Cecile M. Pickart
#148,801
Most Influential Person Now
Cecile M. Pickart's AcademicInfluence.com Rankings
Cecile M. Pickartbiology Degrees
Biology
#10979
World Rank
#14345
Historical Rank
Biochemistry
#1784
World Rank
#1920
Historical Rank

Download Badge
Biology
Why Is Cecile M. Pickart Influential?
(Suggest an Edit or Addition)Cecile M. Pickart's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Mechanisms underlying ubiquitination. (2001) (3630)
- Activation of the IκB Kinase Complex by TRAF6 Requires a Dimeric Ubiquitin-Conjugating Enzyme Complex and a Unique Polyubiquitin Chain (2000) (1882)
- Recognition of the polyubiquitin proteolytic signal (2000) (1795)
- Ubiquitin: structures, functions, mechanisms. (2004) (1281)
- The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses (2004) (1132)
- Polyubiquitin chains: polymeric protein signals. (2004) (1061)
- Noncanonical MMS2-Encoded Ubiquitin-Conjugating Enzyme Functions in Assembly of Novel Polyubiquitin Chains for DNA Repair (1999) (842)
- Proteasomes and their kin: proteases in the machine age (2004) (771)
- A 26 S protease subunit that binds ubiquitin conjugates. (1994) (755)
- Back to the Future with Ubiquitin (2004) (714)
- Ubiquitin in chains. (2000) (494)
- A proteasomal ATPase subunit recognizes the polyubiquitin degradation signal (2002) (468)
- Ubiquitin enters the new millennium. (2001) (408)
- Targeting of substrates to the 26S proteasome (1997) (374)
- Huntingtin Is Ubiquitinated and Interacts with a Specific Ubiquitin-conjugating Enzyme* (1996) (373)
- Mms2–Ubc13 covalently bound to ubiquitin reveals the structural basis of linkage-specific polyubiquitin chain formation (2006) (339)
- Diverse polyubiquitin interaction properties of ubiquitin-associated domains (2005) (335)
- Solution Conformation of Lys63-linked Di-ubiquitin Chain Provides Clues to Functional Diversity of Polyubiquitin Signaling* (2004) (334)
- Inhibition of the ubiquitin-proteasome system in Alzheimer's disease. (2000) (332)
- Characterization of Two Polyubiquitin Binding Sites in the 26 S Protease Subunit 5a* (1998) (320)
- Molecular Insights into Polyubiquitin Chain Assembly Crystal Structure of the Mms2/Ubc13 Heterodimer (2001) (310)
- Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T. (1995) (288)
- Structural properties of polyubiquitin chains in solution. (2002) (270)
- The ubiquitin-proteasome pathway in Parkinson's disease and other neurodegenerative diseases. (2004) (269)
- In Vitro Assembly and Recognition of Lys-63 Polyubiquitin Chains* (2001) (259)
- Rad23 Ubiquitin-associated Domains (UBA) Inhibit 26 S Proteasome-catalyzed Proteolysis by Sequestering Lysine 48-linked Polyubiquitin Chains* (2003) (245)
- Surface hydrophobic residues of multiubiquitin chains essential for proteolytic targeting. (1996) (244)
- Distinct Functional Surface Regions on Ubiquitin* (2001) (241)
- Controlled synthesis of polyubiquitin chains. (2005) (239)
- Structural determinants for selective recognition of a Lys48-linked polyubiquitin chain by a UBA domain. (2005) (226)
- Inhibition of the 26 S Proteasome by Polyubiquitin Chains Synthesized to Have Defined Lengths* (1997) (218)
- Crystal Structure of the Human Ubiquitin-like Protein NEDD8 and Interactions with Ubiquitin Pathway Enzymes* (1998) (217)
- K63‐specific deubiquitination by two JAMM/MPN+ complexes: BRISC‐associated Brcc36 and proteasomal Poh1 (2009) (211)
- Determinants of proteasome recognition of ornithine decarboxylase, a ubiquitin‐independent substrate (2003) (204)
- A 25-kilodalton ubiquitin carrier protein (E2) catalyzes multi-ubiquitin chain synthesis via lysine 48 of ubiquitin. (1990) (198)
- Structure of a diubiquitin conjugate and a model for interaction with ubiquitin conjugating enzyme (E2). (1993) (188)
- Functional heterogeneity of ubiquitin carrier proteins. (1985) (183)
- A conserved catalytic residue in the ubiquitin‐conjugating enzyme family (2003) (181)
- Binding of polyubiquitin chains to ubiquitin-associated (UBA) domains of HHR23A. (2004) (168)
- Ubiquitin carboxyl-terminal hydrolase acts on ubiquitin carboxyl-terminal amides. (1985) (166)
- Crystal structure and solution NMR studies of Lys48-linked tetraubiquitin at neutral pH. (2007) (165)
- Structure of tetraubiquitin shows how multiubiquitin chains can be formed. (1994) (156)
- Structure and function of ubiquitin conjugating enzyme E2-25K: the tail is a core-dependent activity element. (1997) (141)
- Evidence for bidentate substrate binding as the basis for the K48 linkage specificity of otubain 1. (2009) (134)
- A HECT Domain E3 Enzyme Assembles Novel Polyubiquitin Chains* (2001) (131)
- The hydrophobic effect contributes to polyubiquitin chain recognition. (1998) (114)
- Specificity of the Ubiquitin Isopeptidase in the PA700 Regulatory Complex of 26 S Proteasomes* (1997) (111)
- An arsenite-inducible 19S regulatory particle-associated protein adapts proteasomes to proteotoxicity. (2006) (110)
- Energetics of the calcium-transporting ATPase. (1984) (109)
- Ubiquitin Lysine 63 Chain–Forming Ligases Regulate Apical Dominance in Arabidopsis[W][OA] (2007) (104)
- Yeast RAD6 encoded ubiquitin conjugating enzyme mediates protein degradation dependent on the N‐end‐recognizing E3 enzyme. (1991) (102)
- Molecular determinants of polyubiquitin linkage selection by an HECT ubiquitin ligase (2006) (89)
- Chlorpyrifos and chlorpyrifos-oxon inhibit axonal growth by interfering with the morphogenic activity of acetylcholinesterase. (2008) (89)
- Substrate properties of site-specific mutant ubiquitin protein (G76A) reveal unexpected mechanistic features of ubiquitin-activating enzyme (E1). (1994) (84)
- Mechanism of ubiquitin carboxyl-terminal hydrolase. Borohydride and hydroxylamine inactivate in the presence of ubiquitin. (1986) (83)
- E2/E3-mediated Assembly of Lysine 29-linked Polyubiquitin Chains* (1999) (80)
- Functional Dissection of a HECT Ubiquitin E3 Ligase*S (2008) (79)
- Structure of a new crystal form of tetraubiquitin. (2001) (77)
- Induction of ubiquitin-conjugating enzymes during terminal erythroid differentiation. (1995) (77)
- Mechanism of ubiquitin conjugating enzyme E2-230K: catalysis involving a thiol relay? (1996) (64)
- Isolation of a cDNA encoding a mammalian multiubiquitinating enzyme (E225K) and overexpression of the functional enzyme in Escherichia coli. (1991) (64)
- Arsenite inhibits two steps in the ubiquitin-dependent proteolytic pathway. (1989) (62)
- Levels of active ubiquitin carrier proteins decline during erythroid maturation. (1988) (55)
- Ubiquitin chain synthesis. (2005) (54)
- Construct for high-level expression and low misincorporation of lysine for arginine during expression of pET-encoded eukaryotic proteins in Escherichia coli. (1999) (53)
- Slow dissociation of ATP from the calcium ATPase. (1982) (47)
- A novel, arsenite-sensitive E2 of the ubiquitin pathway: purification and properties. (1989) (46)
- Opening doors into the proteasome (2000) (45)
- Synthesis of Free and Proliferating Cell Nuclear Antigen-bound Polyubiquitin Chains by the RING E3 Ubiquitin Ligase Rad5* (2009) (41)
- K 63-specific deubiquitination by two JAMM / MPN þ complexes : BRISC-associated Brcc 36 and proteasomal Poh 1 (2009) (36)
- Ubiquitin Binding Site of the Ubiquitin E2 Variant (UEV) Protein Mms2 Is Required for DNA Damage Tolerance in the Yeast RAD6 Pathway* (2005) (35)
- Functional heterogeneity of ubiquitin carrier proteins. (1985) (34)
- Inhibition of ubiquitin-protein ligase (E3) by mono- and bifunctional phenylarsenoxides. Evidence for essential vicinal thiols and a proximal nucleophile. (1992) (33)
- Binding of phenylarsenoxide to Arg-tRNA protein transferase is independent of vicinal thiols. (1995) (33)
- Ubiquitin carrier protein-catalyzed ubiquitin transfer to histones. Mechanism and specificity. (1988) (33)
- E2-25K mediates US11-triggered retro-translocation of MHC class I heavy chains in a permeabilized cell system. (2006) (32)
- Chemical and genetic strategies for manipulating polyubiquitin chain structure. (2005) (31)
- Proteolytic Targeting of Transcriptional Regulator TIP120B by a HECT Domain E3 Ligase* (2003) (26)
- Iodination of tyrosine 59 of ubiquitin selectively blocks ubiquitin's acceptor activity in diubiquitin synthesis catalyzed by E2(25K). (1992) (24)
- Beginning at the end with SUMO (2005) (22)
- Dihydroorotate dehydrogenase from Clostridium oroticum is a class 1B enzyme and utilizes a concerted mechanism of catalysis. (2000) (21)
- DNA repair: Right on target with ubiquitin (2002) (21)
- Ubiquitin biology: an old dog learns an old trick (2000) (20)
- Formation of stable anhydrides from CoA transferase and hydroxamic acids. (1979) (17)
- Inactivation of arginyl-tRNA protein transferase by a bifunctional arsenoxide: identification of residues proximal to the arsenoxide site. (1995) (16)
- Ubiquitin Activation and Ligation (1988) (16)
- Core domain mutation (S86Y) selectively inactivates polyubiquitin chain synthesis catalyzed by E2-25K. (1998) (14)
- Ubiquitin and the Stress Response (1999) (11)
- Murine erythroleukemia cells possess an active ubiquitin- and ATP-dependent proteolytic pathway. (1989) (10)
- Identification of protein ubiquitylation by electrospray ionization tandem mass spectrometric analysis of sulfonated tryptic peptides. (2006) (9)
- A reactive nucleophile proximal to vicinal thiols is an evolutionarily conserved feature in the mechanism of Arg aminoacyl-tRNA protein transferase. (1992) (9)
- Characterization of a cDNA clone encoding E2-20K, a murine ubiquitin-conjugating enzyme. (1995) (6)
- Ubiquitin‐conjugating Enzymes (2008) (5)
- Varshavsky's Contributions (2004) (4)
- Several mammalian ubiquitin carrier proteins, but not E2(20K), are related to the 20-kDa yeast E2, RAD6. (1990) (4)
- Erratum: A conserved catalytic residue in the ubiquitin-conjugating enzyme family (EMBO Journal (2003) 22 (5241-5250) doi: 10.1093/emboj/cdg501) (2004) (4)
- Corrigendum: The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses (2005) (2)
- Ubiquitin Conjugating Enzyme, Ubc13 (2001) (1)
- NMR BASED MODEL OF LYS48-LINKED DI-UBIQUITIN COMPLEX WITH C-TERMINAL UBA DOMAIN OF hHR23A (2005) (0)
- Mms2/Ubc13~Ubiquitin (2006) (0)
- ReviewBack to the Future with Ubiquitin be eliminated for purposes of regulation or quality con - (2004) (0)
- Erratum: A conserved catalytic residue in the ubiquitin-conjugating enzyme family (EMBO Journal (2004) 23, (4876) DOI: 10.1038/sj.emboj.7600513) (2007) (0)
- GATAAGACTTTTGAAATCAGTGCTAGCGATGCGAAGAAGAAACAGGAGTGGATT CAA-3 (2002) (0)
- STRUCTURE OF NEDD8 (1999) (0)
- Mms2/Ubc13 Ubiquitin Conjugating Enzyme Complex (2001) (0)
- The acyl-phosphate intermediate of the sarcoplasmic reticulum calcium ATPase reaction , formed in a brief incubation of vesicular enzyme (2001) (0)
- Eleven Thematic Meetings within the National Meeting Every Day (2003) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Cecile M. Pickart?
Cecile M. Pickart is affiliated with the following schools: