Chris Sander | Academic Influence

Chris Sander 's AcademicInfluence.com Rankings

Chris Sander

Biology

#959

World Rank

#1669

Historical Rank

#510

USA Rank

Computational Biology

#11

World Rank

#11

Historical Rank

#7

USA Rank

Bioinformatics

#11

World Rank

#11

Historical Rank

#4

USA Rank

biology Degrees

Download Badge

Biology

Chris Sander 's Degrees

PhD Bioinformatics Stanford University

Why Is Chris Sander Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Chris Sander is a computational biologist based at the Dana-Farber Cancer Center and Harvard Medical School. Previously he was chair of the Computational Biology Programme at the Memorial Sloan–Kettering Cancer Center in New York City. In 2015, he moved his lab to the Dana–Farber Cancer Institute and the Cell Biology Department at Harvard Medical School.

(See a Problem?)

Chris Sander 's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. (2012) (11320)
Integrative Analysis of Complex Cancer Genomics and Clinical Profiles Using the cBioPortal (2013) (10583)
Comprehensive molecular portraits of human breast tumors (2012) (7791)
Integrated Genomic Analyses of Ovarian Carcinoma (2011) (6411)
Comprehensive molecular characterization of human colon and rectal cancer (2012) (6141)
Comprehensive genomic characterization defines human glioblastoma genes and core pathways (2008) (5775)
Mutational landscape determines sensitivity to PD-1 blockade in non–small cell lung cancer (2015) (5602)
The Cancer Genome Atlas Pan-Cancer analysis project (2013) (5479)
Comprehensive molecular characterization of gastric adenocarcinoma (2014) (4496)
Protein structure comparison by alignment of distance matrices. (1993) (3983)
Integrated genomic characterization of endometrial carcinoma (2013) (3708)
The Somatic Genomic Landscape of Glioblastoma (2013) (3693)
Human MicroRNA Targets (2004) (3683)
A Mammalian microRNA Expression Atlas Based on Small RNA Library Sequencing (2007) (3657)
Integrative genomic profiling of human prostate cancer. (2010) (3312)
Comprehensive genomic characterization of squamous cell lung cancers (2012) (2998)
Prediction of protein secondary structure at better than 70% accuracy. (1993) (2983)
Comprehensive genomic characterization of head and neck squamous cell carcinomas (2015) (2860)
The Immune Landscape of Cancer (2018) (2766)
MicroRNA targets in Drosophila (2003) (2606)
The microRNA.org resource: targets and expression (2007) (2452)
Integration of biological networks and gene expression data using Cytoscape (2007) (2342)
Comprehensive, Integrative Genomic Analysis of Diffuse Lower-Grade Gliomas. (2015) (2211)
Genomic Classification of Cutaneous Melanoma (2015) (2143)
The Molecular Taxonomy of Primary Prostate Cancer (2015) (2116)
Global Mapping of the Yeast Genetic Interaction Network (2004) (2113)
Errors in protein structures (1996) (2085)
Integrated Genomic Characterization of Papillary Thyroid Carcinoma (2014) (2007)
International network of cancer genome projects (2010) (1839)
Comprehensive molecular characterization of urothelial bladder carcinoma (2014) (1748)
Database of homology‐derived protein structures and the structural meaning of sequence alignment (1991) (1650)
Oncogenic Signaling Pathways in The Cancer Genome Atlas (2018) (1646)
Predicting the functional impact of protein mutations: application to cancer genomics (2011) (1644)
Identification of Virus-Encoded MicroRNAs (2004) (1628)
Comprehensive and Integrative Genomic Characterization of Hepatocellular Carcinoma (2017) (1514)
Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites (2010) (1495)
Combining evolutionary information and neural networks to predict protein secondary structure (1994) (1479)
Dali: a network tool for protein structure comparison. (1995) (1436)
A novel class of small RNAs bind to MILI protein in mouse testes (2006) (1393)
Comprehensive Characterization of Cancer Driver Genes and Mutations (2018) (1360)
Comprehensive Molecular Portraits of Invasive Lobular Breast Cancer (2015) (1332)
Identification of microRNAs of the herpesvirus family (2005) (1229)
Emerging landscape of oncogenic signatures across human cancers (2013) (1162)
Direct-coupling analysis of residue coevolution captures native contacts across many protein families (2011) (1155)
Evaluating cell lines as tumour models by comparison of genomic profiles (2013) (1114)
Integrated Genomic Characterization of Pancreatic Ductal Adenocarcinoma. (2017) (1092)
Pathway Commons, a web resource for biological pathway data (2010) (1051)
Protein 3D Structure Computed from Evolutionary Sequence Variation (2011) (1010)
Precision microbiome restoration of bile acid-mediated resistance to Clostridium difficile (2014) (976)
The Systems Biology Graphical Notation (2009) (894)
A series of PDB related databases for everyday needs (2010) (877)
An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp70 heat shock proteins. (1992) (823)
Selection of representative protein data sets (1992) (792)
miR-122, a Mammalian Liver-Specific microRNA, is Processed from hcr mRNA and MayDownregulate the High Affinity Cationic Amino Acid Transporter CAT-1 (2004) (766)
Integrated genomic and molecular characterization of cervical cancer (2017) (762)
The immunoglobulin fold. Structural classification, sequence patterns and common core. (1994) (735)
The double cubic lattice method: Efficient approaches to numerical integration of surface area and volume and to dot surface contouring of molecular assemblies (1995) (727)
Touring protein fold space with Dali/FSSP (1998) (714)
Genome Sequencing Identifies a Basis for Everolimus Sensitivity (2012) (674)
The HUPO PSI's Molecular Interaction format—a community standard for the representation of protein interaction data (2004) (672)
Genomic and transcriptomic hallmarks of poorly differentiated and anaplastic thyroid cancers. (2016) (666)
Protein normal-mode dynamics: trypsin inhibitor, crambin, ribonuclease and lysozyme. (1985) (660)
Subtype-specific genomic alterations define new targets for soft tissue sarcoma therapy (2010) (653)
Transmembrane helices predicted at 95% accuracy (1995) (652)
The nuclear deubiquitinase BAP1 is commonly inactivated by somatic mutations and 3p21.1 losses in malignant pleural mesothelioma (2011) (611)
PHD - an automatic mail server for protein secondary structure prediction (1994) (608)
Mutual exclusivity analysis identifies oncogenic network modules. (2012) (604)
BioPAX – A community standard for pathway data sharing (2010) (594)
Protein structure prediction from sequence variation (2012) (582)
Cellular cofactors affecting hepatitis C virus infection and replication (2007) (579)
Comprehensive and Integrated Genomic Characterization of Adult Soft Tissue Sarcomas (2017) (577)
The ras protein family: evolutionary tree and role of conserved amino acids. (1991) (551)
PredictProtein—an open resource for online prediction of protein structural and functional features (2014) (551)
V600EBRAF is associated with disabled feedback inhibition of RAF–MEK signaling and elevated transcriptional output of the pathway (2009) (545)
Improved prediction of protein secondary structure by use of sequence profiles and neural networks. (1993) (531)
Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs (2009) (509)
Quantitative technologies establish a novel microRNA profile of chronic lymphocytic leukemia. (2007) (507)
Three-Dimensional Structures of Membrane Proteins from Genomic Sequencing (2012) (504)
Characterizing gene sets with FuncAssociate (2003) (503)
Pathogenic Germline Variants in 10,389 Adult Cancers (2018) (501)
A Role for Neuronal piRNAs in the Epigenetic Control of Memory-Related Synaptic Plasticity (2012) (498)
Cooperativity of TMPRSS2-ERG with PI3-kinase pathway activation in prostate oncogenesis (2009) (481)
Genetic dissection of the miR-17~92 cluster of microRNAs in Myc-induced B-cell lymphomas. (2009) (477)
Comprehensive Analysis of Alternative Splicing Across Tumors from 8,705 Patients (2018) (471)
MicroRNA profiling of the murine hematopoietic system (2005) (471)
Ecological Modeling from Time-Series Inference: Insight into Dynamics and Stability of Intestinal Microbiota (2013) (470)
A Specificity Map for the PDZ Domain Family (2008) (461)
An Integrated Metabolic Atlas of Clear Cell Renal Cell Carcinoma. (2016) (459)
Genome-wide analysis of non-coding regulatory mutations in cancer (2014) (459)
Pathguide: a Pathway Resource List (2005) (451)
NetPath: a public resource of curated signal transduction pathways (2010) (449)
MicroRNA Targets in Drosophila (2003) (439)
Dali/FSSP classification of three-dimensional protein folds (1997) (433)
Tumor immune microenvironment characterization in clear cell renal cell carcinoma identifies prognostic and immunotherapeutically relevant messenger RNA signatures (2016) (433)
Sequence co-evolution gives 3D contacts and structures of protein complexes (2014) (431)
A method to predict functional residues in proteins (1995) (414)
Characterization of Small RNAs in Aplysia Reveals a Role for miR-124 in Constraining Synaptic Plasticity through CREB (2009) (379)
The Mutational Landscape of Adenoid Cystic Carcinoma (2013) (370)
Redefining the goals of protein secondary structure prediction. (1994) (363)
Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles (2017) (361)
The FSSP database of structurally aligned protein fold families. (1994) (361)
Completeness in structural genomics (2001) (356)
On the use of sequence homologies to predict protein structure: identical pentapeptides can have completely different conformations. (1984) (355)
Mutation effects predicted from sequence co-variation (2017) (350)
The developmental miRNA profiles of zebrafish as determined by small RNA cloning. (2005) (343)
Target mRNA abundance dilutes microRNA and siRNA activity (2010) (341)
Somatic mutations of the Parkinson's disease–associated gene PARK2 in glioblastoma and other human malignancies (2010) (338)
MView: a web-compatible database search or multiple alignment viewer (1998) (337)
The reactome pathway knowledgebase 2022 (2021) (335)
A yeast gene encoding a protein homologous to the human c-has/bas proto-oncogene product (1983) (335)
Pattern discovery and cancer gene identification in integrated cancer genomic data (2013) (335)
Automated Network Analysis Identifies Core Pathways in Glioblastoma (2010) (335)
Antisense-Mediated Depletion Reveals Essential and Specific Functions of MicroRNAs in Drosophila Development (2005) (330)
Database algorithm for generating protein backbone and side-chain co-ordinates from a C alpha trace application to model building and detection of co-ordinate errors. (1991) (328)
Mitochondrial DNA copy number variation across human cancers (2015) (323)
RNA targets of wild-type and mutant FET family proteins (2011) (319)
Quality control of protein models : directional atomic contact analysis (1993) (309)
Removing near-neighbour redundancy from large protein sequence collections (1998) (296)
Copy number alteration burden predicts prostate cancer relapse (2014) (295)
Adverse Outcomes in Clear Cell Renal Cell Carcinoma with Mutations of 3p21 Epigenetic Regulators BAP1 and SETD2: A Report by MSKCC and the KIRC TCGA Research Network (2013) (294)
Protein fold recognition by prediction-based threading. (1997) (291)
Determinants of protein function revealed by combinatorial entropy optimization (2007) (288)
Pathway and network analysis of cancer genomes (2015) (285)
Multilevel Genomics-Based Taxonomy of Renal Cell Carcinoma. (2016) (284)
A large domain common to sperm receptors (Zp2 and Zp3) and TGF‐β type III receptor (1992) (283)
Can three-dimensional contacts in protein structures be predicted by analysis of correlated mutations? (1994) (281)
The FSSP database: fold classification based on structure-structure alignment of proteins (1996) (274)
Human SRMAtlas: A Resource of Targeted Assays to Quantify the Complete Human Proteome (2016) (264)
An effective solvation term based on atomic occupancies for use in protein simulations (1993) (263)
Prevalence and co-occurrence of actionable genomic alterations in high-grade bladder cancer. (2013) (263)
The tyrosine phosphatase PTPRD is a tumor suppressor that is frequently inactivated and mutated in glioblastoma and other human cancers (2009) (257)
DNA polymerase β belongs to an ancient nucleotidyltransferase superfamily (1995) (246)
Erratum to: Tumor immune microenvironment characterization in clear cell renal cell carcinoma identifies prognostic and immunotherapeutically relevant messenger RNA signatures (2016) (241)
Quantification of the effect of mutations using a global probability model of natural sequence variation (2015) (238)
Exonuclease mutations in DNA polymerase epsilon reveal replication strand specific mutation patterns and human origins of replication (2014) (237)
DGCR8-dependent microRNA biogenesis is essential for skin development (2009) (231)
Objectively judging the quality of a protein structure from a Ramachandran plot (1997) (230)
An integrated genomic analysis of lung cancer reveals loss of DUSP4 in EGFR-mutant tumors (2009) (223)
Dipoles of the α-helix and β-sheet: their role in protein folding (1981) (223)
Analyses of non-coding somatic drivers in 2,658 cancer whole genomes (2020) (220)
Automated genome sequence analysis and annotation (1999) (219)
Gene expression profiling of liposarcoma identifies distinct biological types/subtypes and potential therapeutic targets in well-differentiated and dedifferentiated liposarcoma. (2007) (210)
The HSSP database of protein structure-sequence alignments and family profiles (1998) (210)
An epidemiologic and genomic investigation into the obesity paradox in renal cell carcinoma. (2013) (209)
Integrative Subtype Discovery in Glioblastoma Using iCluster (2012) (208)
Protein folds and families: sequence and structure alignments (1999) (199)
Tumor Genetic Analyses of Patients with Metastatic Renal Cell Carcinoma and Extended Benefit from mTOR Inhibitor Therapy (2014) (198)
Models from experiments: combinatorial drug perturbations of cancer cells (2008) (197)
Correlated Mutations and Residue Contacts (1994) (196)
The amino-acid mutational spectrum of human genetic disease (2003) (194)
Analysis of microRNA-target interactions across diverse cancer types (2013) (193)
Molecular cloning of YPT1/SEC4-related cDNAs from an epithelial cell line (1990) (192)
Evaluation of protein models by atomic solvation preference. (1992) (190)
CancerGenes: a gene selection resource for cancer genome projects (2006) (188)
Pan-Cancer Analysis of lncRNA Regulation Supports Their Targeting of Cancer Genes in Each Tumor Context (2018) (188)
Distinct patterns of dysregulated expression of enzymes involved in androgen synthesis and metabolism in metastatic prostate cancer tumors. (2012) (187)
A sequence property approach to searching protein databases. (1995) (183)
Predicting protein structure using hidden Markov models (1997) (182)
Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. (2011) (182)
FcγR-mediated SARS-CoV-2 infection of monocytes activates inflammation (2022) (180)
Molecular modelling of the Norrie disease protein predicts a cystine knot growth factor tertiary structure (1993) (179)
Antiparallel and parallel β-strands differ in amino acid residue preferences (1979) (179)
The HSSP database of protein structure-sequence alignments (1993) (177)
CAST: an iterative algorithm for the complexity analysis of sequence tracts (2000) (171)
Functional Copy-Number Alterations in Cancer (2008) (170)
Sequencing of prostate cancers identifies new cancer genes, routes of progression and drug targets (2018) (169)
Pathway Commons 2019 Update: integration, analysis and exploration of pathway data (2019) (161)
Computational approaches to identify functional genetic variants in cancer genomes (2013) (161)
Signal Processing in the TGF-β Superfamily Ligand-Receptor Network (2005) (160)
3D clusters of somatic mutations in cancer reveal numerous rare mutations as functional targets (2017) (159)
Identification of PHLPP1 as a tumor suppressor reveals the role of feedback activation in PTEN-mutant prostate cancer progression. (2011) (156)
The use of position‐specific rotamers in model building by homology (1995) (156)
Systematic identification of cancer driving signaling pathways based on mutual exclusivity of genomic alterations (2014) (153)
Bridging the protein sequence-structure gap by structure predictions. (1996) (152)
Applications of targeted proteomics in systems biology and translational medicine (2015) (147)
The PDBFINDER database: a summary of PDB, DSSP and HSSP information with added value (1996) (143)
A common step for signal transduction in G protein-coupled receptors. (1994) (141)
Prediction of protein structure by evaluation of sequence-structure fitness. Aligning sequences to contact profiles derived from three-dimensional structures. (1993) (139)
Protein design and variant prediction using autoregressive generative models (2019) (139)
Correlation between the structure and biochemical activities of FtsA, an essential cell division protein of the actin family. (1994) (139)
Pathway information for systems biology (2005) (138)
3D RNA and Functional Interactions from Evolutionary Couplings (2015) (137)
SQSTM1 is a pathogenic target of 5q copy number gains in kidney cancer. (2013) (137)
cPath: open source software for collecting, storing, and querying biological pathways (2006) (135)
The Somatic Genomic Landscape of Glioblastoma (2014) (135)
Prediction of human microRNA targets. (2006) (133)
The EVcouplings Python framework for coevolutionary sequence analysis (2018) (130)
The ten helical twist angles of B-DNA. (1982) (128)
Perturbation Biology: Inferring Signaling Networks in Cellular Systems (2013) (127)
Learning Protein Structure with a Differentiable Simulator (2018) (125)
Structured States of Disordered Proteins from Genomic Sequences (2016) (123)
Corrigendum: Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs (2009) (123)
miR-34a Repression in Proneural Malignant Gliomas Upregulates Expression of Its Target PDGFRA and Promotes Tumorigenesis (2012) (121)
18F-fluorodeoxy-glucose positron emission tomography marks MYC-overexpressing human basal-like breast cancers. (2011) (120)
Superoxide dismutase 1 (SOD1) is a target for a small molecule identified in a screen for inhibitors of the growth of lung adenocarcinoma cell lines (2011) (119)
A large domain common to sperm receptors (Zp2 and Zp3) and TGF-beta type III receptor. (1992) (118)
The chaperone function of DnaK requires the coupling of ATPase activity with substrate binding through residue E171. (1994) (117)
Corrigendum: The BioPAX community standard for pathway data sharing (2010) (114)
The molecular diversity of Luminal A breast tumors (2013) (114)
A novel RNA-binding motif in omnipotent suppressors of translation termination, ribosomal proteins and a ribosome modification enzyme? (1994) (114)
Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma. (2011) (113)
Integrated Analyses of microRNAs Demonstrate Their Widespread Influence on Gene Expression in High-Grade Serous Ovarian Carcinoma (2012) (110)
Genomic complexity and AKT dependence in serous ovarian cancer. (2012) (110)
PconsFold: improved contact predictions improve protein models (2014) (109)
Who checks the checkers? Four validation tools applied to eight atomic resolution structures. EU 3-D Validation Network. (1998) (107)
TCEB1-mutated Renal Cell Carcinoma: A Distinct Genomic and Morphologic Subtype (2014) (107)
Time to Recurrence and Survival in Serous Ovarian Tumors Predicted from Integrated Genomic Profiles (2011) (104)
Frequent alterations and epigenetic silencing of differentiation pathway genes in structurally rearranged liposarcomas. (2011) (103)
GeneQuiz: A Workbench for Sequence Analysis (1994) (103)
mRNA turnover rate limits siRNA and microRNA efficacy (2010) (103)
Polarity as a criterion in protein design. (1989) (102)
Network modeling of the transcriptional effects of copy number aberrations in glioblastoma (2011) (100)
Progress of 1D protein structure prediction at last (1995) (99)
Challenging times for bioinformatics (1995) (98)
Third generation prediction of secondary structures. (2000) (98)
Yeast chromosome III: new gene functions. (1994) (98)
Correction: Human MicroRNA Targets (2005) (97)
A Landscape of Metabolic Variation across Tumor Types. (2018) (97)
Inferring Pairwise Interactions from Biological Data Using Maximum-Entropy Probability Models (2015) (97)
Modeling of transmembrane seven helix bundles. (1993) (97)
Integrative pathway enrichment analysis of multivariate omics data (2018) (96)
Introducing meta-services for biomedical information extraction (2008) (96)
Inferring protein 3D structure from deep mutation scans (2019) (95)
Immunization with synthetic peptides of a Plasmodium falciparum surface antigen induces antimerozoite antibodies. (1986) (95)
CellMinerCDB for Integrative Cross-Database Genomics and Pharmacogenomics Analyses of Cancer Cell Lines (2018) (94)
Perturbation biology nominates upstream–downstream drug combinations in RAF inhibitor resistant melanoma cells (2015) (93)
Verification of protein structures : Side-chain planarity (1996) (92)
Machine Learning Detects Pan-cancer Ras Pathway Activation in The Cancer Genome Atlas (2018) (92)
Computational Analysis of Mouse piRNA Sequence and Biogenesis (2007) (91)
Off-target effects dominate a large-scale RNAi screen for modulators of the TGF-β pathway and reveal microRNA regulation of TGFBR2 (2011) (90)
The cytidylyltransferase superfamily: Identification of the nucleotide‐binding site and fold prediction (1995) (90)
Somatic POLE mutations cause an ultramutated giant cell high-grade glioma subtype with better prognosis. (2015) (90)
The prediction of protein contacts from multiple sequence alignments. (1996) (89)
Erratum: Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles (Cell Reports (2017) 18(11) (2780–2794) (S2211124717302140) (10.1016/j.celrep.2017.02.033)) (2017) (88)
Amino acid analysis and protein database compositional search as a rapid and inexpensive method to identify proteins. (1994) (86)
Evaluation of annotation strategies using an entire genome sequence (2003) (86)
Mitochondrial respiratory gene expression is suppressed in many cancers (2016) (85)
PredictProtein - Predicting Protein Structure and Function for 29 Years (2021) (85)
A module of the DnaJ heat shock proteins found in malaria parasites. (1992) (84)
DNA polymerase beta belongs to an ancient nucleotidyltransferase superfamily. (1995) (84)
Alignment of three-dimensional protein structures: network server for database searching. (1996) (83)
LLGL2 rescues nutrient stress by promoting leucine uptake in ER+ breast cancer (2019) (82)
MYC Cooperates with AKT in Prostate Tumorigenesis and Alters Sensitivity to mTOR Inhibitors (2011) (82)
Drug Synergy Screen and Network Modeling in Dedifferentiated Liposarcoma Identifies CDK4 and IGF1R as Synergistic Drug Targets (2013) (81)
3-D Lookup: Fast Protein Structure Database Searches at 90% Reliability (1995) (81)
Protein structure determination by combining sparse NMR data with evolutionary couplings (2015) (81)
Pan-Cancer Analysis of Mutation Hotspots in Protein Domains. (2015) (81)
Cancer LncRNA Census reveals evidence for deep functional conservation of long noncoding RNAs in tumorigenesis (2020) (80)
A new ATP-binding fold in actin, hexokinase and Hsc70. (1993) (78)
Jury returns on structure prediction (1992) (78)
Predicting cancer involvement of genes from heterogeneous data (2008) (76)
Bioinformatics: from genome data to biological knowledge. (1997) (76)
The role of heat-shock and chaperone proteins in protein folding: possible molecular mechanisms. (1991) (75)
Comprehensive Analysis of Long Non-Coding RNAs in Ovarian Cancer Reveals Global Patterns and Targeted DNA Amplification (2013) (75)
New triple-helical model for the shaft of the adenovirus fibre. (1992) (74)
EUCLID: automatic classification of proteins in functional classes by their database annotations (1998) (73)
Secondary structure prediction of all-helical proteins in two states. (1993) (72)
TFIIB, an evolutionary link between the transcription machineries of archaebacteria and eukaryotes (1992) (71)
MLH1‐silenced and non‐silenced subgroups of hypermutated colorectal carcinomas have distinct mutational landscapes (2013) (69)
From Bytes to Bedside: Data Integration and Computational Biology for Translational Cancer Research (2007) (68)
Molecular cloning and structural analysis of genes from Zea mays (L.) coding for members of the ras-related ypt gene family. (1992) (65)
Excluded volume approximation to protein-solvent interaction. The solvent contact model. (1990) (65)
Using Biological Pathway Data with Paxtools (2013) (65)
Classification of protein families and detection of the determinant residues with an improved self-organizing map (1997) (64)
Predicting local structural changes that result from point mutations. (1994) (63)
Genome sequences and great expectations (2000) (62)
From genome sequences to protein function (1994) (62)
Progress in protein structure prediction? (1993) (61)
SARS-CoV-2 infects blood monocytes to activate NLRP3 and AIM2 inflammasomes, pyroptosis and cytokine release (2021) (61)
Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles. (2017) (61)
GTPase domains of ras p21 oncogene protein and elongation factor Tu: analysis of three-dimensional structures, sequence families, and functional sites. (1991) (61)
CellMiner Cross-Database (CellMinerCDB) version 1.2: Exploration of patient-derived cancer cell line pharmacogenomics (2020) (60)
Evolutionary link between glycogen phosphorylase and a DNA modifying enzyme. (1995) (58)
How to determine protein secondary structure in solution by Raman spectroscopy: practical guide and test case DNase I (1989) (56)
Computer-guided design of optimal microbial consortia for immune system modulation (2018) (56)
New structure--novel fold? (1997) (55)
All-atom 3D structure prediction of transmembrane β-barrel proteins from sequences (2015) (54)
Matrix Metalloproteinase-9 (MMP-9) polymorphisms in patients with cutaneous malignant melanoma (2007) (53)
The nuclear deubiquitinase BAP 1 is commonly inactivated by somatic mutations and 3 p 21 . 1 losses in malignant pleural mesothelioma (2015) (52)
Analysis of renal cancer cell lines from two major resources enables genomics-guided cell line selection (2017) (51)
Integrin-α10 Dependency Identifies RAC and RICTOR as Therapeutic Targets in High-Grade Myxofibrosarcoma. (2016) (51)
Bioinformatics and the discovery of gene function. (1996) (51)
CellBox: Interpretable Machine Learning for Perturbation Biology with Application to the Design of Cancer Combination Therapy. (2020) (51)
Alterations of DNA repair genes in the NCI-60 cell lines and their predictive value for anticancer drug activity. (2015) (51)
BioPAX - Biological Pathways Exchange Language Level 2, Version 1.0 Documentation (2005) (50)
Diabetes, Weight Change, and Pancreatic Cancer Risk. (2020) (50)
Erratum: The somatic genomic landscape of glioblastoma (Cell (2013) 155 (462-477)) (2014) (49)
The GeneQuiz web server: protein functional analysis through the Web. (2000) (49)
ChiBE: interactive visualization and manipulation of BioPAX pathway models (2010) (49)
Globin fold in a bacterial toxin (1993) (48)
The interaction of class B G protein-coupled receptors with their hormones. (1998) (48)
Antiparallel and parallel beta-strands differ in amino acid residue preferences. (1979) (48)
Cell-selective labeling with amino acid precursors for proteomic studies of multicellular environments (2013) (47)
Novel protein families in archaean genomes. (1995) (47)
Causal interactions from proteomic profiles: Molecular data meet pathway knowledge (2018) (47)
Discovery and characterization of coding and non-coding driver mutations in more than 2,500 whole cancer genomes (2017) (46)
A comparison of structural and dynamic properties of different simulation methods applied to SH3. (1996) (44)
Decision Support System for the Evolutionary Classification of Protein Structures (1997) (44)
Report on EU–USA Workshop: How Systems Biology Can Advance Cancer Research (27 October 2008) (2009) (43)
What's in a genome? (1992) (42)
The structure of ColE1 rop in solution (1991) (42)
ZIC1 overexpression is oncogenic in liposarcoma. (2010) (42)
Quantitative Proteome Landscape of the NCI-60 Cancer Cell Lines (2019) (41)
Databases of homology-derived protein structures (1990) (41)
The BioPAX community standard for pathway data sharing (Nature Biotechnology (2010) 28, (935-942)) (2012) (41)
Conservation of residue interactions in a family of Ca-binding proteins. (1989) (40)
LexA repressor and iron uptake regulator from Escherichia coli: new members of the CAP-like DNA binding domain superfamily. (1994) (39)
Exopolyphosphate phosphatase and guanosine pentaphosphate phosphatase belong to the sugar kinase/actin/hsp 70 superfamily. (1993) (39)
Cancer-associated mutations in DICER1 RNase IIIa and IIIb domains exert similar effects on miRNA biogenesis (2019) (37)
Are binding residues conserved? (1998) (37)
Functional Classes in the Three Domains of Life (1999) (37)
Accelerating Protein Design Using Autoregressive Generative Models (2019) (37)
rcellminer: exploring molecular profiles and drug response of the NCI-60 cell lines in R (2016) (36)
Proceedings of the 5th International Conference on Intelligent Systems for Molecular Biology (1996) (36)
The HSSP data base of protein structure-sequence alignments (1993) (36)
SARS-CoV-2 infects blood monocytes to activate NLRP3 and AIM2 inflammasomes, pyroptosis and cytokine release (2021) (35)
Three sisters, different names (1994) (35)
The HSSP database of protein structure-sequence alignments. (1994) (34)
Structure prediction of proteins--where are we now? (1994) (34)
A human cDNA coding for the Leydig insulin-like peptide (Ley I-L) (1994) (33)
EVfold.org: Evolutionary Couplings and Protein 3D Structure Prediction (2015) (33)
Computational comparisons of model genomes. (1996) (33)
Frequent disruption of the RB pathway in indolent follicular lymphoma suggests a new combination therapy (2014) (33)
Prediction of individualized therapeutic vulnerabilities in cancer from genomic profiles (2014) (32)
Discovering modulators of gene expression (2010) (31)
Integrating biological pathways and genomic profiles with ChiBE 2 (2014) (31)
A Multi-Method Approach for Proteomic Network Inference in 11 Human Cancers (2015) (31)
Combined burden and functional impact tests for cancer driver discovery using DriverPower (2020) (31)
The modular structure of NifU proteins. (1994) (30)
Using MEMo to Discover Mutual Exclusivity Modules in Cancer (2013) (30)
Artificial Intelligence and Early Detection of Pancreatic Cancer: 2020 Summative Review. (2021) (29)
Extensive Decoupling of Metabolic Genes in Cancer (2014) (29)
Identifying Actionable Targets through Integrative Analyses of GEM Model and Human Prostate Cancer Genomic Profiling (2014) (28)
Abnormal oxidative metabolism in a quiet genomic background underlies clear cell papillary renal cell carcinoma (2019) (27)
Specific recognition in the tertiary structure of beta-sheets of proteins. (1980) (27)
Graph Curvature and the Robustness of Cancer Networks (2015) (27)
A novel search method for protein sequence--structure relations using property profiles. (1994) (26)
Collection, integration and analysis of cancer genomic profiles: from data to insight. (2014) (25)
Sequence analysis of the Methanococcus jannaschii genome and the prediction of protein function (1997) (25)
Ricci Curvature and Robustness of Cancer Networks (2015) (25)
Degeneracy of the information contained in amino acid sequences: Evidence from overlaid genes (1979) (25)
Spatial Normalization of Reverse Phase Protein Array Data (2014) (24)
Nucleotide sequence and analysis of the centromeric region of yeast chromosome IX (1995) (24)
COVID19 Disease Map, a computational knowledge repository of virus–host interaction mechanisms (2021) (24)
Dipoles of the alpha-helix and beta-sheet: their role in protein folding. (1981) (24)
PaxtoolsR: pathway analysis in R using Pathway Commons (2015) (23)
Genequiz II: Automatic Function Assignment For Genome Sequence Analysis (1996) (23)
Protein design on computers. Five new proteins: Shpilka, grendel, fingerclasp, leather, and aida (1992) (23)
Four-helix bundle topology re-engineered: monomeric Rop protein variants with different loop arrangements. (2001) (22)
Disulfiram use is associated with lower risk of COVID-19: A retrospective cohort study (2021) (22)
Genetic Variation in DNA Repair Pathways and Risk of Non-Hodgkin's Lymphoma (2014) (22)
The Journal Bioinformatics, key medium for computational biology (2002) (22)
Frame: detection of genomic sequencing errors (1998) (22)
CTD2 Dashboard: a searchable web interface to connect validated results from the Cancer Target Discovery and Development Network (2017) (22)
Pattern search in BioPAX models (2013) (21)
MatchMiner: An open source computational platform for real-time matching of cancer patients to precision medicine clinical trials using genomic and clinical criteria (2017) (21)
Erratum: The Systems Biology Graphical Notation (2009) (20)
Prokaryotic members of a new family of putative helicases with similarity to transcription activator SNF2. (1993) (20)
Proton nuclear magnetic resonance assignments and secondary structure determination of the ColE1 rop (rom) protein. (1990) (20)
De novo design of proteins (1991) (18)
Identical pentapeptides with different backbones (1985) (18)
Systematic Assessment of Tumor Purity and Its Clinical Implications (2020) (17)
MutationAligner: a resource of recurrent mutation hotspots in protein domains in cancer (2015) (17)
Investigating the structural determinants of the p21-like triphosphate and Mg2+ binding site. (1995) (16)
The landscape of T cell infiltration in human cancer and its association with antigen presenting gene expression (2015) (15)
Identification of Guanine-Nucleotide Binding Proteins in Plants: Structural Analysis and Evolutionary Comparison of the Ras-Related Ypt-Gene Family from Zea Mays (1989) (15)
Protein structure prediction assisted with sparse NMR data in CASP13 (2019) (15)
Protein Structure from Experimental Evolution. (2019) (15)
Design of protein structures: helix bundles and beyond. (1994) (14)
Abstract 5277: The cBioPortal for cancer genomics and its application in precision oncology (2016) (14)
Evolution and Neural Networks - Protein Secondary Structure Prediction Above 71% Accuracy (1994) (14)
Detection of Activity Centers in Cellular Pathways Using Transcript Profiling (2004) (14)
PiHelper: an open source framework for drug-target and antibody-target data (2013) (13)
Systems pharmacology using mass spectrometry identifies critical response nodes in prostate cancer (2018) (12)
Reconstruction of Symmetry-Related Molecules from Protein Data Bank (PDB) Files (1994) (12)
Principle of system balance for drug interactions. (2010) (12)
Transforming Big Data into Cancer-Relevant Insight: An Initial, Multi-Tier Approach to Assess Reproducibility and Relevance (2016) (12)
mRNA turnover rate limits siRNA and microRNA efficacy (2010) (11)
The Role of MicroRNAs in Human Prostate Cancer (2010) (11)
Pan-cancer analysis of mutation hotspots in protein domains (2016) (11)
Perturbation biology links temporal protein changes to drug responses in a melanoma cell line (2019) (11)
COVID-19 Disease Map, a computational knowledge repository of SARS-CoV-2 virus-host interaction mechanisms (2020) (11)
A Drosophila hsp70 gene contains long, antiparallel, coupled open reading frames (LAC ORFs) conserved in homologous loci (1995) (11)
3D protein structure from genetic epistasis experiments (2018) (11)
Bioinformatics - Challenges in 2001 (2001) (10)
Protein structure from experimental evolution (2019) (10)
Pancreatic cancer risk predicted from disease trajectories using deep learning (2021) (9)
Cancer-associated recurrent mutations in RNase III domains of DICER1 (2014) (9)
Analysis working group of the International Cancer Genome Consortium (2015) (9)
A Hybrid Approach for Protein Structure Determination Combining Sparse NMR with Evolutionary Coupling Sequence Data. (2018) (8)
The BioPAX Validator (2013) (8)
Comparing cancer cell lines and tumor samples by genomic profiles (2015) (8)
Increased expression of androgen receptor (AR) and enzymes involved in androgen synthesis in metastatic prostate cancer: Targets for novel personalized therapies. (2009) (8)
The HSSP database of protein structure-sequence alignments (1996) (8)
BioPAX – biological pathway data exchange format (2006) (8)
COVID‐19 Disease Map, a computational knowledge repository of virus‐host interaction mechanisms (2021) (8)
Erratum to: Tumor immune microenvironment characterization in clear cell renal cell carcinoma identifies prognostic and immunotherapeutically relevant messenger RNA signatures (2017) (8)
Combining Evolutionary Covariance and NMR Data for Protein Structure Determination. (2019) (7)
Author-sourced capture of pathway knowledge in computable form using Biofactoid (2021) (7)
Does the HIV Nef protein mimic the MHC? (1993) (7)
The Human Genome and High Performance Computing in Molecular Biology (1992) (7)
Abstract S2-04: Comprehensive molecular characterization of invasive lobular breast tumors (2015) (7)
Pedestrian guide to analyzing sequence databases (1997) (7)
Abstract 3302: The molecular landscape of oncogenic signaling pathways in The Cancer Genome Atlas (2018) (6)
Exercising Multi-Layered Networks on Protein Secondary Structure (1992) (6)
Evolution and neural networks/spl minus/protein secondary structure prediction above 71% accuracy (1994) (6)
Interpretable Machine Learning for Perturbation Biology (2019) (6)
Inverting the protein-folding problem. (1990) (6)
Rapid proteotyping reveals cancer biology and drug response determinants in the NCI-60 cells (2018) (6)
FcγR-mediated SARS-CoV-2 infection of monocytes activates inflammation (2022) (5)
Abstract 923: The cBioPortal for Cancer Genomics: An intuitive open-source platform for exploration, analysis and visualization of cancer genomics data (2018) (5)
Adaptive response to BET inhibition induces therapeutic vulnerability to MCL1 inhibitors in breast cancer (2019) (5)
3D Protein Structure Predicted from Sequence (2011) (5)
Pharmacologically controlling protein-protein interactions through epichaperomes for therapeutic vulnerability in cancer (2021) (5)
MP23-11 GENOMIC COMPARISON OF RENAL CELL CARCINOMA CELL LINES TO HUMAN TUMORS (2014) (5)
Sequencing and analysis of a 35·4 kb region on the left arm of chromosome IV from Saccharomyces cerevisiae reveal 23 open reading frames (1996) (5)
scPerturb: Information Resource for Harmonized Single-Cell Perturbation Data (2022) (4)
Precision combination therapies based on recurrent oncogenic co-alterations (2020) (4)
Learning from pre-pandemic data to forecast viral escape (2023) (4)
The molecular landscape of oncogenic signaling pathways in The Cancer Genome Atlas (2018) (4)
Molecular response to PARP1 inhibition in ovarian cancer cells as determined by mass spectrometry based proteomics (2021) (4)
Artificial Intelligence and Early Detection of Pancreatic Cancer (2021) (4)
Integrative analysis of pharmacogenomics in major cancer cell line databases using CellMinerCDB (2018) (3)
Precision combination therapies based on recurrent oncogenic co-alterations. (2022) (3)
The structure of ColE 1 rop in solution (1991) (3)
Protein structure prediction (1998) (3)
The Functional Composition of Living Machines as a Design Principle for Artificial Organisms (1995) (3)
Defining the genetic basis of everolimus sensitivity in metastatic bladder cancer (MBC) by whole-genome sequencing (WGS). (2012) (3)
Analytic Properties of Bound State Wave Functions. (1975) (3)
AlignmentViewer: Sequence Analysis of Large Protein Families (2018) (3)
Accurate prediction of transmembrane β-barrel proteins from sequences (2014) (3)
Protein profiling in cancer cell lines and tumor tissue using reverse phase protein arrays (2017) (3)
A pan-cancer survey of cell line tumor similarity by feature-weighted molecular profiles (2021) (3)
Data Based Modeling of Proteins (1994) (3)
Estimation of Residue-Residue Coevolution using Direct Coupling Analysis Identifies Many Native Contacts Across a Large Number of Domain Families (2012) (3)
Disulfiram associated with lower risk of Covid-19: a retrospective cohort study (2021) (3)
Abstract 4271: The cBioPortal for Cancer Genomics as a clinical decision support tool (2014) (2)
3D RNA from evolutionary couplings (2015) (2)
netboxr: Automated discovery of biological process modules by network analysis in R (2020) (2)
Analyzing causal relationships in proteomic profiles using CausalPath (2021) (2)
Perturbation biology models predict c-Myc as an effective co-target in RAF inhibitor resistant melanoma cells (2014) (2)
COVIDpro: Database for mining protein dysregulation in patients with COVID-19 (2022) (2)
scPerturb: Harmonized Single-Cell Perturbation Data (2023) (2)
Erratum: The BioPAX community standard for pathway data sharing (Nat. Biotechnol. (2010) 28 (935-942) (2010) (2)
Macromolecular structure information and databases. The EU BRIDGE Database Project Consortium. (1996) (2)
Capturing scientific knowledge in computable form (2020) (2)
Abstract 2838: Discovery of adaptive resistance pathways and anti-resistance combination therapies in cancer from phosphoproteomic data (2018) (2)
GeneCrunch: Experiences on the SGI POWER CHALLENGEarray with Bioinformatics applications (1996) (2)
AlignmentViewer: Sequence Analysis of Large Protein Families. (2020) (1)
A Comparison of Structural and Dynamic Properties of Different Simulation Methods Applied to SH 3 (2019) (1)
Molecular and Cellular Pathobiology 18 F-Fluorodeoxy-glucose Positron Emission Tomography Marks MYC-Overexpressing Human Basal-Like Breast Cancers (2011) (1)
AlignmentViewer: Sequence Analysis of Large Protein Families [version 1; peer review: 1 approved, 1 approved with reservations] (2021) (1)
Abstract B15: Repression of PDGFRA-targeting miR-34a promotes tumorigenesis in proneural malignant gliomas (2012) (1)
Abstract 5140: Individual patient cancer profiles in the cBio Cancer Genomic Portal. (2013) (1)
Abstract 1114: Polymerase epsilon (POLE) mutations and mutator phenotypes in colorectal and endometrial tumors. (2013) (1)
Abstract 2405: Identification of PHLPP as a tumour suppressor reveals the role of pathway feedback compensation in PTEN-mutant prostate cancer progression (2011) (1)
MP85-20 METABOLOMICS AND POST-NEPHRECTOMY RENAL FUNCTION PREDICTION (2016) (1)
From Sequence Similarity to Structural Homology of Proteins (1993) (1)
Targeting Adaptation to Cancer Treatment by Drug Combinations (2021) (1)
Abstract 1284: How can you interpret gene lists from -omics experiments (2018) (1)
Solutions to the computational protein folding problem (2018) (1)
Significance of necrosis and gene expression profiling in high-grade myxoid/round cell liposarcoma (MRLS) of the extremity (2005) (1)
Pathway Commons: 2019 Update (2019) (1)
Author response: Perturbation biology nominates upstream–downstream drug combinations in RAF inhibitor resistant melanoma cells (2015) (1)
Jaws. A film of enzyme dynamics (1985) (1)
A flexible search system for high-accuracy identification of biological entities and molecules (2021) (1)
Inference of cell dynamics on perturbation data using adjoint sensitivity (2021) (1)
Author Correction: Integrative pathway enrichment analysis of multivariate omics data (2020) (1)
Author Correction: Combined burden and functional impact tests for cancer driver discovery using DriverPower (2020) (1)
GTPase domains of ras p 21 oncogene protein and elongation factor (1)
Systems pharmacology and quantitative proteomics for developing targeted triple therapy (2017) (0)
Integrative Genomic Analy sis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles Graphical (2017) (0)
Abstract 3820: Discovery of adaptive resistance pathways and anti-resistance combination therapies from phosphoproteomic data using graphical models (2019) (0)
Abstract 3515: Pathway convergent evolution underscores treatment response to MTOR inhibitors in kidney cancers. (2013) (0)
Functional Copy-Number Alterations in Cancer article openly available. Please share how this access benefits you. Your story matters (2008) (0)
LLGL2 rescues nutrient stress by promoting leucine uptake in ER+ breast cancer (2019) (0)
Proceedings of the 5th International Conference on Intelligent Systems for Molecular Biology, Halkidiki, Greece, June 21-26, 1997 (1997) (0)
EC-NMR Structure of Escherichia coli Maltose-binding protein Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data with a second set of RDC data simulated for an alternative alignment tensor. Northeast Structural Genomics Consortium target ER690 (2015) (0)
AlignmentViewer: Sequence Analysis of Large Protein Families [version 2; peer review: 2 approved] (2020) (0)
EC-NMR Structure of Human H-RasT35S mutant protein Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data (2015) (0)
TheHSSPdatabaseofprotein structure-sequen ce alignments (1993) (0)
The immune landscape of renal cell carcinoma and its association with intratumoral clonality. (2016) (0)
EC-NMR Structure of Agrobacterium tumefaciens Atu1203 Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data. Northeast Structural Genomics Consortium target AtT10 (2015) (0)
Identifying driver networks in cancer (2011) (0)
Science Signaling Podcast: 24 September 2013 (2013) (0)
EC-NMR Structure of Escherichia coli YiaD Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data. Northeast Structural Genomics Consortium target ER553 (2015) (0)
Author response: Abnormal oxidative metabolism in a quiet genomic background underlies clear cell papillary renal cell carcinoma (2019) (0)
BIOPAX REPORT SPRING 2007 (2007) (0)
Identification by computer sequence analysis of transcriptional regulator proteins in Dictyostelium discoideum and Serratia marcescens. (1991) (0)
Commentary response (2001) (0)
Pancreatic cancer is associated with medication changes prior to clinical diagnosis (2023) (0)
Abstract 822: The molecular diversity of Luminal A breast cancer. (2013) (0)
Re-engineering topology of the homodimeric ROP protein into a single-chain 4-helix bundle (2005) (0)
EVcomplex Supplementary Data (2014) (0)
miRNA Profiling of Pediatric ALL and Non-Hodgkin Lymphomas. (2005) (0)
823 Pathway signatures in breast cancer progression − a genome-scale study based on integration of biology networks, DNA copy number, gene expression and mutations (2010) (0)
Exploring causal relationships in proteomic profiles in Cytoscape using the CausalPath App (2022) (0)
Cancer-om-atics: Multilevel interpretation of cancer genome data (2011) (0)
Mechanisms of small RNA mediated mammalian gene silencing (2007) (0)
Abstract SY12-02: Computational cancer genomics: Biological discovery and translation. (2013) (0)
On the use of sequence homologies Identical pentapeptides can have cc (cooperativity/protein folding/amino acid sequence homology) (2016) (0)
[Biosimilars in inflammatory bowel disease]. (2016) (0)
Systematic dissection of cytokine responses in vivo at single-cell resolution (2021) (0)
Sequencing and analysis of a 35.4 kb region on the right [corrected] arm of chromosome IV from Saccharomyces cerevisiae reveal 23 open reading frames. (1996) (0)
How can you interpret gene lists from -omics experiments? (2017) (0)
Potential miRNA Target Sites in the 3′ UTRs of Selected Genes (2013) (0)
Medicine, Proteomics, Bioinformatics, Materials, Pharmaceuticals, Astronomy, Transitions (2002) (0)
Pattern search in BioPAX models ¨ Ozg¨ (2013) (0)
GCI: a network server for interactive 3D graphics. (1992) (0)
EC-NMR Structure of Erwinia carotovora ECA1580 N-terminal Domain Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data. Northeast Structural Genomics Consortium target EwR156A (2015) (0)
Abstract 3451: Interpreting gene lists from -omics experiments (2019) (0)
Study of genetic alterations in soft tissue sarcomas by SNP arrays, expression profiling and high-throughput sequencing (2007) (0)
Networks Improved Prediction of Protein Secondary Structure by Use of Sequence Profiles and Neural (2006) (0)
Abstract 2607: The cBioPortal for Cancer Genomics: an open source platform for accessing and interpreting complex cancer genomics data in the era of precision medicine (2017) (0)
EC-NMR Structure of Escherichia coli Maltose-binding protein Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data. Northeast Structural Genomics Consortium target ER690 (2015) (0)
Thechaperone function ofDnaKrequires thecoupling ofATPaseactivity withsubstrate binding through residue E171 (1994) (0)
Abstract 3209: The cBioPortal for Cancer Genomics (2019) (0)
RNA from evolutionary couplings (2015) (0)
Fast and sensitive search of information databases for biological relationships (1995) (0)
BY STRUCTURE PREDICTIONS SEQUENCE-STRUCTURE GAP (1996) (0)
Author response: Author-sourced capture of pathway knowledge in computable form using Biofactoid (2021) (0)
Sequence network 1 D 2 D Structure network Invariant features A C OrientationsDistances B weights features Energy (2019) (0)
Faculty Opinions recommendation of Incorporating structure to predict microRNA targets. (2005) (0)
Systems pharmacology using mass spectrometry identifies critical response nodes in prostate cancer (2018) (0)
Faculty Opinions recommendation of A glycine-dependent riboswitch that uses cooperative binding to control gene expression. (2004) (0)
Mechanistic clues about downstream effects of mutations in signaling domains (2015) (0)
Data Exchange Format for Biological Pathway Databases (BioPAX) Workshop - Final Technical Report (2004) (0)
Molecular and Cellular Pathobiology Distinct Patterns of Dysregulated Expression of Enzymes Involved inAndrogenSynthesis andMetabolism inMetastatic Prostate Cancer Tumors (2012) (0)
EC-NMR Structure of Arabidopsis thaliana At2g32350 Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data. Northeast Structural Genomics Consortium target AR3433A (2015) (0)
Abstract A24: Network models of signaling and drug response in melanoma. (2013) (0)
Using evolutionary couplings to predict contacts and build structures (2018) (0)
Table of Contents (1994) (0)
Molecular profiling of liposarcoma subtypes (2005) (0)
Resource Machine Learning Detects Pan-cancer Ras Pathway Activation in The Cancer Genome Atlas Graphical (2018) (0)
Abstract 2586: CellMinerCDB: Enabling cross-database exploration of molecular pharmacology data and response determinant discovery in cancer cell lines (2017) (0)
Molecular characterisation of PBAN-receptors: a basis for the development and screening of antagonists against Pheromone biosynthesis in moth pest species (2008) (0)
EC-NMR Structure of Ralstonia metallidurans Rmet_5065 Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data. Northeast Structural Genomics Consortium target CrR115 (2015) (0)
Protein Domain Hotspots Reveal Functional Mutations across Genes in Cancer (2015) (0)
Development of a Standard ReferenceMaterial for Metabolomics Research (2013) (0)
The Book of Job - the real meaning of justice, faith and evilness? a Bible Scripture in the old Testament about man’s relationship to God, faith, evilness and the meaning of justice (2019) (0)
Denmark-Russia relations in the years 1493-1924: Vikings, the Baltic Sea, Sweden, Poland-Lithuania, royal dynasties, Tsar Peter III, Naval officers and trade companies (2018) (0)
GENO-15IDENTIFICATION AND GENOMIC ANALYSIS OF HYPER-MUTATED AND ULTRA-MUTATED GBMS. (2015) (0)
MYC-Overexpressing Human Basal-Like Breast Cancers F-Fluorodeoxy-glucose Positron Emission Tomography Marks 18 (2011) (0)
The history of the Russian Orthodox Church in Denmark (1741-2016) seen in a Danish-Russian historical perspective (2017) (0)
3-D Lookup : Fast Protpin Structure Database Searches at 90 % ReHabi ! iW (2002) (0)
Sequencing of prostate cancers identifies new cancer genes, routes of progression and drug targets (2018) (0)
THE VIKINGS AND THEIR IMPORTANCE FOR THE NORTH ATLANTIC (ICELAND, GREENLAND, NORTH AMERICA) FROM THE BEGINNING OF THE EXPANSION IN THE 9TH CENTURY UNTIL THE EXTINCTION AROUND 1400 (2020) (0)
Abstract LB119: Precision combination therapies based on recurrent oncogenic co-alterations (2022) (0)
Ethnic religion in nowadays Europe: renaissance of the historical pagan beliefs or political Paganism? Exemplified by the Asatru in Denmark and the Mari native religion in Russia (2017) (0)
Author Correction: Analyses of non-coding somatic drivers in 2,658 cancer whole genomes (2020) (0)
small RNA cloning The developmental miRNA profiles of zebrafish as determined by Material Supplemental (2005) (0)
The history of the Moravian Church rooting in Unitas Fratrum or the Unity of the Brethren (1457-2017) based on the story of the two settlements of Christiansfeld and Sarepta (2017) (0)
Abstract LB550: AI predicts risk of pancreatic cancer from disease trajectories using real-world electronic health records (EHRs) from Denmark and the USA (2022) (0)
Abstract 3606: Identification of oncogenic mutation hotspots via three-dimensional proximity (2016) (0)
Bioinformatics : from genome data to biological knowledge fviiguel (1999) (0)
A gene expression signature associated with sensitivity to the multikinase inhibitor dasatinib: Implications for development of a noninvasive biomarker for personalized therapy based on circulating tumor cell analysis. (2010) (0)
Computer-guided design of optimal microbial 1 consortia for immune system modulation 2 3 (0)
GCTGTTA CAA CTAGTACACCTGGTTCAGGTGGTTCAGTTA CTTCAGGTGGTTCAGGTGGTTCAGTTGCTTCAGTTGCTTCAGGTGGTTCAGGTGGCTCAGTTGCTTCAGGTGGTTCAGGT A laVel ThrThrSerThrProGl ySerGl yGl ySerVal ThrSerGl yGl ySerGl yGl ySerVel A aSerVa lA (1999) (0)
A process for the structure determination of peptides (1989) (0)
MP47-13 MUTATIONAL AND PROGNOSTIC ASSOCIATIONS OF IMMUNE CELL SIGNATURES IN CLEAR CELL RENAL CELL CARCINOMA (2015) (0)
EC-NMR Structure of Synechocystis sp. PCC 6803 Slr1183 Determined by Combining Evolutionary Couplings (EC) and Sparse NMR Data. Northeast Structural Genomics Consortium target SgR145 (2015) (0)
Abstract 4256: cBioPortal for Cancer Genomics (2023) (0)
The prediction and design of protein structures (1993) (0)
Abstract 5227: Quantitative network models of signaling and drug response in melanoma. (2013) (0)
Proteomic Dynamics of Breast Cancers Identifies Potential Therapeutic Protein Targets (2022) (0)
Activating mutation in B-RAF disables normal feedback inhibition of MEK and results in increased output of the RAF/MEK/MAPK signaling pathway. (2007) (0)
BRIDGING THE PROTEIN BY STRUCTURE PREDICTIONS SEQUENCE-STRUCTURE GAP (2005) (0)
Abstract 2102: Interpretable machine learning for perturbation biology (2020) (0)
Resource Human SRMAtlas : A Resource of Targeted Assays to Quantify the Complete Human Proteome Graphical Abstract Highlights (2016) (0)
BET inhibition induces vulnerability to MCL1 targeting through upregulation of fatty acid synthesis pathway in breast cancer (2020) (0)
MP35-01 PROTEOMIC STRATIFICATION OF CLEAR CELL RENAL CELL CARCINOMA UTILIZING THE CANCER GENOME ATLAS (TCGA) WITH EXTERNAL VALIDATION (2015) (0)
SONNHAMMER reading frames of yeast chromosome III Comprehensive sequence analysis of the 182 predicted open (2002) (0)
The utility of high-throughput proteomic datasets for probing cancer-related pathways (2015) (0)

This paper list is powered by the following services:

Other Resources About Chris Sander

en.wikipedia.org

What Schools Are Affiliated With Chris Sander ?

Chris Sander is affiliated with the following schools:

Image Attributions

Image Source for Chris Sander