Charles Dumontet

Q: What Schools Are Affiliated With Charles Dumontet

Charles Dumontet is affiliated with the following schools: University of Molise, University of California, Berkeley, Université Paris Cité, University of Alberta, Stanford University, Lund University

Charles Dumontet's AcademicInfluence.com Rankings

Charles Dumontet

Computer Science

#5764

World Rank

#6084

Historical Rank

Computational Linguistics

#874

World Rank

#887

Historical Rank

Machine Learning

#1646

World Rank

#1668

Historical Rank

Artificial Intelligence

#1882

World Rank

#1914

Historical Rank

computer-science Degrees

Charles Dumontet

Mathematics

#6271

World Rank

#8718

Historical Rank

Measure Theory

#1234

World Rank

#1565

Historical Rank

mathematics Degrees

Download Badge

Computer Science
Mathematics

Charles Dumontet's Degrees

PhD Computer Science Université Paris Cité
Masters Computer Science Université Paris Cité
Bachelors Mathematics Université Paris Cité

Similar Degrees You Can Earn

Why Is Charles Dumontet Influential?

(Suggest an Edit or Addition)

(See a Problem?)

Charles Dumontet's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Microtubule-binding agents: a dynamic field of cancer therapeutics (2010) (1385)
Strategies and challenges for the next generation of antibody–drug conjugates (2017) (1231)
Lenalidomide maintenance after stem-cell transplantation for multiple myeloma. (2012) (1017)
Genetic abnormalities and survival in multiple myeloma: the experience of the Intergroupe Francophone du Myélome. (2007) (879)
Advances in the development of nucleoside and nucleotide analogues for cancer and viral diseases (2013) (826)
Maintenance therapy with thalidomide improves survival in patients with multiple myeloma. (2006) (662)
Mechanisms of action of and resistance to antitubulin agents: microtubule dynamics, drug transport, and cell death. (1999) (559)
Breast cancer subtypes and response to docetaxel in node-positive breast cancer: use of an immunohistochemical definition in the BCIRG 001 trial. (2009) (511)
Nucleoside analogues and nucleobases in cancer treatment. (2002) (491)
Mucosa-associated lymphoid tissue lymphoma is a disseminated disease in one third of 158 patients analyzed. (2000) (491)
Nucleoside analogues: mechanisms of drug resistance and reversal strategies (2001) (469)
The Absence of Human Equilibrative Nucleoside Transporter 1 Is Associated with Reduced Survival in Patients With Gemcitabine-Treated Pancreas Adenocarcinoma (2004) (395)
Mucosa-associated lymphoid tissue gastrointestinal and nongastrointestinal lymphoma behavior: analysis of 108 patients. (1997) (381)
Incidence, predictive factors, and outcome of lymphoma transformation in follicular lymphoma patients. (1997) (324)
Subclinical late cardiomyopathy after doxorubicin therapy for lymphoma in adults. (2004) (315)
Is class III beta-tubulin a predictive factor in patients receiving tubulin-binding agents? (2008) (310)
Preclinical Activity of the Type II CD20 Antibody GA101 (Obinutuzumab) Compared with Rituximab and Ofatumumab In Vitro and in Xenograft Models (2013) (289)
Primary thyroid lymphoma is a heterogeneous disease. (2002) (284)
Class III β-tubulin expression in tumor cells predicts response and outcome in patients with non–small cell lung cancer receiving paclitaxel (2005) (243)
SAR650984, A Novel Humanized CD38-Targeting Antibody, Demonstrates Potent Antitumor Activity in Models of Multiple Myeloma and Other CD38+ Hematologic Malignancies (2014) (243)
Modulation by flavonoids of cell multidrug resistance mediated by P-glycoprotein and related ABC transporters (2002) (230)
Levels of gemcitabine transport and metabolism proteins predict survival times of patients treated with gemcitabine for pancreatic adenocarcinoma. (2012) (223)
Elderly patients with aggressive non-Hodgkin's lymphoma: disease presentation, response to treatment, and survival--a Groupe d'Etude des Lymphomes de l'Adulte study on 453 patients older than 69 years. (1997) (220)
Dysregulation of Ribosome Biogenesis and Translational Capacity Is Associated with Tumor Progression of Human Breast Cancer Cells (2009) (215)
Mantle cell lymphoma: a retrospective study of 121 cases (1998) (204)
Expression of Class III β-Tubulin Is Predictive of Patient Outcome in Patients with Non–Small Cell Lung Cancer Receiving Vinorelbine-Based Chemotherapy (2005) (193)
Primary anaplastic large-cell lymphoma in adults: clinical presentation, immunophenotype, and outcome. (1997) (187)
Antimitotic and antiproliferative activities of chalcones: forward structure-activity relationship. (2008) (165)
Factors associated with successful mobilization of peripheral blood progenitor cells in 200 patients with lymphoid malignancies (1998) (158)
The ribonucleotide reductase large subunit (RRM1) as a predictive factor in patients with cancer. (2011) (155)
Tubulin detyrosination is a frequent occurrence in breast cancers of poor prognosis. (2001) (155)
In vivo mechanisms of resistance to cytarabine in acute myeloid leukaemia (2002) (153)
Common resistance mechanisms to deoxynucleoside analogues in variants of the human erythroleukaemic line K562 (1999) (150)
Chemoresistance in non-small cell lung cancer. (2005) (149)
The role of 2‐deoxy‐2‐[F‐18]fluoro‐D‐glucose positron emission tomography in disseminated carcinoma of unknown primary site (2007) (149)
Treatment of splenic marginal zone B-cell lymphoma: an analysis of 81 patients. (2002) (149)
Class III β-Tubulin Expression and Benefit from Adjuvant Cisplatin/Vinorelbine Chemotherapy in Operable Non–Small Cell Lung Cancer: Analysis of NCIC JBR.10 (2007) (148)
High CD34+ Cell Counts Decrease Hematologic Toxicity of Autologous Peripheral Blood Progenitor Cell Transplantation (1998) (143)
Triptolide is an inhibitor of RNA polymerase I and II–dependent transcription leading predominantly to down-regulation of short-lived mRNA (2009) (140)
Recent advances in the discovery of flavonoids and analogs with high‐affinity binding to P‐glycoprotein responsible for cancer cell multidrug resistance (2002) (135)
Potential mechanisms of resistance to cytarabine in AML patients. (2002) (131)
Antibody–Drug Conjugates: The Last Decade (2020) (130)
Preclinical Studies on the Mechanism of Action and the Anti-Lymphoma Activity of the Novel Anti-CD20 Antibody GA101 (2011) (126)
Resistance mechanisms in human sarcoma mutants derived by single-step exposure to paclitaxel (Taxol). (1996) (125)
Endocrine resistance associated with activated ErbB system in breast cancer cells is reversed by inhibiting MAPK or PI3K/Akt signaling pathways (2010) (121)
Biopsy proven and biopsy negative temporal arteritis: differences in clinical spectrum at the onset of the disease (1999) (119)
Expression of class III beta tubulin in non-small cell lung cancer is correlated with resistance to taxane chemotherapy. (2002) (117)
Gemcitabine as a single agent in the treatment of relapsed or refractory low‐grade non‐Hodgkin's lymphoma (2001) (112)
Ixabepilone: targeting βIII-tubulin expression in taxane-resistant malignancies (2009) (112)
Tumor necrosis factor ligand-receptor system can predict treatment outcome in lymphoma patients. (1997) (111)
High CD34(+) cell counts decrease hematologic toxicity of autologous peripheral blood progenitor cell transplantation. (1998) (105)
Expression of a non‐functional p53 affects the sensitivity of cancer cells to gemcitabine (2002) (100)
A20/TNFAIP3, a new estrogen-regulated gene that confers tamoxifen resistance in breast cancer cells (2007) (97)
Intensive therapy with peripheral stem cell transplantation in 16 patients with mantle cell lymphoma. (1997) (96)
C-Isoprenylation of flavonoids enhances binding affinity toward P-glycoprotein and modulation of cancer cell chemoresistance. (2001) (96)
Phase I studies of AVE9633, an anti-CD33 antibody-maytansinoid conjugate, in adult patients with relapsed/refractory acute myeloid leukemia (2012) (95)
Expression of class III {beta}-tubulin is predictive of patient outcome in patients with non-small cell lung cancer receiving vinorelbine-based chemotherapy. (2005) (95)
Expression of high Km 5'-nucleotidase in leukemic blasts is an independent prognostic factor in adults with acute myeloid leukemia. (2001) (94)
Frequency and significance of anemia in non-Hodgkin's lymphoma patients. (1998) (92)
Adipose cells promote resistance of breast cancer cells to trastuzumab-mediated antibody-dependent cellular cytotoxicity (2015) (90)
Multidrug-resistant Human Sarcoma Cells with a Mutant P-Glycoprotein, Altered Phenotype, and Resistance to Cyclosporins* (1997) (89)
Interaction of PRMT1 with BTG/TOB proteins in cell signalling: molecular analysis and functional aspects (2002) (86)
Deoxycytidine kinase and cN‐II nucleotidase expression in blast cells predict survival in acute myeloid leukaemia patients treated with cytarabine (2003) (86)
Review of recent studies on resistance to cytotoxic deoxynucleoside analogues. (2007) (85)
Thalidomide in patients with advanced multiple myeloma: a study of 83 patients--report of the Intergroupe Francophone du Myélome (IFM). (2002) (85)
Decreased mutation rate for cellular resistance to doxorubicin and suppression of mdr1 gene activation by the cyclosporin PSC 833. (1995) (85)
Novel mechanism of resistance to paclitaxel (Taxol) in human K562 leukemia cells by combined selection with PSC 833. (1995) (84)
Drug resistance associated with loss of p53 involves extensive alterations in microtubule composition and dynamics (2003) (80)
Quantitative analysis of nucleoside transporter and metabolism gene expression in chronic lymphocytic leukemia (CLL): identification of fludarabine-sensitive and -insensitive populations. (2005) (80)
Microtubule-associated parameters as predictive markers of docetaxel activity in advanced breast cancer patients: results of a pilot study. (2002) (78)
Jatrophane diterpenes as modulators of multidrug resistance. Advances of structure-activity relationships and discovery of the potent lead pepluanin A. (2004) (77)
Adipocytes promote breast cancer resistance to chemotherapy, a process amplified by obesity: role of the major vault protein (MVP) (2019) (77)
The role of betaIII tubulin in predicting chemoresistance in non-small cell lung cancer. (2010) (76)
Small Molecule Inhibitors of ERCC1-XPF Protein-Protein Interaction Synergize Alkylating Agents in Cancer Cells (2013) (76)
Phase I/II trial of a P-glycoprotein inhibitor, Zosuquidar.3HCl trihydrochloride (LY335979), given orally in combination with the CHOP regimen in patients with non-Hodgkin's lymphoma (2007) (76)
Resistance to gemcitabine in a human follicular lymphoma cell line is due to partial deletion of the deoxycytidine kinase gene (2004) (75)
Alteration of Natural Killer cell phenotype and function in obese individuals. (2017) (75)
Engineering therapeutic bispecific antibodies using CrossMab technology. (2019) (74)
Problems Related to Resistance to Cytarabine in Acute Myeloid Leukemia (2004) (74)
Low serum albumin levels and liver metastasis are powerful prognostic markers for survival in patients with carcinomas of unknown primary site (2006) (73)
The fat and the bad: Mature adipocytes, key actors in tumor progression and resistance. (2017) (73)
Jatrophane diterpenes from Euphorbia spp. as modulators of multidrug resistance in cancer therapy (2009) (73)
Pharmacological inhibition of LIM kinase stabilizes microtubules and inhibits neoplastic growth. (2012) (72)
Plasma levels of tumour necrosis factor and its soluble receptors correlate with clinical features and outcome of Hodgkin's disease patients. (1998) (71)
The Antitumor Activity of Combinations of Cytotoxic Chemotherapy and Immune Checkpoint Inhibitors Is Model-Dependent (2018) (70)
Simultaneous analysis of eight nucleoside triphosphates in cell lines by liquid chromatography coupled with tandem mass spectrometry. (2009) (70)
Jatrophane diterpenes as P-glycoprotein inhibitors. First insights of structure-activity relationships and discovery of a new, powerful lead. (2003) (70)
Characterization of a Gemcitabine-Resistant Murine Leukemic Cell Line (2004) (68)
Subclavian and axillary involvement in temporal arteritis and polymyalgia rheumatica. (1990) (68)
Increased expression of the large subunit of ribonucleotide reductase is involved in resistance to gemcitabine in human mammary adenocarcinoma cells (2005) (67)
Factors that predict chemotherapy-induced myelosuppression in lymphoma patients: role of the tumor necrosis factor ligand-receptor system. (2000) (67)
Identification of TACC1, NOV, and PTTG1 as new candidate genes associated with endocrine therapy resistance in breast cancer. (2008) (66)
cN-II expression predicts survival in patients receiving gemcitabine for advanced non-small cell lung cancer. (2005) (65)
Class III β-Tubulin Isotype Predicts Response in Advanced Breast Cancer Patients Randomly Treated Either with Single-Agent Doxorubicin or Docetaxel (2008) (62)
mTOR inhibition reverses acquired endocrine therapy resistance of breast cancer cells at the cell proliferation and gene‐expression levels (2008) (61)
Tubulin targets in the pathobiology and therapy of glioblastoma multiforme. I. class III β‐tubulin (2009) (61)
Antimitotic activity of 5-hydroxy-7-methoxy-2-phenyl-4-quinolones. (2004) (60)
Glucose metabolism in experimental hyperthyroidism: intact in vivo sensitivity to insulin with abnormal binding and increased glucose turnover. (1984) (60)
High-dose chemotherapy with autologous hematopoietic stem-cell transplantation for advanced soft tissue sarcoma in adults. (2000) (60)
Virtual Screening and Biological Evaluation of Inhibitors Targeting the XPA-ERCC1 Interaction (2012) (59)
The fat and the bad: Mature adipocytes, key actors in tumor progression and resistance (2017) (58)
The influence of comorbidities, age, and performance status on the prognosis and treatment of patients with metastatic carcinomas of unknown primary site (2006) (58)
A revised nomenclature for the human and rodent alpha-tubulin gene family. (2007) (57)
Monoclonal antibody therapy in multiple myeloma (2017) (56)
Monoclonal antibodies in clinical oncology. (2008) (56)
BMP4 regulation of human megakaryocytic differentiation is involved in thrombopoietin signaling. (2008) (56)
Deregulation of TWIST-1 in the CD34+ compartment represents a novel prognostic factor in chronic myeloid leukemia. (2011) (55)
A new P-glycoprotein inhibitor from the caper spurge (Euphorbia lathyris). (2003) (55)
Thalidomide in patients with advanced multiple myeloma. (2000) (53)
In B-cell chronic lymphocytic leukemias, 7q21 translocations lead to overexpression of the CDK6 gene. (2003) (53)
Differentiation of human colon cancer cells changes the expression of β-tubulin isotypes and MAPs (1999) (52)
Early diagnosis of ventilator-associated pneumonia. Is it possible to define a cutoff value of infected cells in BAL fluid? (1996) (52)
Structure-activity relationship of natural and synthetic coumarins inhibiting the multidrug transporter P-glycoprotein. (2006) (51)
Liquid chromatographic methods for the determination of endogenous nucleotides and nucleotide analogs used in cancer therapy: a review. (2010) (51)
Pyrimidine nucleoside analogs in cancer treatment (2003) (51)
A microarray to measure repair of damaged plasmids by cell lysates. (2008) (49)
Germline Lysine-Specific Demethylase 1 (LSD1/KDM1A) Mutations Confer Susceptibility to Multiple Myeloma. (2018) (48)
Class III β-tubulin is a marker of paclitaxel resistance in carcinomas of unknown primary site (2007) (48)
Amifostine reduces mucosal damage after high-dose melphalan conditioning and autologous peripheral blood progenitor cell transplantation for patients with multiple myeloma (2002) (48)
Infections following peripheral blood progenitor cell transplantation for lymphoproliferative malignancies: etiology and potential risk factors. (1999) (48)
Autoimmune thrombocytopenic purpura after autologous stem cell transplantation (2003) (47)
Prevention of high dose L-PAM-induced mucositis by cryotherapy. (1994) (46)
Understanding and circumventing resistance to anticancer monoclonal antibodies (2009) (46)
Mechanisms of action and resistance to tubulin-binding agents (2000) (46)
Transfection of cells in suspension by ultrasound cavitation. (2010) (46)
Expression of excision repair cross-complementation group 1 and class III beta-tubulin predict survival after chemotherapy for completely resected non-small cell lung cancer. (2008) (45)
High dose chemotherapy with ABMT in soft tissue sarcomas: a report of 22 cases. (1992) (44)
Dexamethasone down-regulates ABCG2 expression levels in breast cancer cells. (2008) (44)
Rituximab in CD20 positive multiple myeloma (2007) (44)
Genetic polymorphisms associated with outcome in multiple myeloma patients receiving high-dose melphalan (2010) (44)
A predictive model for risk of early grade ≥ 3 infection in patients with multiple myeloma not eligible for transplant: analysis of the FIRST trial (2018) (43)
The molecular make up of smoldering myeloma highlights the evolutionary pathways leading to multiple myeloma (2021) (43)
Phase II study of gemcitabine-dexamethasone with or without cisplatin in relapsed or refractory mantle cell lymphoma. (2006) (42)
BCIRG 001 Molecular Analysis: Prognostic Factors in Node-Positive Breast Cancer Patients Receiving Adjuvant Chemotherapy (2010) (42)
Gemcitabine resistance due to deoxycytidine kinase deficiency can be reverted by fruitfly deoxynucleoside kinase, DmdNK, in human uterine sarcoma cells (2006) (41)
How Can Immune Checkpoint Inhibitors Cause Hyperprogression in Solid Tumors? (2020) (41)
The acridone derivative MBLI-87 sensitizes breast cancer resistance protein-expressing xenografts to irinotecan. (2011) (41)
The prognostic value of cN-II and cN-III enzymes in adult acute myeloid leukemia. (2005) (40)
The superoxide dismutase content in erythrocytes predicts short‐term toxicity of high‐dose cyclophosphamide (2001) (39)
Characterization of an inhibitory dynamic pharmacophore for the ERCC1-XPA interaction using a combined molecular dynamics and virtual screening approach. (2009) (39)
Increased expression of putative cancer stem cell markers in the bone marrow of prostate cancer patients is associated with bone metastasis progression (2013) (38)
Primary cutaneous marginal zone lymphoma. (2010) (38)
In vivo Model of Follicular Lymphoma Resistant to Rituximab (2009) (37)
Selective modulation of P-glycoprotein activity by steroidal saponines from Paris polyphylla. (2009) (37)
Inactivation of wild-type p53 by a dominant negative mutant renders MCF-7 cells resistant to tubulin-binding agent cytotoxicity (2001) (36)
Drug resistance to cytotoxic nucleoside analogues. (2003) (36)
ADP ribosylation factor like 2 (Arl2) protein influences microtubule dynamics in breast cancer cells. (2007) (36)
Genome-wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (2015) (36)
Outcome in Relation to Treatment Modalities in 48 Patients with Localized Gastric MALT Lymphoma: A Retrospective Study of Patients Treated During 1976-2001 (2003) (35)
Treatment with lenograstim (glycosylated recombinant human granulocyte colony-stimulating factor) and orthotopic liver transplantation for glycogen storage disease type Ib. (1993) (33)
Modified jatrophane diterpenes as modulators of multidrug resistance from Euphorbia dendroides L. (2003) (33)
Differential expression of tubulin isotypes during the cell cycle. (1996) (33)
Development of a sensitive and selective LC/MS/MS method for the simultaneous determination of intracellular 1-beta-D-arabinofuranosylcytosine triphosphate (araCTP), cytidine triphosphate (CTP) and deoxycytidine triphosphate (dCTP) in a human follicular lymphoma cell line. (2009) (33)
ABCC11 expression is regulated by estrogen in MCF7 cells, correlated with estrogen receptor alpha expression in postmenopausal breast tumors and overexpressed in tamoxifen-resistant breast cancer cells. (2008) (33)
Fully validated assay for the quantification of endogenous nucleoside mono- and triphosphates using online extraction coupled with liquid chromatography–tandem mass spectrometry (2014) (33)
A fluorescent biomarker of the polyamine transport system to select patients with AML for F14512 treatment. (2010) (33)
A Genome-Wide Association Study Identifies a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Patients with Multiple Myeloma (2016) (32)
Novel pedigree analysis implicates DNA repair and chromatin remodeling in multiple myeloma risk (2017) (32)
Zidovudine (AZT) has a bactericidal effect on enterobacteria and induces genetic modifications in resistant strains (2011) (32)
Expression of Arl2 is associated with p53 localization and chemosensitivity in a breast cancer cell line (2008) (32)
Genetics and molecular epidemiology of multiple myeloma: the rationale for the IMMEnSE consortium (review). (2011) (31)
Frameshift mutation in the Dok1 gene in chronic lymphocytic leukemia (2004) (31)
Profiles and prognostic values of LDH isoenzymes in patients with non-Hodgkin’s lymphoma (1999) (31)
Monodisperse polysarcosine-based highly-loaded antibody-drug conjugates† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c9sc00285e (2019) (31)
Maintenance Therapy with a Monthly Injection of Alemtuzumab Prolongs Response Duration in Patients with Refractory B-cell Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma (B-CLL/SLL) (2004) (30)
3‐Aryl‐4‐methyl‐2‐quinolones Targeting Multiresistant Staphylococcus aureus Bacteria (2013) (30)
Hybrid Model of Erythropoiesis and Leukemia Treatment with Cytosine Arabinoside (2011) (30)
Role of IMP-SELECTIVE 5′-NUCLEOTIDASE (cN-II) in HEMATOLOGICAL MALIGNANCIES (2003) (30)
Simultaneous quantification of 5-FU, 5-FUrd, 5-FdUrd, 5-FdUMP, dUMP and TMP in cultured cell models by LC-MS/MS. (2009) (30)
Prognostic value of immunophenotyping in elderly patients with acute myeloid leukemia (2008) (30)
Identification, purification, and characterization of a non-heme lactoperoxidase in bovine milk. (1983) (30)
Severe autoimmune hemolytic anemia in two patients treated with fludarabine for chronic lymphocytic leukemia. (1992) (29)
Resistance to microtubule-targeted cytotoxins in a K562 leukemia cell variant associated with altered tubulin expression and polymerization. (2004) (29)
Potent and fully noncompetitive peptidomimetic inhibitor of multidrug resistance P-glycoprotein. (2010) (29)
Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients (2017) (29)
High CD 34 1 Cell Counts Decrease Hematologic Toxicity of Autologous Peripheral Blood Progenitor Cell Transplantation (1998) (29)
Risk of multiple myeloma is associated with polymorphisms within telomerase genes and telomere length (2015) (29)
Recent Advances in the Discovery of Flavonoids and Analogues with High‐Affinity Binding to P‐Glycoprotein Responsible for Cancer Cell Multidrug Resistance (2002) (29)
Factors predictive of early death in patients receiving high‐dose CHOP (ACVB regimen) for aggressive non‐Hodgkin's lymphoma: a GELA study (2002) (29)
Synovial lipoma arborescens of the hip (1987) (29)
Beta3-tubulin is induced by estradiol in human breast carcinoma cells through an estrogen-receptor dependent pathway. (2009) (28)
Potential interactions between antitubulin agents and temperature: implications for modulation of multidrug resistance. (1998) (28)
Prognostic Value of Immunophenotyping in Elderly Patients with Acute Myeloid Leukemia: A Single Institution Experience. (2007) (27)
Epileptic seizures after autologous peripheral blood progenitor infusion in a patient treated with high-dose chemotherapy for myeloma (2002) (27)
In vitro susceptibility of CD4+ and CD8+ T cell subsets to fludarabine. (2003) (26)
Identification and characterization of inhibitors of cytoplasmic 5'-nucleotidase cN-II issued from virtual screening. (2013) (26)
Exome sequencing identifies germline variants in DIS3 in familial multiple myeloma (2019) (26)
Class III beta-tubulin is a marker of paclitaxel resistance in carcinomas of unknown primary site. (2007) (26)
Giant cell arteritis and polymyalgia rheumatica: are pregnancies a protective factor? A prospective, multicentre case-control study. GRACG (Groupe de Recherche sur l'Artérite à Cellules Géantes). (1999) (26)
Hepatitis C virus infection and B-cell non-Hodgkin's lymphoma: a cross-sectional study in Lyon, France (2004) (25)
Methional derived from 4-methylthio-2-oxobutanoate is a cellular mediator of apoptosis in BAF3 lymphoid cells. (1995) (25)
Acute silicosis due to inhalation of a domestic product. (1991) (24)
Long-term outcome and sequelae in aggressive lymphoma patients treated with the LNH-80 regimen. (1992) (24)
Influence of p53 and p21(WAF1) expression on sensitivity of cancer cells to cladribine. (2003) (24)
Severe autoimmune cytopenias in treatment-naive hepatitis C virus infection: clinical description of 16 cases (2009) (24)
Effect of kinase inhibitors on the therapeutic properties of monoclonal antibodies (2015) (24)
Giant cell arteritis and polymyalgia rheumatica: role of viral infections. (2000) (24)
Impact of polymorphic variation at 7p15.3, 3p22.1 and 2p23.3 loci on risk of multiple myeloma (2012) (24)
ADP Ribosylation Factor Like 2 (Arl2) Regulates Breast Tumor Aggressivity in Immunodeficient Mice (2009) (24)
A New Anti-CXCR4 Antibody That Blocks the CXCR4/SDF-1 Axis and Mobilizes Effector Cells (2016) (24)
Tubulin binding cofactor C (TBCC) suppresses tumor growth and enhances chemosensitivity in human breast cancer cells (2010) (23)
Structure-activity relationships for euphocharacins A-L, a new series of jatrophane diterpenes, as inhibitors of cancer cell P-glycoprotein. (2004) (23)
Structural Insights into the Inhibition of Cytosolic 5′-Nucleotidase II (cN-II) by Ribonucleoside 5′-Monophosphate Analogues (2011) (23)
Intensive radio-chemotherapy with peripheral blood stem cell transplantation in young patients with chronic lymphocytic leukemia. (1992) (23)
High frequency of CD34+CD38-/low immature leukemia cells is correlated with unfavorable prognosis in acute myeloid leukemia (2017) (22)
Reduced progression-free survival in elderly patients receiving intensification with autologous peripheral blood stem cell reinfusion for multiple myeloma (1998) (22)
Special feature of mixed phosphotriester derivatives of cytarabine. (2009) (22)
Gemcitabine is active against clinical multiresistant Staphylococcus aureus strains and is synergistic with gentamicin. (2012) (22)
Gene therapy with Adv-IL-2 in unresectable digestive cancer: phase I-II study, intermediate report. (1999) (22)
Substrate cycles and drug resistance to 1-beta-D-arabinofuranosylcytosine (araC) (2005) (21)
BRAF and DIS3 Mutations Associate with Adverse Outcome in a Long-term Follow-up of Patients with Multiple Myeloma (2020) (21)
Tissue-nonspecific alkaline phosphatase is an anti-inflammatory nucleotidase. (2020) (21)
Differential Allelic Expression in Leukoblast from Patients with Acute Myeloid Leukemia Suggests Genetic Regulation of CDA, DCK, NT5C2, NT5C3, and TP53 (2008) (21)
Modulation of P‐glycoprotein activity by acridones and coumarins from Citrus sinensis (2007) (21)
Regulation and activity of cytosolic 5′‐nucleotidase II (2005) (21)
Inhibition of IGF-1 Signalling Enhances the Apoptotic Effect of AS602868, an IKK2 Inhibitor, in Multiple Myeloma Cell Lines (2011) (21)
Genetic Variants and Multiple Myeloma Risk: IMMEnSE Validation of the Best Reported Associations—An Extensive Replication of the Associations from the Candidate Gene Era (2014) (21)
Protein abundance of class III beta-tubulin but not Delta2-alpha-tubulin or tau is related to paclitaxel response in carcinomas of unknown primary site. (2008) (21)
Prognostic value of PINI index in patients with multiple myeloma (2012) (21)
Synovial cyst of the hip causing iliac vein and femoral nerve compression. (1987) (20)
CD73 inhibition by purine cytotoxic nucleoside analogue-based diphosphonates. (2018) (20)
Do hENT1 and RRM1 predict the clinical benefit of gemcitabine in pancreatic cancer? (2013) (20)
Spatial and Temporal Control of Cavitation Allows High In Vitro Transfection Efficiency in the Absence of Transfection Reagents or Contrast Agents (2015) (20)
Cell proliferation and drug sensitivity of human glioblastoma cells are altered by the stable modulation of cytosolic 5'-nucleotidase II. (2015) (20)
Determination of the enzymatic activity of cytosolic 5′-nucleotidase cN-II in cancer cells: development of a simple analytical method and related cell line models (2015) (20)
Recent developments to improve the efficacy of cytotoxic nucleoside analogues. (2006) (20)
mTOR inhibition reverses acquired endocrine therapy resistance of breast cancer cells at the cell proliferation and gene expression levels (2008) (20)
Initial absolute lymphocyte count as a prognostic factor for outcome in acute myeloid leukemia (2014) (19)
The purine analog fludarabine acts as a cytosolic 5'-nucleotidase II inhibitor. (2015) (19)
Beta-tubulin III expression in prostate cancer (2010) (19)
Nucleoside analogue delivery systems in cancer therapy (2007) (19)
High efficacy with five days schedule of oral fludarabine phosphate and cyclophosphamide in patients with previously untreated chronic lymphocytic leukaemia (2008) (19)
Structure-activity relationships of β-hydroxyphosphonate nucleoside analogues as cytosolic 5'-nucleotidase II potential inhibitors: synthesis, in vitro evaluation and molecular modeling studies. (2014) (18)
Hormonal Therapy Resistance and Breast Cancer: Involvement of Adipocytes and Leptin (2019) (18)
Isoprenoid flavonoids are new leads in the modulation of chemoresistance (2002) (18)
Tubulin folding pathways: implication in the regulation of microtubule dynamics. (2007) (18)
Oncogene- and drug resistance-associated alternative exon usage in acute myeloid leukemia (AML) (2015) (18)
Sensitization of chronic lymphocytic leukemia cells to TRAIL-induced apoptosis by hyperthermia. (2007) (18)
Multifocal progressive leukoencephalopathy occurring after refractory anemia and multiple infectious disorders consecutive to severe lymphopenia (2002) (17)
Modeling the Colchicum autumnale Tubulin and a Comparison of Its Interaction with Colchicine to Human Tubulin (2017) (17)
Common resistance mechanisms to nucleoside analogues in variants of the human erythroleukemic line K562. (1999) (17)
Skin lesions in malignancy. Case 3. Yellow nail syndrome in non-Hodgkin's lymphoma. (2001) (17)
The druggability of intracellular nucleotide-degrading enzymes (2016) (17)
Heterogeneity of protein kinase C β2 expression in lymphoid malignancies (2007) (17)
Cytosolic 5’-Nucleotidase II Interacts with the Leucin Rich Repeat of NLR Family Member Ipaf (2015) (17)
Kinetics and organ distribution of [14C]-sialic acid-GM3 and [3H]-sphingosine-GM1 after intravenous injection in rats. (1992) (16)
Doxorubicin Delivery into Tumor Cells by Stable Cavitation without Contrast Agents. (2017) (16)
Development of gene therapy in association with clinically used cytotoxic deoxynucleoside analogues (2009) (16)
A Tridimensional Model for NK Cell-Mediated ADCC of Follicular Lymphoma (2019) (16)
An Open Label, Dose Escalation Study of AVE9633 Administered as a Single Agent by Intravenous (IV) Infusion Weekly for 2 Weeks in 4-Week Cycle to Patients with Relapsed or Refractory CD33-Positive Acute Myeloid Leukemia (AML). (2007) (16)
Esophageal cancer cells resistant to T-DM1 display alterations in cell adhesion and the prostaglandin pathway (2018) (16)
2-[18F]Fludarabine, a Novel Positron Emission Tomography (PET) Tracer for Imaging Lymphoma: a Micro-PET Study in Murine Models (2014) (16)
5'-(3')-nucleotidase mRNA levels in blast cells are a prognostic factor in acute myeloid leukemia patients treated with cytarabine. (2004) (15)
Identification of Noncompetitive Inhibitors of Cytosolic 5'-Nucleotidase II Using a Fragment-Based Approach. (2015) (15)
Sensitization of ara‐C‐resistant lymphoma cells by a pronucleotide analogue (2003) (15)
Multidrug resistance ABC transporter structure predictions by homology modeling approaches. (2011) (15)
Benign recurrent cholestasis with normal gamma-glutamyl-transpeptidase activity. (1992) (15)
A common variant within the HNF1B gene is associated with overall survival of multiple myeloma patients: Results from the IMMEnSE consortium and meta-analysis (2016) (15)
Toxicities after peripheral blood progenitor cell transplantation for lymphoid malignancies: analysis of 300 cases in a single institution (1999) (15)
Polymorphisms in xenobiotic transporters ABCB1, ABCG2, ABCC2, ABCC1, ABCC3 and multiple myeloma risk: a case–control study in the context of the International Multiple Myeloma rESEarch (IMMEnSE) consortium (2012) (15)
Ungueotropic T-cell lymphoma. (2006) (15)
Targeted therapies in metastatic melanoma: toward a clinical breakthrough? (2010) (14)
Comprehensive investigation of genetic variation in the 8q24 region and multiple myeloma risk in the IMMEnSE consortium (2012) (14)
Therapeutic Enhancement of ER Stress by Insulin-Like Growth Factor I Sensitizes Myeloma Cells to Proteasomal Inhibitors (2013) (14)
Phase II study of 3-hour infusion of high dose paclitaxel in refractory and relapsed aggressive non-Hodgkin's lymphomas. Groupe d'Etude des Lymphomes de l'Adulte. (2000) (14)
Vinorelbine induces beta3-tubulin gene expression through an AP-1 Site. (2009) (14)
Compared Antitumor Activity of GA101 and Rituximab against the Human RL Follicular Lymphoma Xenografts in SCID Beige Mice. (2008) (14)
F-ara-AMP is a substrate of cytoplasmic 5′-nucleotidase II (cN-II): HPLC and NMR studies of enzymatic dephosphorylation (2006) (14)
[Distal metastases of bronchial cancers. Bone and soft tissue metastases]. (1990) (14)
Erratum: Microtubule-binding agents: a dynamic field of cancer therapeutics (2010) (14)
Methionine dependence of tumor cells: programmed cell survival? (1996) (14)
Loss of KDM1A in GIP-dependent primary bilateral macronodular adrenal hyperplasia with Cushing's syndrome: a multicentre, retrospective, cohort study. (2021) (13)
Inhibition of immune cell proliferation and cytokine production by lipoprotein-bound gangliosides (1994) (13)
Neutrophils protect lymphoma cells against cytotoxic and targeted therapies through CD11b/ICAM-1 binding (2017) (13)
Synthesis of new steroidal inhibitors of P-glycoprotein-mediated multidrug resistance and biological evaluation on K562/R7 erythroleukemia cells. (2015) (13)
Identification and validation of seven genes, as potential markers, for the differential diagnosis of small B cell lymphomas (small lymphocytic lymphoma, marginal zone B cell lymphoma and mantle cell lymphoma) by cDNA macroarrays analysis (2002) (13)
Evaluation of class III beta-tubulin (bTubIII) expression as a prognostic marker in patients with resectable non-small cell lung cancer (NSCLC) treated by perioperative chemotherapy (CT) in the phase III trial IFCT-0002. (2009) (13)
Modulation of cancer cell multidrug resistance by an extract of Ficus citrifolia. (2001) (12)
Paclitaxel-loaded microparticles for intratumoral administration via the TMT technique: preparation, characterization, and preliminary antitumoral evaluation. (2008) (12)
Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents. (2016) (12)
Advances in Bispecific Antibodies Engineering: Novel Concepts for Immunotherapies (2015) (12)
Bortezomib influences the expression of malignant plasma cells membrane antigens. (2013) (12)
Paclitaxel-Loaded Microparticles for Intratumoral Administration via the TMT Technique: Preparation, Characterization, and Preliminary Antitumoral Evaluation (2008) (12)
Genetic polymorphisms in genes of class switch recombination and multiple myeloma risk and survival: an IMMEnSE study (2019) (12)
The genomic landscape of plasma cells in systemic light chain amyloidosis. (2018) (12)
Exatecan Antibody Drug Conjugates Based on a Hydrophilic Polysarcosine Drug-Linker Platform (2021) (12)
Single nucleotide polymorphisms in ABCB1 and CBR1 can predict toxicity to R-CHOP type regimens in patients with diffuse non-Hodgkin lymphoma (2015) (12)
Prognostic Index for Older Adult Patients with Newly Diagnosed Acute Myeloid Leukemia: The Edouard Herriot Hospital Experience (2008) (11)
31st Annual Meeting and Associated Programs of the Society for Immunotherapy of Cancer (SITC 2016): part two (2016) (11)
Localization of putative binding sites for cyclic guanosine monophosphate and the anti-cancer drug 5-fluoro-2′-deoxyuridine-5′-monophosphate on ABCC11 in silico models (2013) (11)
A p21/WAF1 mutation favors the appearance of drug resistance to paclitaxel in human noncancerous epithelial mammary cells (2006) (11)
Type 2 diabetes-related variants influence the risk of developing multiple myeloma: results from the IMMEnSE consortium. (2015) (11)
Expression of domains for protein–protein interaction of nucleotide excision repair proteins modifies cancer cell sensitivity to platinum derivatives and genomic stability (2014) (10)
Apoptotic induction by anti-CD20 antibodies in chronic lymphocytic leukemia: comparison of rituximab and obinutuzumab (2014) (10)
Peripheral blood stem cells harvested after chemotherapy and GM-CSF for treatment intensification in patients with advanced lymphoproliferative diseases. (1993) (10)
Accumulation of lactosylceramide and overexpression of a PSC833-resistant P-glycoprotein in multidrug-resistant human sarcoma cells. (2011) (10)
Heterogeneity of acute lymphoblastic leukemia in HIV-seropositive patients. (1994) (10)
A phase II trial of miltefosine in patients with cutaneous T-cell lymphoma. (2006) (10)
The Adipose Microenvironment Dysregulates the Mammary Myoepithelial Cells and Could Participate to the Progression of Breast Cancer (2021) (10)
Sever immune thombocytopenic purpura and haemolytic anaemia in a hairy‐cell leukaemia patient (1995) (10)
Beta-hydroxyphosphonate ribonucleoside analogues derived from 4-substituted-1,2,3-triazoles as IMP/GMP mimics: synthesis and biological evaluation (2016) (10)
Silicosis due to inhalation of domestic cleaning powder (1991) (9)
Silencing of Tubulin Binding Cofactor C Modifies Microtubule Dynamics and Cell Cycle Distribution and Enhances Sensitivity to Gemcitabine in Breast Cancer Cells (2011) (9)
Higher percentage of CD34 + CD38− cells detected by multiparameter flow cytometry from leukapheresis products predicts unsustained complete remission in acute myeloid leukemia (2015) (9)
International Society for Therapeutic Ultrasound Conference 2016 (2017) (9)
Very low density lipoproteins and interleukin 2 enhance the immunogenicity of 9-O-acetyl-GD3 ganglioside in BALB/c mice. (1997) (9)
[Antibody-drug conjugates in oncology: from the concept to trastuzumab emtansine (T-DM1)]. (2012) (9)
Identification of miRSNPs associated with the risk of multiple myeloma (2017) (9)
Pegfilgrastim Enhances the Antitumor Effect of Therapeutic Monoclonal Antibodies (2016) (9)
Inhibition of P-glycoprotein-mediated multidrug efflux by aminomethylene and ketomethylene analogs of reversins. (2006) (9)
Clinical and pharmacokinetic phase II study of fotemustine in refractory and relapsing multiple myeloma patients. (2003) (9)
IL‐3 increases marrow and peripheral erythroid precursors in chronic pure red cell aplasia presenting in childhood (1995) (8)
Regulation of tubulin expression: Multiple overlapping mechanisms (2009) (8)
Adipocyte-conditioned medium induces resistance of breast cancer cells to lapatinib (2020) (8)
Second autologous transplantation after failure of a first autologous transplant in 18 patients with non-Hodgkin's lymphoma. (2004) (8)
Stably transfected adherent cancer cell models with decreased expression of 5′-nucleotidase cN-II (2016) (8)
The cytosolic 5′-nucleotidase cN-II lowers the adaptability to glucose deprivation in human breast cancer cells (2017) (8)
Deoxycholic acid derivatives as inhibitors of P-glycoprotein-mediated multidrug efflux (2016) (8)
ABCC 11 expression is regulated by estrogen in MCF 7 cells , correlated with estrogen receptor a expression in postmenopausal breast tumors and overexpressed in tamoxifen-resistant breast cancer cells (2008) (8)
Short Communication A revised nomenclature for the human and rodent α-tubulin gene family (2007) (8)
The Novel Aurora Kinase Inhibitor AS703569 Shows Potent Anti-Tumor Activity in Acute Myeloid Leukemia (AML). (2007) (8)
Leukocytosis and circulating blasts in older adults with newly diagnosed acute myeloid leukemia: are they valuable factors for therapeutic decision-making? (2011) (8)
Enhanced migration of breast and lung cancer cells deficient for cN-II and CD73 via COX-2/PGE2/AKT axis regulation (2020) (7)
Diagnostics of the AML with immunophenotypical data (2006) (7)
Late autologous transplantation in chronic myelogenous leukemia with peripheral blood progenitor cells mobilized by G-CSF and interferon-α (2000) (7)
Rare Circulating Cells in Familial Waldenström Macroglobulinemia Displaying the MYD88 L265P Mutation Are Enriched by Epstein-Barr Virus Immortalization (2015) (7)
The cytosolic 5'-nucleotidase cN-II lowers the adaptability to glucose deprivation in human breast cancer cells. (2017) (7)
Genetically determined telomere length and multiple myeloma risk and outcome (2021) (7)
A heavy metal baseline score predicts outcome in acute myeloid leukemia (2020) (7)
Lead optimization and biological evaluation of fragment-based cN-II inhibitors. (2019) (7)
Impact of clinical practice guidelines on the management for carcinomas of unknown primary site: a controlled "before-after" study. (2009) (7)
Platelet concentrate supernatants alter endothelial cell mRNA and protein expression patterns as a function of storage length (2018) (7)
Functions of the multi‐interacting protein KIDINS220/ARMS in cancer and other pathologies (2018) (6)
Progesterone–adenine hybrids as bivalent inhibitors of P-glycoprotein-mediated multidrug efflux: Design, synthesis, characterization and biological evaluation (2012) (6)
MRP8/ABCC11 Expression Is Regulated by Dexamethasone in Breast Cancer Cells and Is Associated to Progesterone Receptor Status in Breast Tumors (2011) (6)
[Tarsal bone metastasis of bladder carcinoma]. (1987) (6)
In vitro antileukaemic activity of extracts from Daphne gnidium leaves against sensitive and multidrug resistant K562/R7 cells (2014) (6)
Inclusion complexes of a nucleotide analogue with hydroxypropyl-beta-cyclodextrin (2009) (6)
Identification of TACC 1 , NOV , and PTTG 1 as new candidate genes associated with endocrine therapy resistance in breast cancer (2009) (6)
Design, synthesis and evaluation of progesterone-adenine hybrids as bivalent inhibitors of P-glycoprotein-mediated multidrug efflux. (2010) (6)
Development of a confocal ultrasound device using an inertial cavitation control for transfection in-vitro (2015) (6)
Transient Acute Myopia Induced by Antilymphocyte Globulins (1999) (6)
Determination and quantification of intracellular fludarabine triphosphate, cladribine triphosphate and clofarabine triphosphate by LC-MS/MS in human cancer cells. (2017) (5)
Prediction of gemcitabine benefit after curative-intent resection of pancreatic adenocarcinoma using HENT1 and dCK protein expression. (2011) (5)
Characterization of T‐DM1‐resistant breast cancer cells (2020) (5)
[Class III beta tubulin expression in nonsmall cell lung cancer]. (2010) (5)
Evaluation of Microtubule Associated Parameters (MTAPs) as predictive markers for Advanced Breast Cancer (ABC) patients treated with docetaxel (2001) (5)
Synthesis and Evaluation of a Molecularly Imprinted Polymer for Selective Solid-Phase Extraction of Irinotecan from Human Serum Samples (2012) (5)
Minimally differentiated acute myeloid leukemia (FAB AML-M0): prognostic factors and treatment effects on survival--a retrospective study of 42 adult cases. (2011) (5)
Sensitivity and gene expression profile of fresh human acute myeloid leukemia cells exposed ex vivo to AS602868 (2011) (5)
Polymorphisms in regulators of xenobiotic transport and metabolism genes PXR and CAR do not affect multiple myeloma risk: a case–control study in the context of the IMMEnSE consortium (2013) (5)
Human T-cell leukemia virus type I-induced proliferation of human thymocytes requires the presence of a comitogen. (1988) (4)
Brachial plexus compression by an iatrogenic arteriovenous fistula (1987) (4)
Jatrophane Diterpenes as Modulators of Multidrug Resistance. Advances of Structure—Activity Relationships and Discovery of the Potent Lead Pepluanin A. (2004) (4)
In vitro modulation of multidrug resistance by pregnane steroids and in vivo inhibition of tumour development by 7α-OBz-11α(R)-OTHP-5β-pregnanedione in K562/R7 and H295R cell xenografts (2019) (4)
The challenge of myeloma-related thromboembolic disease: can thrombin generation assay help physicians to better predict the thromboembolic risk and personalize anti-thrombotic prophylaxis? (2019) (4)
[Pneumococcal cellulitis revealing a myeloma]. (2000) (4)
Bacterial Deoxyribonucleoside Kinases are Poor Suicide Genes in Mammalian Cells (2009) (4)
A label‐free mass spectrometry method for relative quantitation of β‐tubulin isotype expression in human tumor tissue (2012) (4)
Granulocyte Colony-Stimulating Factor Nanocarriers for Stimulation of the Immune System (Part I): Synthesis and Biodistribution Studies. (2017) (4)
TET2 exon 2 skipping is an independent favorable prognostic factor for cytogenetically normal acute myelogenous leukemia (AML): TET2 exon 2 skipping in AML. (2017) (4)
Mobilization of CD34(+)CD38(-) hematopoietic stem cells after priming in acute myeloid leukemia. (2013) (4)
LFB-R603, a Third-Generation Monoclonal Anti-CD20 Antibody Displays An Additive Antitumor Activity with Antileukemic Chemotherapeutic Agents in Mouse Xenograft Models (2011) (4)
BCIRG 001 molecular analysis: Identification of prognostic factors in patients (pts) receiving adjuvant therapy for node- positive (N+) breast cancer (BC) (2007) (4)
Piperidinyl-embeded chalcones possessing anti PI3Kδ inhibitory properties exhibit anti-atopic properties in preclinical models. (2018) (4)
Real life management of patients hospitalized with multiple myeloma in France (2018) (4)
[Antibody-drug conjugates in oncology. Recent success of an ancient concept]. (2019) (4)
A prospective study of intensive induction therapy with high-dose consolidation in patients with aggressive non-Hodgkin's lymphoma and two or three adverse prognostic factors (2000) (4)
Unexpected Growth-Promoting Effect of Oxaliplatin in Excision Repair Cross-Complementation Group 1 Transfected Human Colon Cancer Cells (2018) (4)
Impact of clinical practice guidelines on the diagnostic strategy for carcinomas of unknown primary site: a controlled 'before-after' study. (2008) (3)
[Can tumor hypoxia be turned into a chemotherapeutic advantage?]. (2008) (3)
Payload diversification: a key step in the development of antibody–drug conjugates (2023) (3)
Enhancing the activity of platinum-based drugs by improved inhibitors of ERCC1–XPF-mediated DNA repair (2021) (3)
[Efflux pumps: their role in Staphylococcus aureus antibiotic resistance]. (2008) (3)
Hepatic angiosarcoma in a patient with essential thrombocythaemia and Budd-Chiari syndrome. (1995) (3)
Multidrug Resistance‐Associated Protein (MRP/ABCC Proteins) (2009) (3)
[Antitubulin agents]. (2011) (3)
[Gangliosides and cancer]. (1991) (3)
[Immunotherapy and cancer: the role of monoclonal antibodies]. (1989) (3)
CD73 and cN-II regulate the cellular response to chemotherapeutic and hypoxic stress in lung adenocarcinoma cells. (2021) (3)
Abstract 4735: SAR650984: Characterization of a potent phase I humanized anti-CD38 antibody for the treatment of multiple myeloma and other hematologic malignancies. (2013) (3)
A Two-complementary Method Assay for Screening New Reversal Agents of Cancer Cell Multidrug Resistance (2003) (3)
IN VIVO SYNGENEIC TUMOR MODELS WITH ACQUIRED RESISTANCE TO ANTI-PD-1/PD-L1 THERAPIES. (2022) (3)
[Metabolism, mechanism of action and resistance to cytotoxic nucleoside analogues]. (2005) (3)
Analgesic and preventive effects of donepezil in animal models of chemotherapy-induced peripheral neuropathy: Involvement of spinal muscarinic acetylcholine M2 receptors. (2022) (3)
Calcium Channel Blockers Impair the Antitumor Activity of Anti-CD20 Monoclonal Antibodies by Blocking EGR-1 Induction (2020) (3)
Common gene variants within 3′‐untranslated regions as modulators of multiple myeloma risk and survival (2020) (3)
Reply to “Clinical and therapeutic implications of BRAF mutation heterogeneity in metastatic melanoma” by Mesbah Ardakani et al. (2017) (3)
[Antibody-drug conjugates in oncology. New strategies in development]. (2019) (2)
[Rituximab: mechanism of action and resistance]. (2007) (2)
Targeting the nucleotide metabolism proteins of the NUDIX family and SAMHD1 in cancer. (2020) (2)
A polygenic risk score for multiple myeloma risk prediction (2021) (2)
Enhanced Sensitivity of Idelalisib and Ibrutinib-Resistant Cell Lines to Anti-CD38 Antibodies (2020) (2)
Corrigendum to "A revised nomenclature for the human and rodent α-tubulin gene family" [Genomics 90 (2007) 285-289] (DOI:10.1016/j.ygeno.2007.04.008) (2009) (2)
Rituximab in CD20 Positive Multiple Myeloma: A Prospective Study from the IFM Group. (2006) (2)
Netrin-1 expression and targeting in multiple myeloma (2019) (2)
Gangliosides et cancer. (1991) (2)
Preparation, characterization and in vitro evaluation of a new nucleotide analogue prodrug cyclodextrin inclusion complexes. (2009) (2)
Les agents antitubulines (2011) (2)
Analysis of the Sub-Clonal Structure of Smoldering Myeloma over Time Provides a New Means of Disease Monitoring and Highlights Evolutionary Trajectories Leading to Myeloma (2019) (2)
Anti-Lymphoma Activity of the Novel Anti-CD 20 Antibody Preclinical Studies on the Mechanism of Action and the Updated (2011) (2)
The Expression of Anti-Müllerian Hormone Type II Receptor (AMHRII) in Non-Gynecological Solid Tumors Offers Potential for Broad Therapeutic Intervention in Cancer (2021) (2)
Expression quantitative trait loci of genes predicting outcome are associated with survival of multiple myeloma patients (2021) (2)
838 TESTING AND PROGNOSTIC IMPLICATIONS OF PROSTATE CANCER STEM CELLS IN BONE MARROW (2011) (2)
7th Cancer Scientific Forum of the Cancéropôle Lyon Auvergne Rhône-Alpes (2012) (2)
Evaluation of gemcitabine in relapsed or refractory multiple myeloma. (2004) (2)
98: Reduced content of Tubulin binding cofactor C (TBCC) in breast cancer cells modifies progression into cell cycle and influences response to treatments (2010) (1)
Abstract 774: Anti-Müllerian hormone type II receptor (AMHRII) found expressed in human non-gynecological solid tumors, suggesting potential broader applications for anti-AMHRII-based therapy (2018) (1)
[Prognostic factors, late relapse and outcome of patients with aggressive malignant lymphoma: long term results of LNH-80 protocol]. (1992) (1)
Prognostic impact of cN-III mRNA expression on overall survival and drug sensitivity in pediatric leukemia (2021) (1)
Higher Percentage of CD34+CD38− Cells Detected by Multiparameter Flow Cytometry From Leukapheresis Products Predict Unsustained Complete Remission in AML (2012) (1)
Natural Killer Cells Display an Activated Phenotype but Reduced Effector Functions in Obese Patients (2015) (1)
What can we expect from liposomal drugs? (2001) (1)
The molecular make up of smoldering myeloma highlights the evolutionary pathways leading to multiple myeloma (2021) (1)
Erratum: Genome-wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (Nature Communications (2015) 6 (7539) DOI: 10.1038/ncomms8539) (2015) (1)
Granulocyte-Colony Stimulating Factor Nanocarriers for Stimulation of the Immune System (Part II): Dose-Dependent Biodistribution and In Vivo Antitumor Efficacy in Combination with Rituximab. (2017) (1)
Correction: Corrigendum: Genome-wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (2015) (1)
Transcriptional and Metabolic Investigation in 5′-Nucleotidase Deficient Cancer Cell Lines (2021) (1)
A functional procedure using fresh samples to select patients with acute myeloid leukemia prior to treatment with the novel targeted cytotoxic agent F14512. (2016) (1)
Impact of mouse model tumor implantation site on acquired resistance to anti-PD-1 immune checkpoint therapy (2023) (1)
In-vitro and in-vivo siRNA transfection by an ultrasonic confocal device (2012) (1)
Comparison of Cytotoxic Mechanisms of Anti-CD20 Antibodies GA101 and Rituximab Against Fresh Chronic Lymphocytic Leukemia Cells (2010) (1)
A Genome-Wide Association Study Identi fi es a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Patients with Multiple Myeloma (2016) (1)
Host immune genetic variations influence the risk of developing acute myeloid leukaemia: results from the NuCLEAR consortium (2020) (1)
Genetic Polymorphisms Correlated with Outcome in Multiple Myeloma Patients Receiving High Dose Melphalan. (2006) (1)
The first ADC bearing the ferroptosis inducer RSL3 as a payload with conservation of the fragile electrophilic warhead. (2022) (1)
Genome-wide association study identifies variants at 16 p 13 associated with survival in multiple myeloma patients (2015) (1)
Unusual Organisms in the Bone Marrow of a Patient With Systemic Sarcoidosis (2005) (1)
Abstract 309: Mechanisms of resistance to trastuzumab emtansine in gastric cancer (2016) (1)
Effectiveness of 2‐chlorodeoxyadenosine in nodal and extra haematopoietic localizations in hairy cell leukaemia (1995) (1)
Proof of Concept: Protein Delivery into Human Erythrocytes Using Stable Cavitation. (2022) (1)
Cytotoxic and antitumoral activity of N-(9H-purin-6-yl) benzamide derivatives and related water-soluble prodrugs. (2021) (1)
Evaluation of natural phenolic compounds from Clusiaceae as P-glycoprotein inhibitors (2007) (1)
Abstract 3274: Combination of elacytarabine and daunorubicin is significantly more effective than combination of cytarabine and daunorubicin in primary patient xenografts of AML. (2013) (1)
New derivatives of chalcone, has antimitotic activity (2006) (0)
Abstract 1778: 5’-nucleotidases are involved in the biology of human lung cancer cell lines (2019) (0)
Abstract 2723: In vivo activity of combinations of cytotoxic regimens with anti-PD1 and anti-PDL1 in various syngeneic cancer models (2018) (0)
A Genome-Wide Association Study Identifies a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Multiple Myeloma Patients (2020) (0)
The International Multiple Myeloma Research (IMMEnSE) Consortium: Genetics of Multiple Myeloma Risk and Prognosis (2014) (0)
[Chemotherapy for human immunodeficiency virus infection. Current status and perspectives]. (1992) (0)
Allogeneic Hematopoietic Stem Cell Transplantation in First Line High Risk Multiple Myeloma Patients: Evolving Strategies with the Immunomodulating Drugs. (2012) (0)
ESTABLISHMENT AND CHARACTERISATION OF A PRECLINICAL BLADDER MODEL OF RESISTANCE TO IMMUNE CHECKPOINT INHIBITORS (2018) (0)
New derivatives of azacoumarines presenting inhibitory activity of the mdr pump (2011) (0)
Resistance to Anticancer Antibodies: From Mechanisms to Solutions (2013) (0)
Sequencing at lymphoid neoplasm susceptibility loci maps six myeloma risk genes (2021) (0)
A High Density Polymorphism Analysis of Factors Correlated with Neurotoxicity to Bortezomib in Patients with Multiple Myeloma. (2009) (0)
Single Nucleotide Polymorphisms in ABCB1 and CBR1 Predict Toxicity to R-CHOP Type Regimens in Patients with Diffuse Non Hodgkin's Lymphoma (2012) (0)
Candidate molecular markers associated with endocrine resistance in breast carcinoma (2008) (0)
Clinical characteristics and outcome of 318 families with familial monoclonal gammopathy: A multicenter Intergroupe Francophone du Myélome study (2023) (0)
Phosphoester prodrugs of gemcitabine as anticancer agents (2007) (0)
Abstract 3783: Adipocytes inhibit trastuzumab-mediated ADCC via induction of GDF15 (2014) (0)
Reply to R.S. Mehta et al (2009) (0)
The Challenge of Myeloma-Related Thromboembolic Disease: Can Thrombin Generation Assay May Detect Disease-Related Hypercoagulability? (2014) (0)
Anticancer composition containing anthracycline compound (1997) (0)
Abstract 5835: Adipocyte-released agents induce resistance of breast cancer cells to lapatinib (2018) (0)
Immunophenotypic Diagnostic Score for MDS Taking into Account Various Cell Populations. (2004) (0)
Title : Quantitative Analysis of Nucleoside Transporter and Metabolism Gene Expression in Chronic Lymphocytic Leukemia ( CLL ) – Identification of fludarabine-sensitive and insensitive populations Short title : Nucleoside transporter and metabolism expression in CLL (2004) (0)
Global Expression Changes of Malignant Plasma Cells over Time Reveals the Evolutionary Development of Signatures of Aggressive Clinical Behavior (2018) (0)
Is anemia an important prognostic factor in non-Hodgkins lymphoma patients? (1996) (0)
Abstract 3613: Opposite effects of adipocytes and adenosine on hematological cancer cell survival and proliferationin vitro (2014) (0)
Correlation between MRD and Chimerism Kinetics in CLL Patients after Myeloablative and Non-Myeloablative Allogeneic Hematopoïetic Stem Cell Transplantation. (2007) (0)
PKC beta II Expression in Lymphoid Malignancies. (2004) (0)
Reversion of the resistance to tamoxifen and cross-resistance to fulvestrant in a novel breast cancer cell line by inhibition of the PI3K/Akt/mTor signaling pathway (2007) (0)
P640 Fatal viral opportunistic infections and Epstein-Barr virus positive large B-cell lymphoma after alemtuzumab treatment for a refractory Sezary syndrome (2007) (0)
Long-term Analysis Of Multiple Sequential Samples Reveals Patterns Of Progression In Smoldering Myeloma (2019) (0)
Polymorphisms in xenobiotic transporters ABCB1, ABCG2, ABCC2, ABCC1, ABCC3 and multiple myeloma risk: a case—control study in the context of the International Multiple Myeloma rESEarch (IMMEnSE) consortium (2013) (0)
A Biomathematical Analysis of Immunophenotypic Characteristics in Patients with Acute Myeloblastic Leukemia. (2006) (0)
Development of a sensitive and selective LC/MS/MS method for the simultaneous determination of intracellular 1-beta-arabinofuranosylcytosine triphosphate (araCTP), cytidine triphosphate (CTP) and deoxycytidine triphosphate (dCTP) in a human follicular lymphoma cell line. (2009) (0)
Abstract 2051: Antitumor activity of a novel allogeneic colorectal cancer vaccine in C57BL/6 mice bearing MC38 anti-PD1 resistant colon carcinoma syngeneic model with TME (2022) (0)
ESCCA 2009, Abstract Clinical Cytometry 2009 (2016) (0)
Cancer Therapy : Preclinical SAR 650984 , A Novel Humanized CD 38-Targeting Antibody , Demonstrates Potent AntitumorActivity inModels ofMultiple Myeloma and Other CD 38 þ Hematologic Malignancies (2014) (0)
Variability in CD39 and CD73 protein levels in uveal melanoma patients (2022) (0)
Long-Term Follow-up of Multiple Myeloma Patients Treated by Bortezomib (Velcade®): A Study on Efficacy, Tolerance, Survival and Time to Progression (2008) (0)
Preclinical Development Silencing of Tubulin Binding Cofactor C Modifies Microtubule Dynamics and Cell Cycle Distribution and Enhances Sensitivity to Gemcitabine in Breast Cancer Cells (2011) (0)
A Genome-Wide Association Study Identifies a Novel Locus for Bortezomib-Induced Peripheral Neuropathy in European Multiple Myeloma Patients Running title : GWAS in multiple myeloma pharmacogenomics (2016) (0)
[Translational research and Cancer Plan]. (2007) (0)
[Use of monoclonal antibodies in the treatment of cancer]. (1987) (0)
Mutations and Copy Number Changes Predict Progression from Smoldering Myeloma to Symptomatic Myeloma in the Era of Novel IMWG Criteria (2018) (0)
Expression of the Chemokine Receptor CXCR4, CXCL12G801A Gene polymorphism and SDF1 Plasma Levels in B-Cell Chronic Lymphocytic Leukemia (B-CLL): Correlation with PBSC Mobilisation, Disease Characteristics and Outcome. (2009) (0)
IsItPossible ToDefine aCutoff Value ofInfected Cells inBALFluid (2015) (0)
Adipocyte-conditioned medium induces resistance of breast cancer cells to lapatinib (2020) (0)
OR04-4 Loss of KDM1A in Bilateral Macronodular Adrenal Hyperplasia With GIP-Dependent Cushing's Syndrome and in Acromegaly With Paradoxical GH Response to Oral Glucose (2022) (0)
Chronic recurrent multifocal osteomyelitis in children with hypophosphatasia explained by anti-inflammatory nucleotidase activity of tissue nonspecific alkaline phosphatase in mesenchymal and hematopoietic cells (2019) (0)
Evaluating the relevance of the platelet transcriptome (2003) (0)
Insulin-Like Growth Factor 1 Potentiates the Cytotoxic Activity of Bortezomib Against Myeloma Cells (2010) (0)
Crystal structure of CD38 with a novel CD38-targeting antibody SAR650984 (2014) (0)
Abstract 4200: Characterization of acquired resistant models to therapies targeting the PD-1/PD-L1 axis demonstrates model-dependent mechanisms (2022) (0)
RG6234: A Novel 2:1 GPRC5D T Cell Bispecific Antibody Exhibits Best in Class Potential for the Treatment of Multiple Myeloma As a Monotherapy and in Combination (2022) (0)
Abstract 5078: Genome wide association study identifies variants at 16p13 associated with survival in multiple myeloma patients (2014) (0)
Large-Scale Linkage Analysis of Multiple Myeloma (MM) and Monoclonal Gammopathy of Undetermined Significance (MGUS) Families (2018) (0)
Targetting glutaminase to starve lymphoma cells. (2022) (0)
A comparison of flow cytometry detection of minimal residual disease and chimerism kinetics in chronic lymphocytic leukemia patients after allogeneic hematopoietic stem cell transplantation (2011) (0)
dCK for: aaa cct gaa cga tgg tct ttt tac c 5'-Fam-caa aca tat gcc tgt ctc agt rev: ctt tga gct tgc cat tca gag a cga ata aga gct c-Tamra UMP/ for: gggcatattctttgcttcca SYBR Green CMP-K rev: tgcatttcaaggttccactg (2005) (0)
[Factors predictive of chemotherapy resistance in patients with breast cancer]. (2000) (0)
Polymorphisms in Regulators of Xenobiotic Transport and Metabolism Genes NR1I2 and NR1I3 and Multiple Myeloma Risk: A Case-Control Study in the Context of IMMEnSE Consortium (2011) (0)
Reply to L.C. Panasci (2009) (0)
Research of genetic factors predisposing to dysglobulinemia (2008) (0)
Cancer Therapy: Preclinical SAR650984, A Novel Humanized CD38-Targeting Antibody, Demonstrates Potent AntitumorActivity inModels ofMultiple Myeloma and Other CD38þ Hematologic Malignancies (2014) (0)
New chalcone derivatives presenting an antiallergic activity (2013) (0)
Multiparametric Flow Cytometry Evaluation of CD200L/CD200R- LSC/NK Synapse Including Leukemia Stem Cell (LSC) Fraction As a Potential Therapeutic Target and Marker of NK Cell Exhaustion in Pediatric AML-Conect-AML French Collaborative Network (2021) (0)
Abstract P4-08-06: Companion Diagnostic Test for Expression of β-III tubulin (ß3T) in Breast Cancer (BC) Using an Immunohistochemical (IHC) Assay in Studies of Ixabepilone (Ixa) (2010) (0)
7th cancer scientific forum of theCancéropôle Lyon Auvergne Rhône-Alpes: March 20-21, 2012, Lyon, France. (2012) (0)
Abstract 3835: Identification and characterization of inhibitors of 5′-nucleotidase cN-II issued from virtual screening (2012) (0)
fludarabine-sensitive and -insensitive populations expression in chronic lymphocytic leukemia (CLL): identification of Quantitative analysis of nucleoside transporter and metabolism gene (2013) (0)
Abstract 5602: BRAF V600 mutated allelic specific imbalance (MASI) impact on sensitivity to vemurafenib (2014) (0)
Skipping of ATP-Binding Cassette Transporter A3 Exon 19 in AML Cells Is an Independent Prognostic Factor in Patients with Normal Cytogenetics (2014) (0)
Adipocytes promote breast cancer resistance to chemotherapy, a process amplified by obesity: role of the major vault protein (MVP) (2019) (0)
The Bone Morphogenetic Protein (BMP)-4 Is Involved in the Regulation of Human Megakaryocytic Differentiation during Thrombopoietin Signaling. (2008) (0)
Introducing the Electronic Journal of Oncology (2004) (0)
COMMUNICATION Monodisperse Polysarcosine-based Antibody-Drug Conjugates (2021) (0)
prognostic factor in chronic myeloid leukemia compartment represents a novel + Deregulation of TWIST-1 in the CD34 (2011) (0)
Identification of Genetic Markers for the Outcome of Patients with Acute Myeloid Leukemia Treated with Cytarabine. (2007) (0)
[The role of gemcitabine in hematology]. (2002) (0)
Abstract 5014: Neutrophils protect B-cell lymphomas against chemotherapy via cell-cell interactions mediated by CD44 and ICAM1 receptors (2015) (0)
69: Chronic Lymphocytic Leukemia and anti-CD20 monoclonal antibodies (2010) (0)
111 POSTER Design of a screening procedure to select patients with leukemia for treatment with F 14512, a novel targeted cytotoxic agent (2008) (0)
Prognostic Value of PINI in Elderly Patients with Multiple Myeloma (MM). (2009) (0)
1179 Efficacy study of STC-1010 antitumor vaccine associated with standard chemotherapies on MC 38 syngeneic colon cancer tumor model (2022) (0)
Abstract 4594: Induction of apoptosis by anti-CD20 antibodies requires the induction of EGR-1 and calcium influx (2017) (0)
Arl2 content influences p53 phosphorylation and localization in a breast cancer cell line (2007) (0)
Twist-1 Expression Represents a Novel Prognostic Factor in Chronic Myelogenous Leukemia. (2009) (0)
[Optimising therapy in patients with haematological malignancies]. (2008) (0)
Brief report Deregulation of TWIST-1 in the CD34 (cid:1) compartment represents a novel prognostic factor in chronic myeloid leukemia (2011) (0)
A Genome Wide Association Study Reveals Genetic Predisposition for Bortezomib-Induced Peripheral Neuropathy in Multiple Myeloma By Variation in the PREP1-Cbs Locus (2014) (0)
Monodisperse Polysarcosine-Based Antibody-Drug Conjugates (2018) (0)
Correction: ADP Ribosylation Factor Like 2 (Arl2) Regulates Breast Tumor Aggressivity in Immunodeficient Mice (2009) (0)
[Oculomotor imbalance in severe hypermetropia. (Apropos of 169 cases)]. (1972) (0)
The Electronic Journal of Oncology (1999) (0)
Prognostic Index for Older Adult Patients with Newly Diagnosed Acute Myeloid Leukemia: The Edouard Herriot Hospital Experience. (2007) (0)
Abstract 5291: Netrin-1 expression and targeting in multiple myeloma (2019) (0)
Effect of Imids on Gene Expression Profiles of Fresh Human Myeloma Cells (2010) (0)
A pleiotropic variant in DNAJB4 is associated with multiple myeloma risk (2022) (0)
Loss of lysine demethylase KDM1A in GIP-dependent bilateral macronodular adrenal hyperplasia with Cushing's syndrome (2022) (0)
908 Humanized model for assessment of therapies targeting either lymphoid or myeloid compartment: enhanced evaluation of clinical relevancy & translatability (2021) (0)
Abstract LB-078: Effect of a combined immune checkpoint inhibitor and mechanical focused ultrasound treatment on intratumoral immune response in a MC38 preclinical model (2020) (0)
Type 2 Diabetes-Related Variants Influence on the Risk of Developing Multiple Myeloma: Results from the Immense Consortium (2014) (0)
COMMUNICATION Monodisperse Polysarcosine-based Highly-loaded Antibody-Drug Conjugates (2021) (0)
A076 Long-Term Follow-up of Multiple Myeloma Patients Treated by VELCADE (2009) (0)
ADP ribosylation factor like protein 2 (Arl2) regulates microtubule composition and dynamics in breast cancer cells (2006) (0)
Abstract 1779: Inability to regulate ROS content confers sensitivity to ferroptosis in breast cancer cells resistant to T-DM1 (2022) (0)
Analysis of Familial Dysglobulinemia: a Multicenter IFM Study. (2009) (0)
Abstract 3164: Impact of cN-II and CD73 inhibition on cancer cell migration (2018) (0)
Adipose cells promote resistance of breast cancer cells to trastuzumab-mediated antibody-dependent cellular cytotoxicity (2015) (0)
TET2 Exon 2 Skipping Confers Sensitivity to AraC and Is an Independent Favorable Prognostic Factor in AML Patients Treated with Intensive Chemotherapy (2014) (0)
of the Intergroupe Francophone du Myélome Genetic abnormalities and survival in multiple myeloma: the experience (2011) (0)
Enhanced migration of breast and lung cancer cells deficient for cN-II and CD73 via COX-2/PGE2/AKT axis regulation (2020) (0)
Molecular imaging biomarkers to predict resistance to nucleoside analogs in cancer (2008) (0)
Diverse approaches for the design cytosolic 5’-nucleotidase inhibitors (2018) (0)
Comparison of Na18F and 18F-Deoxyglucose Positron Emission Tomography in Patients with Multiple Myeloma. (2004) (0)

This paper list is powered by the following services:

What Schools Are Affiliated With Charles Dumontet?

Charles Dumontet is affiliated with the following schools:

Charles Dumontet's Academic­Influence.com Rankings

Charles Dumontet's Degrees

Similar Degrees You Can Earn

Why Is Charles Dumontet Influential?

Charles Dumontet's Published Works

Published Works

What Schools Are Affiliated With Charles Dumontet?

Charles Dumontet's AcademicInfluence.com Rankings