 838 TESTING AND PROGNOSTIC IMPLICATIONS OF PROSTATE CANCER STEM CELLS IN BONE MARROW (2011) (2)
- 7th Cancer Scientific Forum of the Cancéropôle Lyon Auvergne Rhône-Alpes (2012) (2)
- Evaluation of gemcitabine in relapsed or refractory multiple myeloma. (2004) (2)
- 98: Reduced content of Tubulin binding cofactor C (TBCC) in breast cancer cells modifies progression into cell cycle and influences response to treatments (2010) (1)
- Abstract 774: Anti-Müllerian hormone type II receptor (AMHRII) found expressed in human non-gynecological solid tumors, suggesting potential broader applications for anti-AMHRII-based therapy (2018) (1)
- [Prognostic factors, late relapse and outcome of patients with aggressive malignant lymphoma: long term results of LNH-80 protocol]. (1992) (1)
- Prognostic impact of cN-III mRNA expression on overall survival and drug sensitivity in pediatric leukemia (2021) (1)
- Higher Percentage of CD34+CD38− Cells Detected by Multiparameter Flow Cytometry From Leukapheresis Products Predict Unsustained Complete Remission in AML (2012) (1)
- Natural Killer Cells Display an Activated Phenotype but Reduced Effector Functions in Obese Patients (2015) (1)
- What can we expect from liposomal drugs? (2001) (1)
- The molecular make up of smoldering myeloma highlights the evolutionary pathways leading to multiple myeloma (2021) (1)
- Erratum: Genome-wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (Nature Communications (2015) 6 (7539) DOI: 10.1038/ncomms8539) (2015) (1)
- Granulocyte-Colony Stimulating Factor Nanocarriers for Stimulation of the Immune System (Part II): Dose-Dependent Biodistribution and In Vivo Antitumor Efficacy in Combination with Rituximab. (2017) (1)
- Correction: Corrigendum: Genome-wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (2015) (1)
- Transcriptional and Metabolic Investigation in 5′-Nucleotidase Deficient Cancer Cell Lines (2021) (1)
- A functional procedure using fresh samples to select patients with acute myeloid leukemia prior to treatment with the novel targeted cytotoxic agent F14512. (2016) (1)
- Impact of mouse model tumor implantation site on acquired resistance to anti-PD-1 immune checkpoint therapy (2023) (1)
- In-vitro and in-vivo siRNA transfection by an ultrasonic confocal device (2012) (1)
- Comparison of Cytotoxic Mechanisms of Anti-CD20 Antibodies GA101 and Rituximab Against Fresh Chronic Lymphocytic Leukemia Cells (2010) (1)
- A Genome-Wide Association Study Identi fi es a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Patients with Multiple Myeloma (2016) (1)
- Host immune genetic variations influence the risk of developing acute myeloid leukaemia: results from the NuCLEAR consortium (2020) (1)
- Genetic Polymorphisms Correlated with Outcome in Multiple Myeloma Patients Receiving High Dose Melphalan. (2006) (1)
- The first ADC bearing the ferroptosis inducer RSL3 as a payload with conservation of the fragile electrophilic warhead. (2022) (1)
- Genome-wide association study identifies variants at 16 p 13 associated with survival in multiple myeloma patients (2015) (1)
- Unusual Organisms in the Bone Marrow of a Patient With Systemic Sarcoidosis (2005) (1)
- Abstract 309: Mechanisms of resistance to trastuzumab emtansine in gastric cancer (2016) (1)
- Effectiveness of 2‐chlorodeoxyadenosine in nodal and extra haematopoietic localizations in hairy cell leukaemia (1995) (1)
- Proof of Concept: Protein Delivery into Human Erythrocytes Using Stable Cavitation. (2022) (1)
- Cytotoxic and antitumoral activity of N-(9H-purin-6-yl) benzamide derivatives and related water-soluble prodrugs. (2021) (1)
- Evaluation of natural phenolic compounds from Clusiaceae as P-glycoprotein inhibitors (2007) (1)
- Abstract 3274: Combination of elacytarabine and daunorubicin is significantly more effective than combination of cytarabine and daunorubicin in primary patient xenografts of AML. (2013) (1)
- New derivatives of chalcone, has antimitotic activity (2006) (0)
- Abstract 1778: 5’-nucleotidases are involved in the biology of human lung cancer cell lines (2019) (0)
- Abstract 2723: In vivo activity of combinations of cytotoxic regimens with anti-PD1 and anti-PDL1 in various syngeneic cancer models (2018) (0)
- A Genome-Wide Association Study Identifies a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Multiple Myeloma Patients (2020) (0)
- The International Multiple Myeloma Research (IMMEnSE) Consortium: Genetics of Multiple Myeloma Risk and Prognosis (2014) (0)
- [Chemotherapy for human immunodeficiency virus infection. Current status and perspectives]. (1992) (0)
- Allogeneic Hematopoietic Stem Cell Transplantation in First Line High Risk Multiple Myeloma Patients: Evolving Strategies with the Immunomodulating Drugs. (2012) (0)
- ESTABLISHMENT AND CHARACTERISATION OF A PRECLINICAL BLADDER MODEL OF RESISTANCE TO IMMUNE CHECKPOINT INHIBITORS (2018) (0)
- New derivatives of azacoumarines presenting inhibitory activity of the mdr pump (2011) (0)
- Resistance to Anticancer Antibodies: From Mechanisms to Solutions (2013) (0)
- Sequencing at lymphoid neoplasm susceptibility loci maps six myeloma risk genes (2021) (0)
- A High Density Polymorphism Analysis of Factors Correlated with Neurotoxicity to Bortezomib in Patients with Multiple Myeloma. (2009) (0)
- Single Nucleotide Polymorphisms in ABCB1 and CBR1 Predict Toxicity to R-CHOP Type Regimens in Patients with Diffuse Non Hodgkin's Lymphoma (2012) (0)
- Candidate molecular markers associated with endocrine resistance in breast carcinoma (2008) (0)
- Clinical characteristics and outcome of 318 families with familial monoclonal gammopathy: A multicenter Intergroupe Francophone du Myélome study (2023) (0)
- Phosphoester prodrugs of gemcitabine as anticancer agents (2007) (0)
- Abstract 3783: Adipocytes inhibit trastuzumab-mediated ADCC via induction of GDF15 (2014) (0)
- Reply to R.S. Mehta et al (2009) (0)
- The Challenge of Myeloma-Related Thromboembolic Disease: Can Thrombin Generation Assay May Detect Disease-Related Hypercoagulability? (2014) (0)
- Anticancer composition containing anthracycline compound (1997) (0)
- Abstract 5835: Adipocyte-released agents induce resistance of breast cancer cells to lapatinib (2018) (0)
- Immunophenotypic Diagnostic Score for MDS Taking into Account Various Cell Populations. (2004) (0)
- Title : Quantitative Analysis of Nucleoside Transporter and Metabolism Gene Expression in Chronic Lymphocytic Leukemia ( CLL ) – Identification of fludarabine-sensitive and insensitive populations Short title : Nucleoside transporter and metabolism expression in CLL (2004) (0)
- Global Expression Changes of Malignant Plasma Cells over Time Reveals the Evolutionary Development of Signatures of Aggressive Clinical Behavior (2018) (0)
- Is anemia an important prognostic factor in non-Hodgkins lymphoma patients? (1996) (0)
- Abstract 3613: Opposite effects of adipocytes and adenosine on hematological cancer cell survival and proliferationin vitro (2014) (0)
- Correlation between MRD and Chimerism Kinetics in CLL Patients after Myeloablative and Non-Myeloablative Allogeneic Hematopoïetic Stem Cell Transplantation. (2007) (0)
- PKC beta II Expression in Lymphoid Malignancies. (2004) (0)
- Reversion of the resistance to tamoxifen and cross-resistance to fulvestrant in a novel breast cancer cell line by inhibition of the PI3K/Akt/mTor signaling pathway (2007) (0)
- P640 Fatal viral opportunistic infections and Epstein-Barr virus positive large B-cell lymphoma after alemtuzumab treatment for a refractory Sezary syndrome (2007) (0)
- Long-term Analysis Of Multiple Sequential Samples Reveals Patterns Of Progression In Smoldering Myeloma (2019) (0)
- Polymorphisms in xenobiotic transporters ABCB1, ABCG2, ABCC2, ABCC1, ABCC3 and multiple myeloma risk: a case—control study in the context of the International Multiple Myeloma rESEarch (IMMEnSE) consortium (2013) (0)
- A Biomathematical Analysis of Immunophenotypic Characteristics in Patients with Acute Myeloblastic Leukemia. (2006) (0)
- Development of a sensitive and selective LC/MS/MS method for the simultaneous determination of intracellular 1-beta-arabinofuranosylcytosine triphosphate (araCTP), cytidine triphosphate (CTP) and deoxycytidine triphosphate (dCTP) in a human follicular lymphoma cell line. (2009) (0)
- Abstract 2051: Antitumor activity of a novel allogeneic colorectal cancer vaccine in C57BL/6 mice bearing MC38 anti-PD1 resistant colon carcinoma syngeneic model with TME (2022) (0)
- ESCCA 2009, Abstract Clinical Cytometry 2009 (2016) (0)
- Cancer Therapy : Preclinical SAR 650984 , A Novel Humanized CD 38-Targeting Antibody , Demonstrates Potent AntitumorActivity inModels ofMultiple Myeloma and Other CD 38 þ Hematologic Malignancies (2014) (0)
- Variability in CD39 and CD73 protein levels in uveal melanoma patients (2022) (0)
- Long-Term Follow-up of Multiple Myeloma Patients Treated by Bortezomib (Velcade®): A Study on Efficacy, Tolerance, Survival and Time to Progression (2008) (0)
- Preclinical Development Silencing of Tubulin Binding Cofactor C Modifies Microtubule Dynamics and Cell Cycle Distribution and Enhances Sensitivity to Gemcitabine in Breast Cancer Cells (2011) (0)
- A Genome-Wide Association Study Identifies a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Multiple Myeloma Patients Running title : GWAS in multiple myeloma pharmacogenomics (2016) (0)
- [Translational research and Cancer Plan]. (2007) (0)
- [Use of monoclonal antibodies in the treatment of cancer]. (1987) (0)
- Mutations and Copy Number Changes Predict Progression from Smoldering Myeloma to Symptomatic Myeloma in the Era of Novel IMWG Criteria (2018) (0)
- Expression of the Chemokine Receptor CXCR4, CXCL12G801A Gene polymorphism and SDF1 Plasma Levels in B-Cell Chronic Lymphocytic Leukemia (B-CLL): Correlation with PBSC Mobilisation, Disease Characteristics and Outcome. (2009) (0)
- IsItPossible ToDefine aCutoff Value ofInfected Cells inBALFluid (2015) (0)
- Adipocyte-conditioned medium induces resistance of breast cancer cells to lapatinib (2020) (0)
- OR04-4 Loss of KDM1A in Bilateral Macronodular Adrenal Hyperplasia With GIP-Dependent Cushing's Syndrome and in Acromegaly With Paradoxical GH Response to Oral Glucose (2022) (0)
- Chronic recurrent multifocal osteomyelitis in children with hypophosphatasia explained by anti-inflammatory nucleotidase activity of tissue nonspecific alkaline phosphatase in mesenchymal and hematopoietic cells (2019) (0)
- Evaluating the relevance of the platelet transcriptome (2003) (0)
- Insulin-Like Growth Factor 1 Potentiates the Cytotoxic Activity of Bortezomib Against Myeloma Cells (2010) (0)
- Crystal structure of CD38 with a novel CD38-targeting antibody SAR650984 (2014) (0)
- Abstract 4200: Characterization of acquired resistant models to therapies targeting the PD-1/PD-L1 axis demonstrates model-dependent mechanisms (2022) (0)
- RG6234: A Novel 2:1 GPRC5D T Cell Bispecific Antibody Exhibits Best in Class Potential for the Treatment of Multiple Myeloma As a Monotherapy and in Combination (2022) (0)
- Abstract 5078: Genome wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (2014) (0)
- Large-Scale Linkage Analysis of Multiple Myeloma (MM) and Monoclonal Gammopathy of Undetermined Significance (MGUS) Families (2018) (0)
- Targetting glutaminase to starve lymphoma cells. (2022) (0)
- A comparison of flow cytometry detection of minimal residual disease and chimerism kinetics in chronic lymphocytic leukemia patients after allogeneic hematopoietic stem cell transplantation (2011) (0)
- dCK for: aaa cct gaa cga tgg tct ttt tac c 5'-Fam-caa aca tat gcc tgt ctc agt rev: ctt tga gct tgc cat tca gag a cga ata aga gct c-Tamra UMP/ for: gggcatattctttgcttcca SYBR Green CMP-K rev: tgcatttcaaggttccactg (2005) (0)
- [Factors predictive of chemotherapy resistance in patients with breast cancer]. (2000) (0)
- Polymorphisms in Regulators of Xenobiotic Transport and Metabolism Genes NR1I2 and NR1I3 and Multiple Myeloma Risk: A Case-Control Study in the Context of IMMEnSE Consortium (2011) (0)
- Reply to L.C. Panasci (2009) (0)
- Research of genetic factors predisposing to dysglobulinemia (2008) (0)
- Cancer Therapy: Preclinical SAR650984, A Novel Humanized CD38-Targeting Antibody, Demonstrates Potent AntitumorActivity inModels ofMultiple Myeloma and Other CD38þ Hematologic Malignancies (2014) (0)
- New chalcone derivatives presenting an antiallergic activity (2013) (0)
- Multiparametric Flow Cytometry Evaluation of CD200L/CD200R- LSC/NK Synapse Including Leukemia Stem Cell (LSC) Fraction As a Potential Therapeutic Target and Marker of NK Cell Exhaustion in Pediatric AML-Conect-AML French Collaborative Network (2021) (0)
- Abstract P4-08-06: Companion Diagnostic Test for Expression of β-III tubulin (ß3T) in Breast Cancer (BC) Using an Immunohistochemical (IHC) Assay in Studies of Ixabepilone (Ixa) (2010) (0)
- 7th cancer scientific forum of theCancéropôle Lyon Auvergne Rhône-Alpes: March 20-21, 2012, Lyon, France. (2012) (0)
- Abstract 3835: Identification and characterization of inhibitors of 5′-nucleotidase cN-II issued from virtual screening (2012) (0)
- fludarabine-sensitive and -insensitive populations expression in chronic lymphocytic leukemia (CLL): identification of Quantitative analysis of nucleoside transporter and metabolism gene (2013) (0)
- Abstract 5602: BRAF V600 mutated allelic specific imbalance (MASI) impact on sensitivity to vemurafenib (2014) (0)
- Skipping of ATP-Binding Cassette Transporter A3 Exon 19 in AML Cells Is an Independent Prognostic Factor in Patients with Normal Cytogenetics (2014) (0)
- Adipocytes promote breast cancer resistance to chemotherapy, a process amplified by obesity: role of the major vault protein (MVP) (2019) (0)
- The Bone Morphogenetic Protein (BMP)-4 Is Involved in the Regulation of Human Megakaryocytic Differentiation during Thrombopoietin Signaling. (2008) (0)
- Introducing the Electronic Journal of Oncology (2004) (0)
- COMMUNICATION Monodisperse Polysarcosine-based Antibody-Drug Conjugates (2021) (0)
- prognostic factor in chronic myeloid leukemia compartment represents a novel + Deregulation of TWIST-1 in the CD34 (2011) (0)
- Identification of Genetic Markers for the Outcome of Patients with Acute Myeloid Leukemia Treated with Cytarabine. (2007) (0)
- [The role of gemcitabine in hematology]. (2002) (0)
- Abstract 5014: Neutrophils protect B-cell lymphomas against chemotherapy via cell-cell interactions mediated by CD44 and ICAM1 receptors (2015) (0)
- 69: Chronic Lymphocytic Leukemia and anti-CD20 monoclonal antibodies (2010) (0)
- 111 POSTER Design of a screening procedure to select patients with leukemia for treatment with F 14512, a novel targeted cytotoxic agent (2008) (0)
- Prognostic Value of PINI in Elderly Patients with Multiple Myeloma (MM). (2009) (0)
- 1179 Efficacy study of STC-1010 antitumor vaccine associated with standard chemotherapies on MC 38 syngeneic colon cancer tumor model (2022) (0)
- Abstract 4594: Induction of apoptosis by anti-CD20 antibodies requires the induction of EGR-1 and calcium influx (2017) (0)
- Arl2 content influences p53 phosphorylation and localization in a breast cancer cell line (2007) (0)
- Twist-1 Expression Represents a Novel Prognostic Factor in Chronic Myelogenous Leukemia. (2009) (0)
- [Optimising therapy in patients with haematological malignancies]. (2008) (0)
- Brief report Deregulation of TWIST-1 in the CD34 (cid:1) compartment represents a novel prognostic factor in chronic myeloid leukemia (2011) (0)
- A Genome Wide Association Study Reveals Genetic Predisposition for Bortezomib-Induced Peripheral Neuropathy in Multiple Myeloma By Variation in the PREP1-Cbs Locus (2014) (0)
- Monodisperse Polysarcosine-Based Antibody-Drug Conjugates (2018) (0)
- Correction: ADP Ribosylation Factor Like 2 (Arl2) Regulates Breast Tumor Aggressivity in Immunodeficient Mice (2009) (0)
- [Oculomotor imbalance in severe hypermetropia. (Apropos of 169 cases)]. (1972) (0)
- The Electronic Journal of Oncology (1999) (0)
- Prognostic Index for Older Adult Patients with Newly Diagnosed Acute Myeloid Leukemia: The Edouard Herriot Hospital Experience. (2007) (0)
- Abstract 5291: Netrin-1 expression and targeting in multiple myeloma (2019) (0)
- Effect of Imids on Gene Expression Profiles of Fresh Human Myeloma Cells (2010) (0)
- A pleiotropic variant in DNAJB4 is associated with multiple myeloma risk (2022) (0)
- Loss of lysine demethylase KDM1A in GIP-dependent bilateral macronodular adrenal hyperplasia with Cushing's syndrome (2022) (0)
- 908 Humanized model for assessment of therapies targeting either lymphoid or myeloid compartment: enhanced evaluation of clinical relevancy & translatability (2021) (0)
- Abstract LB-078: Effect of a combined immune checkpoint inhibitor and mechanical focused ultrasound treatment on intratumoral immune response in a MC38 preclinical model (2020) (0)
- Type 2 Diabetes-Related Variants Influence on the Risk of Developing Multiple Myeloma: Results from the Immense Consortium (2014) (0)
- COMMUNICATION Monodisperse Polysarcosine-based Highly-loaded Antibody-Drug Conjugates (2021) (0)
- A076 Long-Term Follow-up of Multiple Myeloma Patients Treated by VELCADE (2009) (0)
- ADP ribosylation factor like protein 2 (Arl2) regulates microtubule composition and dynamics in breast cancer cells (2006) (0)
- Abstract 1779: Inability to regulate ROS content confers sensitivity to ferroptosis in breast cancer cells resistant to T-DM1 (2022) (0)
- Analysis of Familial Dysglobulinemia: a Multicenter IFM Study. (2009) (0)
- Abstract 3164: Impact of cN-II and CD73 inhibition on cancer cell migration (2018) (0)
- Adipose cells promote resistance of breast cancer cells to trastuzumab-mediated antibody-dependent cellular cytotoxicity (2015) (0)
- TET2 Exon 2 Skipping Confers Sensitivity to AraC and Is an Independent Favorable Prognostic Factor in AML Patients Treated with Intensive Chemotherapy (2014) (0)
- of the Intergroupe Francophone du Myélome Genetic abnormalities and survival in multiple myeloma: the experience (2011) (0)
- Enhanced migration of breast and lung cancer cells deficient for cN-II and CD73 via COX-2/PGE2/AKT axis regulation (2020) (0)
- Molecular imaging biomarkers to predict resistance to nucleoside analogs in cancer (2008) (0)
- Diverse approaches for the design cytosolic 5’-nucleotidase inhibitors (2018) (0)
- Comparison of Na18F and 18F-Deoxyglucose Positron Emission Tomography in Patients with Multiple Myeloma. (2004) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Charles Dumontet?
Charles Dumontet is affiliated with the following schools: