David W. Golde
#90,523
Most Influential Person Now
David W. Golde's AcademicInfluence.com Rankings
David W. Goldephilosophy Degrees
Philosophy
#3319
World Rank
#5387
Historical Rank
Logic
#1085
World Rank
#1725
Historical Rank
David W. Goldebiology Degrees
Biology
#4119
World Rank
#6189
Historical Rank
Virology
#67
World Rank
#70
Historical Rank
Microbiology
#128
World Rank
#153
Historical Rank
Download Badge
Philosophy Biology
Why Is David W. Golde Influential?
(Suggest an Edit or Addition)David W. Golde's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- A new subtype of human T-cell leukemia virus (HTLV-II) associated with a T-cell variant of hairy cell leukemia. (1982) (1094)
- The sphingomyelin pathway in tumor necrosis factor and interleukin-1 signaling (1994) (953)
- Effect of recombinant human granulocyte-macrophage colony-stimulating factor on myelopoiesis in the acquired immunodeficiency syndrome. (1987) (568)
- Acute myelogenous leukemia: a human cell line responsive to colony-stimulating activity. (1978) (529)
- Human granulocyte-macrophage colony-stimulating factor is a neutrophil activator (1985) (527)
- Mammalian facilitative hexose transporters mediate the transport of dehydroascorbic acid (1993) (505)
- Cytokines alter production of HIV-1 from primary mononuclear phagocytes. (1988) (490)
- The stem cell. (1991) (472)
- Purified human granulocyte-macrophage colony-stimulating factor: direct action on neutrophils. (1984) (450)
- Human myeloid leukemia cell lines: a review. (1980) (383)
- Direct evidence for a bone marrow origin of the alveolar macrophage in man. (1976) (383)
- Human GM-CSF primes neutrophils for enhanced oxidative metabolism in response to the major physiological chemoattractants. (1987) (343)
- Hairy cell leukemia: a clinical review based on 71 cases. (1978) (339)
- Complete nucleotide sequence of an infectious clone of human T-cell leukemia virus type II: an open reading frame for the protease gene. (1985) (338)
- Granulocyte-macrophage colony-stimulating factor enhances phagocytosis of bacteria by human neutrophils. (1986) (338)
- Vitamin C crosses the blood-brain barrier in the oxidized form through the glucose transporters. (1997) (317)
- Identification of the colony-stimulating cell in human peripheral blood. (1972) (289)
- Enhancement of human eosinophil cytotoxicity and leukotriene synthesis by biosynthetic (recombinant) granulocyte-macrophage colony-stimulating factor. (1986) (283)
- An undifferentiated variant derived from the human acute myelogenous leukemia cell line (KG-1). (1980) (278)
- Prostate cancer cell cycle regulators: response to androgen withdrawal and development of androgen independence. (1999) (270)
- Molecular characterization and expression of the gene encoding human erythroid-potentiating activity (1985) (268)
- The Pulmonary-Alveolar Macrophage (1979) (265)
- Chronic myelogenous leukemia: recent advances. (1985) (259)
- Human granulocyte colony-stimulating factor: biologic activities and receptor characterization on hematopoietic cells and small cell lung cancer cell lines. (1990) (255)
- A second isolate of HTLV-II associated with atypical hairy-cell leukemia. (1986) (253)
- Vitamin C enters mitochondria via facilitative glucose transporter 1 (Gluti) and confers mitochondrial protection against oxidative injury (2005) (248)
- Vitamin C suppresses TNF alpha-induced NF kappa B activation by inhibiting I kappa B alpha phosphorylation. (2002) (239)
- Sphingomyelinase and ceramide activate mitogen-activated protein kinase in myeloid HL-60 cells. (1993) (234)
- Dehydroascorbic acid, a blood–brain barrier transportable form of vitamin C, mediates potent cerebroprotection in experimental stroke (2001) (226)
- Bone marrow origin of hepatic macrophages (Kupffer cells) in humans. (1978) (224)
- Vitamin C antagonizes the cytotoxic effects of antineoplastic drugs. (2005) (217)
- Biosynthetic human GM-CSF modulates the number and affinity of neutrophil f-Met-Leu-Phe receptors. (1986) (216)
- The human gene encoding GM-CSF is at 5q21-q32, the chromosome region deleted in the 5q- anomaly. (1985) (216)
- GM-CSF induces human neutrophil IgA-mediated phagocytosis by an IgA Fc receptor activation mechanism (1988) (205)
- Tissue inhibitor of metalloproteinase‐2 (TIMP‐2) has erythroid‐potentiating activity (1992) (205)
- T-lymphocyte variant of hairy-cell leukemia. (1978) (203)
- Human Monocarboxylate Transporter 2 (MCT2) Is a High Affinity Pyruvate Transporter* (1998) (203)
- Biosynthetic (recombinant) human granulocyte-macrophage colony-stimulating factor: effect on normal bone marrow and leukemia cell lines. (1986) (198)
- Association of the human type C retrovirus with a subset of adult T-cell cancers. (1983) (197)
- Alpha-2 interferon therapy of hairy-cell leukemia: a multicenter study of 64 patients. (1986) (196)
- Molecular characterization of genome of a novel human T-cell leukaemia virus (1983) (191)
- Identification of CRKL as the constitutively phosphorylated 39-kD tyrosine phosphoprotein in chronic myelogenous leukemia cells. (1994) (191)
- Identification of the putative transforming protein of the human T-cell leukemia viruses HTLV-I and HTLV-II. (1984) (184)
- Defective lung macrophages in pulmonary alveolar proteinosis. (1976) (183)
- Stromal cell oxidation: a mechanism by which tumors obtain vitamin C. (1999) (183)
- Therapy for neutropenia in hairy cell leukemia with recombinant human granulocyte colony-stimulating factor. (1988) (180)
- Granulocyte-macrophage colony-stimulating factor enhances neutrophil function in acquired immunodeficiency syndrome patients. (1988) (180)
- Nonhematopoietic tumor cells express functional GM-CSF receptors (1989) (179)
- Metalloproteinase inhibition and erythroid potentiation are independent activities of tissue inhibitor of metalloproteinases-1. (1995) (174)
- Vitamin C Prevents DNA Mutation Induced by Oxidative Stress* (2002) (173)
- Soluble receptors in human disease (1998) (173)
- Expression of the fructose transporter GLUT5 in human breast cancer. (1996) (172)
- Growth hormone: species-specific stimulation of erythropoiesis in vitro. (1977) (170)
- Resolution of the Facilitated Transport of Dehydroascorbic Acid from Its Intracellular Accumulation as Ascorbic Acid (*) (1995) (167)
- Cellular interactions in haematopoiesis (1979) (164)
- A quantitative measurement of the human somatic mutation rate. (2005) (160)
- A review and reevaluation of the histiocytic disorders. (1973) (160)
- Tumor necrosis factor activation of the sphingomyelin pathway signals nuclear factor kappa B translocation in intact HL-60 cells. (1993) (159)
- High-affinity binding of granulocyte-macrophage colony-stimulating factor to normal and leukemic human myeloid cells. (1986) (159)
- Response of prostate cancer to anti-Her-2/neu antibody in androgen-dependent and -independent human xenograft models. (1999) (158)
- Hydrogen peroxide generated extracellularly by receptor-ligand interaction facilitates cell signaling. (2005) (154)
- Recycling of Vitamin C by a Bystander Effect* (2003) (154)
- Production of colony-stimulating factor by human macrophages. (1972) (153)
- Colony-stimulating factors and host defense. (1989) (148)
- Human T lymphocyte cell line producing colony-stimulating activity. (1978) (146)
- The histiocytic disorders: a pathophysiologic analysis. (1981) (145)
- Treatment of refractory aplastic anemia with recombinant human granulocyte-macrophage-colony-stimulating factor (1989) (143)
- Occult pulmonary haemorrhage in leukaemia. (1975) (141)
- Potentiation of erythropoiesis in vitro by dexamethasone. (1976) (139)
- Hypoxia-reoxygenation-induced mitochondrial damage and apoptosis in human endothelial cells are inhibited by vitamin C. (2005) (138)
- Mechanism of Vitamin C Inhibition of Cell Death Induced by Oxidative Stress in Glutathione-depleted HL-60 Cells* (2001) (136)
- Genistein Is a Natural Inhibitor of Hexose and Dehydroascorbic Acid Transport through the Glucose Transporter, GLUT1 (*) (1996) (135)
- Persistence of insulin resistance in polycystic ovarian disease after inhibition of ovarian steroid secretion. (1986) (134)
- The 5q- abnormality. (1987) (128)
- Vitamin C inhibits FAS-induced apoptosis in monocytes and U937 cells. (2003) (126)
- Human HL-60 myeloid leukemia cells transport dehydroascorbic acid via the glucose transporters and accumulate reduced ascorbic acid. (1994) (122)
- Thyroid Hormones Stimulate Erythropoiesis in Vitro (1977) (122)
- Monocytes and Macrophages: Functions and Diseases (1978) (119)
- 5' upstream sequence and genomic structure of the human primary response gene, EGR-1/TIS8. (1991) (116)
- Growth hormone stimulation of normal and leukemic human T-lymphocyte proliferation in vitro. (1981) (114)
- Characterization of a novel HTLV-infected cell line. (1984) (113)
- Growth hormone mediates the growth of T-lymphoblast cell lines via locally generated insulin-like growth factor-I. (1990) (112)
- Regulation of expression of human granulocyte/macrophage colony-stimulating factor. (1986) (107)
- Proliferation of astroglia and oligodendroglia in response to human T cell-derived factors. (1984) (105)
- Direct inhibition of the hexose transporter GLUT1 by tyrosine kinase inhibitors. (2001) (104)
- Growth of human bone marrow in liquid culture. (1973) (103)
- The precrystalline cytoplasmic granules of alveolar soft part sarcoma contain monocarboxylate transporter 1 and CD147. (2002) (102)
- Vitamin C Is a Kinase Inhibitor: Dehydroascorbic Acid Inhibits IκBα Kinase β (2004) (102)
- Serum cholesterol-lowering activity of granulocyte-macrophage colony-stimulating factor. (1988) (102)
- Identification and molecular cloning of a soluble human granulocyte-macrophage colony-stimulating factor receptor. (1991) (101)
- Infections in hairy-cell leukemia. (1978) (100)
- Recombinant alpha-2-interferon for hairy cell leukemia. (1985) (98)
- Efficient Transport and Accumulation of Vitamin C in HL-60 Cells Depleted of Glutathione* (1997) (97)
- Serum inhibitors of hematopoiesis in a patient with aplastic anemia and systemic lupus erythematosus. Recovery after exchange plasmapheresis. (1979) (94)
- Activities of four purified growth factors on highly enriched human hematopoietic progenitor cells. (1987) (94)
- Human immunodeficiency virus causes mononuclear phagocyte dysfunction. (1990) (94)
- Insulin-like growth factor-I resistance. (1998) (92)
- Alveolar macrophage dysfunction in human bone marrow transplant recipients. (1982) (92)
- Regulation of granulopoiesis. (1974) (90)
- Immunoglobulin Synthesis in Hairy Cell Leukaemia (1977) (89)
- Retroviral gene transfer induced constitutive expression of interleukin-2 or interferon-gamma in irradiated human melanoma cells. (1992) (88)
- Immune suppression of hematopoiesis. (1978) (87)
- Augmentation of antitumor immunity by tumor cells transduced with a retroviral vector carrying the interleukin-2 and interferon-gamma cDNAs. (1994) (87)
- Long-term human bone marrow cultures. (1980) (87)
- Purification and characterization of human T-lymphocyte-derived erythroid-potentiating activity. (1984) (84)
- Integrated human T-cell leukemia virus II genome in CD8 + T cells from a patient with "atypical" hairy cell leukemia: evidence for distinct T and B cell lymphoproliferative disorders. (1988) (84)
- Polycythemia: mechanisms and management. (1981) (84)
- Studies of the putative transforming protein of the type I human T-cell leukemia virus. (1985) (83)
- The pulmonary macrophage in acute leukemia. (1974) (82)
- Human preleukemia. Identification of a maturation defect in vitro. (1973) (82)
- Immune (γ) interferon produced by a human T-lymphoblast cell line (1981) (82)
- Vitamin C inhibits hypoxia-induced damage and apoptotic signaling pathways in cardiomyocytes and ischemic hearts. (2004) (77)
- Helper and suppressor t-lymphocyte leukemia in ataxia telangiectasia. (1979) (77)
- N-Glycosylation of the Human Granulocyte-Macrophage Colony-stimulating Factor Receptor α Subunit Is Essential for Ligand Binding and Signal Transduction (*) (1995) (74)
- Activation of human eosinophil and neutrophil functions by haematopoietic growth factors: comparisons of IL‐1, IL‐3, IL‐5 and GM‐CSF (1992) (74)
- Increased facilitated transport of dehydroascorbic acid without changes in sodium-dependent ascorbate transport in human melanoma cells. (1997) (74)
- Human erythrocytes express GLUT5 and transport fructose. (1997) (73)
- Sequential therapy with fludarabine, high-dose cyclophosphamide, and rituximab in previously untreated patients with chronic lymphocytic leukemia produces high-quality responses: molecular remissions predict for durable complete responses. (2009) (73)
- Diagnostic lavage and occult pulmonary hemorrhage in thrombocytopenic immunocompromised patients. (1977) (73)
- Production of granulocyte‐macrophage colony‐stimulating factor in two patients with lung cancer, leukocytosis, and eosinophilia (1992) (72)
- Mixed cryoglobulins and glomerulonephritis. (1968) (71)
- Randomized study of the duration of treatment with interferon alfa-2B in patients with hairy cell leukemia. (1988) (71)
- Autoimmune disease in hairy‐cell leukaemia: clinical syndromes and treatment (1985) (70)
- Human preleukemia. (1980) (68)
- Purification and characterization of a human T-lymphocyte-derived granulocyte-macrophage colony-stimulating factor (1981) (68)
- Granulocytosis associated with tumor cell production of colony-stimulating activity. (1983) (67)
- Peripheral unresponsiveness to human growth hormone in Laron dwarfism. (1980) (67)
- Natural and biosynthetic insulin stimulates the growth of human erythroid progenitors in vitro. (1982) (67)
- Vitamin C inhibits granulocyte macrophage-colony-stimulating factor-induced signaling pathways. (2002) (67)
- Macroglobulinemia and hairy-cell leukemia. (1977) (65)
- Effect of endotoxin on the production of colony‐stimulating factor by human monocytes and macrophages (1974) (65)
- Systolic Phases of the Cardiac Cycle in Children (1970) (65)
- Nucleotide sequence analysis of the long terminal repeat of human T-cell leukemia virus type II. (1984) (64)
- Positron emission tomography of a human prostate cancer xenograft: association of changes in deoxyglucose accumulation with other measures of outcome following androgen withdrawal. (1998) (63)
- Physiology of granulocyte and macrophage colony-stimulating factors in host defense. (1989) (63)
- Treatment of acute myelogenous leukemia in the elderly. (1989) (63)
- Vitamin C protects HL60 and U266 cells from arsenic toxicity. (2005) (62)
- K562 cells produce and respond to human erythroid-potentiating activity. (1988) (62)
- Caspase-8 dependent trail-induced apoptosis in cancer cell lines is inhibited by vitamin C and catalase (2006) (62)
- Nucleotide sequence of the 3' region of an infectious human T-cell leukemia virus type II genome. (1984) (62)
- A unique growth factor in patients with acromegaloidism. (1983) (61)
- Cytochemical reactions of human hematopoietic cells in liquid culture. (1976) (60)
- Hormones that stimulate the growth of blood cells. (1988) (60)
- Expression of the 3' terminal region of human T-cell leukemia viruses. (1984) (60)
- Differentiating agents facilitate infection of myeloid leukemia cell lines by monocytotropic HIV-1 strains. (1990) (59)
- Abdominal presentation of varicella-zoster infection in recipients of allogeneic bone marrow transplantation. (1991) (58)
- The alpha subunit of the human granulocyte-macrophage colony-stimulating factor receptor signals for glucose transport via a phosphorylation-independent pathway. (1994) (57)
- Report of a multi-institutional study of 193 patients with hairy cell leukemia treated with interferon-alfa2b. (1988) (57)
- Polycythemia vera: hormonal modulation of erythropoiesis in vitro. (1977) (56)
- Antioxidants prevent oxidative DNA damage and cellular transformation elicited by the over-expression of c-MYC. (2006) (56)
- Tissues of the Laron dwarf are sensitive to insulin-like growth factor I but not to growth hormone. (1987) (56)
- A Human Sodium-Dependent Vitamin C Transporter 2 Isoform Acts as a Dominant-Negative Inhibitor of Ascorbic Acid Transport (2004) (55)
- Hematopoietic cell differentiation (1978) (55)
- Identification and characterization of a low-affinity granulocyte-macrophage colony-stimulating factor receptor on primary and cultured human melanoma cells. (1991) (54)
- Mobilization of hematopoietic stem cells (CFU-C) into the peripheral blood of man by endotoxin. (1977) (53)
- Differentiation of macrophages from normal human bone marrow in liquid culture. Electron microscopy and cytochemistry. (1978) (52)
- Prevention of graft rejection following bone marrow transplantation (1981) (52)
- Controlling the production of blood cells. (1979) (52)
- Chromosomal mosaicism associated with prolonged remission in chronic myelogenous leukemia (1976) (52)
- Hairy cell leukemia: a five-year update on seventy-one patients. (1983) (51)
- Establishment of eosinophilic sublines from human promyelocytic leukemia (HL-60) cells: demonstration of multipotentiality and single-lineage commitment of HL-60 stem cells. (1986) (50)
- K562 Cells Produce and Respond to Human Erythroid-Potentiating Activity (1988) (50)
- Occult pulmonary hemorrhage in anticoagulated patients. (1975) (50)
- Nonhematopoietic tumor cells express functional GM-CSF receptors. (1989) (50)
- Biosynthetic granulocyte-macrophage colony-stimulating factor enhances neutrophil cytotoxicity toward human leukemia cells. (1987) (50)
- Cellular maturation in human preleukemia. (1978) (50)
- Expression of granulocyte-macrophage colony-stimulating factor receptors in human prostate cancer. (1998) (48)
- Relationship between human T cell leukemia virus-II and atypical hairy cell leukemia: a serologic study of hairy cell leukemia patients. (1987) (47)
- Decreased insulin-like growth factor I receptor expression and function in immortalized African Pygmy T cells. (1996) (47)
- Cytogenetic abnormalities in ataxia telangiectasia with T-cell chronic lymphocytic leukemia (1980) (46)
- The Philadelphia chromosome in human macrophages (1977) (46)
- HTLV x-gene product: requirement for the env methionine initiation codon. (1985) (46)
- Granulocyte-macrophage colony-stimulating factor activates microtubule-associated protein 2 kinase in neutrophils via a tyrosine kinase-dependent pathway. (1992) (46)
- Inhibition of colony-stimulating factor-1 activity by monoclonal antibodies to the human CSF-1 receptor. (1989) (45)
- Chronic myelogenous leukemia cell growth and maturation in liquid culture. (1974) (44)
- Erythropoiesis in preleukemia. (1978) (44)
- Growth hormone modulation of murine erythroleukemia cell growth in vitro. (1978) (43)
- Production of colony-stimulating factor by malignant leukocytes. (1974) (42)
- GROWTH WITHOUT GROWTH HORMONE: EVIDENCE FOR A POTENT CIRCULATING HUMAN GROWTH FACTOR (1986) (40)
- A phase I/II study of interleukin-3 in patients with aplastic anemia and myelodysplasia. (1994) (40)
- ÆTIOLOGY OF REGIONAL ENTERITIS (1968) (40)
- Granulocyte colony-stimulating factor (G-CSF): preclinical and clinical studies. (1992) (39)
- Thymus-dependent lymphocytes in human bone marrow. (1975) (38)
- Granulocyte function in experimental human endotoxemia. (1976) (38)
- Pathogenesis of one variant of sea-blue histiocytosis. (1975) (38)
- Involvement of the sphingomyelin pathway in autocrine tumor necrosis factor signaling for human immunodeficiency virus production in chronically infected HL-60 cells. (1994) (37)
- Leprechaunism: In Vitro Insulin Action Despite Genetic Insulin Resistance (1987) (37)
- Purification and characterization of a human T-lymphocyte-derived glial growth-promoting factor. (1985) (36)
- Granulocyte-Macrophage Colony-stimulating Factor Signals for Increased Glucose Transport via Phosphatidylinositol 3-Kinase- and Hydrogen Peroxide-dependent Mechanisms* (2003) (36)
- Glucan-activated macrophages: functional characteristics and surface morphology. (1978) (36)
- Localization of the gene encoding human erythroid-potentiating activity to chromosome region Xp11.1----Xp11.4. (1986) (35)
- Increased Uptake and Accumulation of Vitamin C in Human Immunodeficiency Virus 1-infected Hematopoietic Cell Lines* (1997) (35)
- Treatment of refractory aplastic anemia with recombinant human granulocyte-macrophage-colony-stimulating factor. (1989) (35)
- Erythropoiesis in familial erythrocytosis. (1977) (34)
- Cell mediated inhibition of erythropoiesis and megaloblastic anemia in T‐cell chronic lymphocytic leukemia (1983) (34)
- Differentiation and functional activity of human eosinophilic cells from an eosinophil HL-60 subline: response to recombinant hematopoietic growth factors. (1992) (34)
- Subnuclear localization of the trans-activating protein of human T-cell leukemia virus type I (1988) (34)
- Therapy of hairy-cell leukemia. (1982) (34)
- Biologic potential of pulmonary macrophages. (1978) (34)
- In vitro production of granulocyte-macrophage colony-stimulating factor in aplastic anemia: possible mechanisms of action of antithymocyte globulin. (1991) (33)
- Neutrophil products that inhibit cell proliferation: relation to granulocytic "chalone". (1978) (33)
- Humoral modulation of human acute myelogenous leukemia cell growth in vitro. (1980) (33)
- Clinical problems in hairy cell leukemia: diagnosis and management. (1984) (33)
- Alveolar proteinosis and the overfed macrophage. (1979) (32)
- Evidence that facilitative glucose transporters may fold as beta-barrels. (1993) (32)
- Granulocyte-macrophage colony-stimulating factor signals for increased glucose uptake in human melanoma cells. (1995) (32)
- Colony-stimulating factors signal for increased transport of vitamin C in human host defense cells. (1998) (32)
- Functional evaluation of lung macrophages from cigarette smokers and nonsmokers. (1982) (31)
- The predicted ATP-binding domains in the hexose transporter GLUT1 critically affect transporter activity. (2001) (31)
- Lymphokines secreted by an established lymphocyte line modulate receptor-mediated endocytosis in macrophages derived from human monocytes. (1983) (30)
- Acute leukemia: biology and treatment. (1979) (30)
- Membrane-associated and soluble granulocyte/macrophage-colony-stimulating factor receptor alpha subunits are independently regulated in HL-60 cells. (1995) (30)
- Effect of glucan, a macrophage activator, on murine hemopoietic cell proliferation in diffusion chambers in mice. (1978) (29)
- The Philadelphia chromosome in human macrophages. (1977) (29)
- Persistence of Insulin Resistance in Polycystic Ovarian Disease after Inhibition of Ovarian Steroid Secretion (1987) (29)
- Sequential evaluation of alpha-2b-interferon treatment in 128 patients with hairy cell leukemia. (1987) (28)
- A pilot study of immunization with interleukin-2 secreting allogeneic HLA-A2 matched renal cell carcinoma cells in patients with advanced renal cell carcinoma. (1992) (28)
- Insulin-like growth factor I resistance in immortalized T cell lines from African Efe Pygmies. (1995) (28)
- The pulmonary-alveolar macrophage (first of two parts). (1979) (28)
- Human alveolar macrophages express Ia-like antigens. (1981) (27)
- Evaluation of congenital neutropenic disorders by in vitro bone marrow culture. (1977) (27)
- Hairy cell leukemia. Disease pattern and prognosis (1984) (27)
- The laminin receptor modulates granulocyte–macrophage colony-stimulating factor receptor complex formation and modulates its signaling (2003) (27)
- Characterization of the soluble human granulocyte-macrophage colony-stimulating factor receptor complex. (1991) (27)
- Chronic myelogenous leukemia--new concepts (second of two parts). (1981) (26)
- Insulin and insulin-like growth factor-I responsiveness in polycystic ovarian syndrome. (1992) (26)
- Prevention of graft rejection following bone marrow transplantation. (1981) (26)
- Proliferation and differentiation of human myeloid leukemic cells in immunodeficient mice: electron microscopy and cytochemistry. (1984) (26)
- Crystallization and preliminary x-ray characterization of bovine growth hormone. Purification of bovine prolactin and growth hormone. (1985) (25)
- Detection of two distinct malignant B cell clones in a single patient using anti-idiotype monoclonal antibodies and immunoglobulin gene rearrangement. (1985) (25)
- High-affinity binding to the GM-CSF receptor requires intact N-glycosylation sites in the extracellular domain of the β subunit (2000) (25)
- Granulocytic stem cells in Friend leukemia. (1976) (25)
- Neutrophil migration-inhibition activity produced by a unique T lymphoblast cell line. (1979) (24)
- Granulocyte-macrophage colony-stimulating factor enhances cationic antimicrobial protein synthesis by human neutrophils. (1990) (24)
- Clinical trials of myeloid growth factors. (1990) (24)
- Human myeloid precursors forming colonies in diffusion chambers expresses the Ia-like antigen. (1979) (24)
- Neutrophil migration inhibition factor from T lymphocytes (NIF-T): a new lymphokine. (1979) (23)
- Clinical applications of the myeloid growth factors. (1989) (23)
- Ia antigen is a differentiation marker on human eosinophils. (1980) (23)
- Growth hormone polypeptides stimulate proliferation of K562 human erythroleukemia cells. (1980) (22)
- In vivo effect of human erythroid-potentiating activity on hematopoiesis in mice. (1988) (22)
- Clinical role of granulocyte-macrophage colony-stimulating factor. (1989) (22)
- Deoxyribonuclease-positive Staphylococcus epidermidis strains. (1970) (22)
- Tumor necrosis factor-dependent production of human immunodeficiency virus 1 in chronically infected HL-60 cells. (1993) (22)
- HTLV and human leukemia: perspectives 1986. (1986) (22)
- Insulin-like growth factor-I unresponsiveness in an Efe Pygmy. (1993) (21)
- Glucocorticoid sensitivity and receptors in cells of human myelogenous leukemia lines. (1980) (21)
- Hormonal effects on cell proliferation in a human erythroleukemia cell line (K562). (1980) (21)
- Hormonal Modulation of Erythropoiesis In Vitro (1978) (20)
- Discrete clusters of hematopoietic cells in the marrow cavity of man after bone marrow transplantation. (1977) (20)
- Autoimmune panleukopenia. (1976) (20)
- Response of human glioblastoma cells to recombinant interleukin-2 (1988) (19)
- Lithium enhances growth of human leukaemia cells in vitro (1982) (19)
- Overview of myeloid growth factors. (1990) (19)
- Insulin and IGF-I stimulate normal and virally transformed T-lymphocyte cell growth in vitro (1992) (19)
- The colony-stimulating factors: biology and clinical use. (1990) (19)
- Chronic leukemias: oncogenes, chromosomes, and advances in therapy. (1986) (19)
- High-affinity binding to the GM-CSF receptor requires intact N-glycosylation sites in the extracellular domain of the beta subunit. (2000) (18)
- The function of human alveolar macrophages. (1979) (18)
- The pulmonary-alveolar macrophage (second of two parts). (1979) (18)
- Surface morphology and functional studies of human alveolar macrophages from cigarette smokers and nonsmokers. (1982) (18)
- The UCLA experience with type I interferons in hairy cell leukemia. (1987) (18)
- GM-CSF: receptor structure and transmembrane signaling. (1990) (18)
- Production of bone resorbing activity in poorly differentiated monocytic malignancy (1978) (18)
- Hairy Cell Leukemia: In-Vitro Culture Studies (1976) (17)
- Serum agglutinins to commercially prepared albumin. (1971) (17)
- A Human Lymphokine Activates Macrophage C3 Receptors for Phagocytosis: Studies Using Monoclonal Anti‐Lymphokine Antibodies (1984) (17)
- Serum stem cell factor levels in patients with aplastic anemia. (1994) (16)
- Molecular characterization of a granulocyte macrophage-colony-stimulating factor receptor alpha subunit-associated protein, GRAP. (2000) (16)
- Treatment of adults with acute lymphoblastic leukemia: Do the specifics of the regimen matter? (2013) (16)
- Translation of mRNA for human granulocyte–macrophage colony stimulating factor (1982) (16)
- Transformation of DBA/2 mouse fetal liver cells infected in vitro by the anemic strain of Friend leukemia virus. (1979) (16)
- Hairy cell leukemia and human T cell leukemia virus. (1984) (16)
- Polycythemia: evaluation and management. (1989) (16)
- Amygdalin (Laetrile): effect on clonogenic cells from human myeloid leukemia cell lines and normal human marrow. (1980) (15)
- Granulocytes in human disease. (1974) (14)
- Purification and characterization of a human T-lymphocyte-derived granulocyte-macrophage colony-stimulating factor. (1981) (14)
- Induction of acute corneal allograft rejection by alpha-2 interferon. (1987) (14)
- Detection of glucocorticoid receptors on Friend erythroleukemia cells. (1979) (14)
- Survival Experience of 195 Patients with Hairy Cell Leukemia Treated in a Multi-Institutional Study with Interferon-Alfa 2B. (1991) (14)
- The use of myeloid hematopoietic growth factors in patients with HIV infection. (1990) (13)
- IGF-I resistance in virus-transformed B-lymphocytes from African Efe Pygmies. (1996) (13)
- Evolving therapy of hairy cell leukemia (1987) (13)
- Hormonal interactions with hematopoietic cells in vitro. (1978) (13)
- Hairy-cell leukemia: biology and treatment. (1986) (13)
- Characterization of purified human erythroid-potentiating activity. (1985) (13)
- Chronic myelogenous leukemia--new concepts (first of two parts). (1981) (12)
- Growth hormone induces insulin resistance in Laron dwarf cells via lactogenic receptors. (1993) (12)
- Hematologic abnormalities in fibrogenesis imperfecta ossium. (1971) (12)
- Neutrophil migration inhibition factor from T lymphocytes (NIF-T): selective removal of biologic activity by human peripheral blood neutrophils, myelocytic leukemia cells, and differentiated HL-60 cells. (1982) (12)
- Proliferation and maturation of human leukemia cells in liquid culture. (1975) (12)
- Purification and crystallization of the polypeptide hormone human chorionic somatomammotropin. (1981) (11)
- Hairy cell leukemia. Disease pattern and prognosis. (1984) (11)
- Production of migration-inhibitory factor by a human T-lymphoblast cell line. (1983) (11)
- Abnormal in vitro granulopoiesis in phenotypically normal parents of some children with congenital neutropenia. (1977) (11)
- Recombinant beta‐serine‐interferon in hairy cell leukemia compared prospectively with results with recombinant alpha‐interferon (1989) (11)
- The use of hematopoietic hormones in HIV infection and AIDS-related malignancies. (1991) (11)
- Kinetics and function of the human alveolar macrophage. (1977) (11)
- Pathogenesis of polycythemia vera—new concepts (1976) (11)
- HTLV-II and human lymphoproliferative disorders. (1988) (11)
- Chronic neutropenia: Response to plasma with high colony-stimulating activity. (1975) (11)
- DNA synthesis in multiple myeloma cells following cell cycle-nonspecific chemotherapy. (1974) (11)
- Neutrophil migration inhibition factor from T lymphocytes (NIF-T): partial purification by antibody affinity chromatography and further characterization. (1982) (11)
- Expression of Ia-like antigens in human erythroid progenitor cells as determined by monoclonal antibodies and heteroantiserum to Ia-like antigens. (1981) (11)
- Splenic artery embolization prior to splenectomy in end‐stage polycythemia vera (1980) (10)
- Aplastic anemia from veterinary phenylbutazone. (1976) (10)
- UCLA Conference. Monocytes and macrophages: functions and diseases. (1978) (10)
- Erythropoietin‐Stimulated Proliferation of Human Red Cell Precursors in Vitro (1974) (10)
- PI3-kinase activation by GM-CSF in endothelium is upstream of Jak/Stat pathway: role of alphaGMR. (2005) (10)
- The Effect of Endotoxin on Circulating Lymphocytes in Normal Man (1977) (10)
- The α Subunit of the Granulocyte-Macrophage Colony-stimulating Factor Receptor Interacts with c-Kit and Inhibits c-Kit Signaling* (2006) (10)
- Insulin Resistance in Klinefelter Syndrome (1987) (10)
- A colony assay for in vitro transformation by human T cell leukemia viruses type I and type II (1987) (10)
- Responsiveness of a human myelogenous leukemia cell line (KG-1) to humoral factors in vivo. (1980) (10)
- Vitamin C in Cancer (2003) (10)
- Diminished in vitro responsiveness of circulating erythroid progenitor cells to insulin as an indicator of insulin resistance. (1985) (10)
- Stimulatory activity for human pluripotent hemopoietic progenitors produced by a human T-lymphocyte cell line. (1981) (9)
- Hemopoietic stem cells in mouse liver. (1978) (9)
- Morphological studies of cultured human pulmonary macrophages. (1980) (9)
- Human T-lymphocyte products stimulate human hemopoietic progenitor cell proliferation in diffusion chambers in vivo. (1982) (9)
- 5-fluorocytosine: inhibition of hematopoiesis in vitro and reversal of inhibition by uracil. (1979) (9)
- Granulocytosis associated with tumor cell production of colony- stimulating activity (1983) (9)
- Antigens present on human myeloid leukemia cell lines. (1980) (9)
- The biology and clinical applications of granulocyte-macrophage colony-stimulating factor. (1991) (9)
- Treatment of hairy-cell leukemia. (1990) (8)
- Proliferation of human malignant hematopoietic cells in immunodeficient mice: suppression by antibody to pluripotent K-562 leukemia cells involves direct cytolysis and effector cells. (1983) (8)
- Immune (gamma) interferon produced by a human T-lymphoblast cell line. (1981) (8)
- Critical evaluation of the World Health Organization classification of myelodysplasia and acute myeloid leukemia (2000) (8)
- Erythroid-potentiating activity: characterization and target cells. (1980) (8)
- Human myeloma cells and their strong stimulating capacity in 'one-way' mixed lymphocyte reaction: a comparative study with leukaemic B lymphoid cells. (1979) (7)
- Aetiology of regional enteritis. (1968) (7)
- Radiographic aspects of occult pulmonary haemorrhage. (1978) (7)
- Human leukemia cell line K562 responds to erythroid-potentiating activity (1982) (7)
- Bacterial endocarditis in a patient with a saphenous vein graft A-V fistula receiving dental work. (1972) (7)
- T-cell leukemia in ataxia telangiectasia. (1979) (7)
- Recombinant human erythroid potentiating activity enhances the effect of erythropoietin in mice (1990) (7)
- Spectrum of Albumin Auto‐Agglutinins (1973) (7)
- Growth-Promoting Actions of Parathyroid Hormone, Adrenocorticotrophic Hormone, and Thyroid-Stimulating Hormone: In Vitro Studies in Normal and Pygmy T-Lymphoblast Cell Lines (1995) (7)
- Pure red cell aplasia characterized by erythropoietic maturation arrest. Response to anti-thymocyte globulin. (1985) (7)
- Improved techniques for liquid culture of human and mouse bone marrow. (1976) (6)
- Inhibitors of myelopoiesis. (1978) (6)
- Impaired cellular interactions involving lymphocytes from patients with chronic lymphocytic leukemia and ataxia-telangiectasia. (1980) (6)
- T-lymphoblast cell lines from Laron dwarfs augment basal colony formation in response to extremely high concentrations of growth hormone. (1990) (6)
- Lowering Cholesterol With Granulocyte-Macrophage Colony-Stimulating Factor-Reply (1989) (5)
- Further purification of neutrophil migration inhibition factor from T lymphocytes (NIF-T): evidence that NIF-T and leukocyte inhibitory factor (LIF) are immunologically distinct. (1984) (5)
- Cladribine Underdosing in Hairy-cell Leukemia: a Cause for Apparent Response Failure (2002) (5)
- A colony assay for in vitro transformation by human T cell leukemia viruses type I and type II. (1987) (5)
- Responses of neutrophils to myeloid growth factors. (1990) (5)
- Human leukemia cell line K562 responds to erythroid-potentiating activity. (1982) (5)
- Physiological relevance of erythroid-potentiating activity or TIMP (reply) (1986) (4)
- Myeloid colony-forming cell kinetics in man. (1980) (4)
- Hb Switching in neonatal cultures. Increase of Hb A synthesis in presence of an erythroid potentiating activity (EPA) (1982) (4)
- A Monoclonal Antibody Against Migration Inhibitory Factor (MIF) Obtained by Immunization With MIF From the Human Lymphoblast Cell Line Mo (1986) (4)
- THE THIRD INTERNATIONAL WORKSHOP ON HAIRY CELL LEUKEMIA, LAGUNA NIGUEL, CALIFORNIA, 19–20 OCTOBER 1989 (1990) (4)
- Growth hormone stimulates drug-induced porphyrin formation in liver cells maintained in a serum-free medium. (1981) (4)
- Beta 2 receptor-mediated stimulation of Friend erythroleukemia cell growth by thyroid hormones. (1981) (4)
- Metabolism and Functions of Monocytes and Macrophages (1977) (3)
- Deoxyribonuclease-Positive Staphylococcus epidermidis Strains (1970) (3)
- Hematopoietic growth factors--an overview. (1990) (3)
- Antibody lysis of human hematopoietic cells in the absence of complement and effector cells. (1982) (3)
- Toxicity and bone marrow response of patients with hairy cell leukemia treated with biosynthetic (recombinant) α-2-interferon (2004) (3)
- HUMAN PULMONARY MACROPHAGES IN DISEASE AND NEOPLASIA (1976) (3)
- T cell-derived migration-inhibitory factor and colony-stimulating factor share common structural elements. (1986) (3)
- Separation By Velocity Sedimentation of Human Haemopoietic Precursors Forming Colonies in vivo and in vitro Cultures (1985) (2)
- Enhancement of human myeloid stem cell growth in vitro. (1983) (2)
- Biological activities of human granulocyte-macrophage colony-stimulating factor. (1985) (2)
- Disorders of mononuclear phagocyte proliferation, maturation and function. (1975) (2)
- The colony-stimulating factors and molecular transport. (1994) (2)
- via the glucose transporters and accumulate reduced ascorbic acid Human HL-60 myeloid leukemia cells transport dehydroascorbic acid (2011) (2)
- Production of gamma (immune) interferon by a permanent human T-lymphocyte cell line. (1984) (2)
- Recent advances in leukemia and lymphoma : proceedings of a Schering Corporation-UCLA Symposium held in Keystone, Colorado, January 25-31, 1987 (1987) (2)
- Structure and function of the human T-cell leukemia virus II genome (1986) (2)
- Mechanisms of action and therapeutic applications of biologicals in cancer and immune deficiency disorders : proceedings of a Hoffmann-La Roche-Smith Kline & French-UCLA symposium, held at Keystone, Colorado, April 23-30, 1988 (1989) (2)
- Growth Factors in the Treatment of HIV Disease (1996) (2)
- IGF-I does not mediate T-lymphoblast colony formation in response to estradiol, testosterone, 1,25(OH)2 vitamin D3, and triiodothyronine: studies in control and pygmy T-cell lines. (1996) (1)
- Membrane events regulating differentiation and terminal cell division72. GM-CSF directly induces neutrophil platelet activating factor (PAF) and leukotriene B4 (LTB4) synthesis: activation of the lysoPAF acetyltransferase through a tyrosine ki-nase-dependent signaling cascade (1992) (1)
- Hematopoietic stem cells (1985) (1)
- Humoral stimulation of hemopoietic progenitors from human fetal liver. (1982) (1)
- lymphoproliferative disorders cell patient with "atypical" hairy cell leukemia: evidence for distinct T and B Integrated human T-cell leukemia virus II genome in CD8 + T cells from a (2011) (1)
- Modulation of Graft-versus-Host (GvH) Disease in the Rat; Effect of Hydroxyurea on the Mixed Lymphocyte Reaction and Graft-versus-Host Reactivity (1977) (1)
- Hormonal responsiveness of two human acute myelogenous leukemia cell lines (1979) (1)
- Cell line ownership (1990) (1)
- Leukocytic differentiation in friend leukemia induced by colony- -stimulating activity. Abstr. (1975) (1)
- INSULIN RESISTANCE (IR) IN TURNER SYNDROME (TS): DETECTION BY DIMINISHED IN VITRO RESPONSE OF ERYTHROCYTE PROGENITOR CELLS (EPC) TO INSULIN (1984) (1)
- [Hematopoietic stem cells and their growth factors]. (1983) (1)
- Introduction (0)
- HIV INFECTION OF MYELOID LEUKEMIA CELL LINES 1981 Table 1 . Effect of Differentiating Agents on HIV-1 Production in Human Leukemic Cell Lines HIV-1 Production * in the Supernatants After Treatment With Cell Lines Control (2003) (0)
- Impaired response of neutrophils to a lymphokine by sera from patients with connective tissue disease (1983) (0)
- Commercial development of human cell lines--property, ethics, and conflict of interest. (1991) (0)
- Vitamin C Is a Kinase Inhibitor: Dehydroascorbic Acid Inhibits I (cid:2) B (cid:3) Kinase (cid:4) (2004) (0)
- Subject Index Vol. 46, 2009 (2009) (0)
- IGF-II Mediates Mitogenic Signaling in IGF-I-Resistant Efe Pygmy T-Cell Lines• 424 (1998) (0)
- Highlights of the 25th Conference of the European Society for Microcirculation (2009) (0)
- 1984 referees (2007) (0)
- Perturbation of DNA synthesis in multiple myeloma (MM) cells following cell cycle nonspecific (CCNS) chemotherapy (1974) (0)
- Leukemia : recent advances in biology and treatment : proceedings of a UCLA Symposium held in Keystone, Colorado, January 27-February 2, 1985 (1985) (0)
- A Human Sodium-Dependent Vitamin C Transporter 2 Isoform Acts as a Dominant-Negative Inhibitor of Ascorbic Acid Transport (2004) (0)
- Leukemia: Recent advances in biology and treatment (1985) (0)
- (see comments) immunodeficiency virus type 1 infection in bone marrow stem cells Macrophage-active colony-stimulating factors enhance human (2011) (0)
- Human Leukemia Cell Line K 562 Responds 300 Blood (2005) (0)
- Contents Vol. 46, 2009 (2009) (0)
- Human Alveolar Macrophages Express Ia (2005) (0)
- Human Alveolar Macrophages Express (2005) (0)
- Hematopoiesis : proceedings of a UCLA Symposium held at Tamarron, Colorado, February 20-26, 1989 (1990) (0)
- Letter: Hairy cell leukemia: in-vitro culture studies. (1976) (0)
- In Vitro Study of the Independent and Combined Effects of Recombinant Human GM-CSF and G-CSF on Normal Bone Marrow Granulocytes : GM-CSF Enhances the Growth Effect but Suppresses the Terminal Maturation-inducing Effect of G-CSF (1990) (0)
- GAG GAC AGTTGAACAGGAGGG CT T CACTCCTTAGAGGTGTCAG TGACCACAGCACTCCAGG GTTTTGTAC CAGTGAGCCC TGGGC ATTGATTGTACTGTC TGSTCAT T CAG CAA TGACAC V V 1441 AGCT GTCTCCCCATCTTCTTATGC TGAG T GCCTCTCT TT GTCATATT TT CCTAGAGCCCCCCATGCTGC TGACTTCT GACAGACT CTGAC C CCCTT TCAGATAATGAG GGTGC TGAGA (1996) (0)
- 1986 Referees (2007) (0)
- Long-Term Human Bone Marrow Cultures 118 Blood (2005) (0)
- Medical Oncology Training in the Cancer Center1 (1973) (0)
- Poliovirus antigenic sites and vaccines/A vailability of Mo and HTLV-II/Limitations of physical theory/Interstitial fluid (1984) (0)
- Early Signaling by Vascular Endothelial Growth Factor and Placental Growth Factor in Human Bone Marrow-Derived Endothelial Cells Is Mediated by Superoxide (2009) (0)
- Cellular interactions in the control of granulopoiesis. (1975) (0)
- GH PREINCUBATION FAILS TO INDUCE RESISTANCE TO THE MITOGCNIC ACTION OF INSULIN IN A PYGMY T-CELL LINE (1993) (0)
- cultured human melanoma cells macrophage colony-stimulating factor receptor on primary and Identification and characterization of a low-affinity granulocyte (2003) (0)
- antithymocyte globulin factor in aplastic anemia: possible mechanisms of action of In vitro production of granulocyte-macrophage colony-stimulating (2011) (0)
- Transport and Cell Function (2000) (0)
- 1984 UNIQUET-LYMPHOCYTE LINE AND PRODUCTS DERIVED THEREFROM Inventors : (2017) (0)
- Subnuclear Localization ofthetrans-Activating Protein ofHumanT-Cell Leukemia Virus TypeI (1988) (0)
- immunodeficient mice: electron microscopy and cytochemistry Proliferation and differentiation of human myeloid leukemic cells in (2011) (0)
- IGF-I DOES NOT MEDIATE T-LYMPHOBLAST COLONY PROLIFERATION IN RESPONSE TO STEROID AND THYROID HORMONES: STUDIES IN CONTROL AND PYGMY T-CELL LINES.• 518 (1996) (0)
- Advances in Brief Response of Prostate Cancer to Anti-Her-2 / neu Antibody in Androgen-dependent and-independent Human Xenograft Models 1 (1999) (0)
- 707 Penetration of the Blood-Brain-Barrier by Oxidized Vitamin C Improves Outcome in Both Reperfused and Non-Reperfused Stroke (2000) (0)
- Human T-cell leukemia virus x gene. (1985) (0)
- HumoralModulationof Human Acute MyelogenousLeukemia Cell Growth in (1980) (0)
- tyrosine phosphoprotein in chronic myelogenous leukemia cells Identification of CRKL as the constitutively phosphorylated 39-kD (2011) (0)
- HTLV-II and Human Leukemia (1985) (0)
- Chronic Myelogenous Leukemia Cell Growth and Maturation in Liquid Culture1 (2006) (0)
- Medical aid to honduras. (1966) (0)
- α B κ Dehydroascorbic Acid Inhibits I (2014) (0)
- GranulocyticStem Cells in Friend Leukemi (1976) (0)
- macrophage colony-stimulating factor receptor on primary rat Identification and characterization of a high-affinity granulocyte- (2011) (0)
- Potential role of granulocyte-macrophage colony stimulating factor in patients with HIV infection. (1988) (0)
- 9th International Symposium on Resistance Arteries (ISRA) (2009) (0)
- (transformation in vitro/ erythropoietin/spleen focus-forming vir (2016) (0)
- Correction of cyclic neutropenia (1974) (0)
- Special feature Third International Lymphokine Workshop: Interleukins, Lymphokines, and Cytokines Haverford, Pennsylvania, August 1–5, 1982 Session VII: Effector lymphokines (including interferon)Production of second-day PH 5-MIF by a human T-lymphoblast cell line☆☆☆ (1982) (0)
- Availability of Mo and HTLV-II (1984) (0)
- Effects of recombinant human granulocyte-macrophage colony-stimulating factor as treatment for aplastic anemia and agranulocytosis. (1990) (0)
- of Colony-Stimulating Activity (2017) (0)
- Myelogenous Leukemia Lines Glucocorticoid Sensitivity and Receptors in Cells of Human (2013) (0)
- GAMMA (IMMUNE) INTERFERON PRODUCTION BY A PERMANENT HUMAN T-LYMPHOCYTE CELL LINE (1982) (0)
- THE EFFECT OF PLASMA WITH COLONY SIMULATING ACTIVITY (CSA) IN CYCLIC NEUTROPENIA (CN) (1974) (0)
- Leukemia 1985. Abstracts (1985) (0)
- Human Host Defense Cells Colony-Stimulating Factors Signal for Increased Transport of Vitamin C in (2013) (0)
- Compositions htlv-iinra et epreuves pour la detection de l'infection par htlv (1994) (0)
- Bone-marrow transplantation in acute leukaemia. (1977) (0)
- Positron Emission Tomography of a Human Prostate Cancer Xenograft : Association of Changes in Deoxyglucose Accumulation with Other Measures of Outcome following Androgen Withdrawal 1 (2006) (0)
- Normal and neoplastic hematopoiesis : proceedings of the UCLA symposium held at Steamboat Springs, Colorado, March 27-April 1, 1983 (1983) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With David W. Golde?
David W. Golde is affiliated with the following schools:
