Daniel G Anderson
#121,665
Most Influential Person Now
Researcher
Daniel G Anderson's AcademicInfluence.com Rankings
Daniel G Andersonchemistry Degrees
Chemistry
#2632
World Rank
#3564
Historical Rank
Chemical Engineering
#260
World Rank
#274
Historical Rank

Daniel G Andersonengineering Degrees
Engineering
#3860
World Rank
#4995
Historical Rank
Biomedical Engineering
#207
World Rank
#214
Historical Rank
Applied Physics
#815
World Rank
#837
Historical Rank

Download Badge
Chemistry Engineering
Daniel G Anderson's Degrees
- Masters Chemical Engineering Stanford University
Why Is Daniel G Anderson Influential?
(Suggest an Edit or Addition)Daniel G Anderson's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Non-viral vectors for gene-based therapy (2014) (2318)
- Knocking down barriers: advances in siRNA delivery (2009) (2169)
- Physical and mechanical properties of PLA, and their functions in widespread applications - A comprehensive review. (2016) (1586)
- CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling (2014) (1395)
- Delivery materials for siRNA therapeutics. (2013) (1382)
- A combinatorial library of lipid-like materials for delivery of RNAi therapeutics (2008) (1026)
- Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype (2014) (841)
- Molecularly Self-Assembled Nucleic Acid Nanoparticles for Targeted In Vivo siRNA Delivery (2012) (820)
- Lipid-like materials for low-dose, in vivo gene silencing (2010) (746)
- Nanoliter-scale synthesis of arrayed biomaterials and application to human embryonic stem cells (2004) (729)
- Therapeutic siRNA silencing in inflammatory monocytes (2011) (724)
- Therapeutic genome editing by combined viral and non-viral delivery of CRISPR system components in vivo (2016) (692)
- CRISPR-mediated direct mutation of cancer genes in the mouse liver (2014) (636)
- Bio-Inspired Polymer Composite Actuator and Generator Driven by Water Gradients (2013) (636)
- Therapeutic RNAi targeting PCSK9 acutely lowers plasma cholesterol in rodents and LDL cholesterol in nonhuman primates (2008) (615)
- Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling (2013) (595)
- Size- and shape-dependent foreign body immune response to materials implanted in rodents and non-human primates (2015) (586)
- Origins of tumor-associated macrophages and neutrophils (2012) (546)
- Combinatorial Development of Biomaterials for Clonal Growth of Human Pluripotent Stem Cells (2010) (503)
- Preparation of monodisperse biodegradable polymer microparticles using a microfluidic flow-focusing device for controlled drug delivery. (2009) (495)
- Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery. (2019) (484)
- In vivo endothelial siRNA delivery using polymeric nanoparticles with low molecular weight. (2014) (450)
- Advances in the delivery of RNA therapeutics: from concept to clinical reality (2017) (444)
- Long term Glycemic Control Using Polymer Encapsulated, Human Stem-Cell Derived β-cells in Immune Competent mice (2016) (441)
- Semi-automated synthesis and screening of a large library of degradable cationic polymers for gene delivery. (2003) (430)
- Lipid Nanoparticle Assisted mRNA Delivery for Potent Cancer Immunotherapy. (2017) (389)
- Injectable nano-network for glucose-mediated insulin delivery. (2013) (366)
- Degradable Lipid Nanoparticles with Predictable In Vivo siRNA Delivery Activity (2014) (366)
- A vector-free microfluidic platform for intracellular delivery (2013) (364)
- Delivery technologies for genome editing (2017) (363)
- Injectable Self‐Healing Glucose‐Responsive Hydrogels with pH‐Regulated Mechanical Properties (2015) (363)
- Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in Vivo with Fractional Factorial and Definitive Screening Designs. (2015) (360)
- Combinatorial hydrogel library enables identification of materials that mitigate the foreign body response in primates (2016) (346)
- A combinatorial polymer library approach yields insight into nonviral gene delivery. (2008) (332)
- The Translocating RecBCD Enzyme Stimulates Recombination by Directing RecA Protein onto ssDNA in a χ-Regulated Manner (1997) (323)
- Glucose-responsive microgels integrated with enzyme nanocapsules for closed-loop insulin delivery. (2013) (319)
- Combinatorial discovery of polymers resistant to bacterial attachment (2012) (312)
- Lipopeptide nanoparticles for potent and selective siRNA delivery in rodents and nonhuman primates (2014) (310)
- Development of lipidoid-siRNA formulations for systemic delivery to the liver. (2009) (308)
- Parallel synthesis and biophysical characterization of a degradable polymer library for gene delivery. (2003) (301)
- Structure-guided chemical modification of guide RNA enables potent non-viral in vivo genome editing (2017) (288)
- Structure/property studies of polymeric gene delivery using a library of poly(β-amino esters). (2005) (287)
- Genetic engineering of human stem cells for enhanced angiogenesis using biodegradable polymeric nanoparticles (2009) (281)
- Dendrimer-RNA nanoparticles generate protective immunity against lethal Ebola, H1N1 influenza, and Toxoplasma gondii challenges with a single dose (2016) (279)
- Adenovirus-Mediated Somatic Genome Editing of Pten by CRISPR/Cas9 in Mouse Liver in Spite of Cas9-Specific Immune Responses. (2015) (274)
- Engineering circular RNA for potent and stable translation in eukaryotic cells (2018) (274)
- Proliferation and Recruitment Contribute to Myocardial Macrophage Expansion in Chronic Heart Failure. (2016) (269)
- FGF regulates TGF-β signaling and endothelial-to-mesenchymal transition via control of let-7 miRNA expression. (2012) (258)
- Materials for non-viral intracellular delivery of messenger RNA therapeutics. (2016) (257)
- Biomaterial microarrays: rapid, microscale screening of polymer-cell interaction. (2005) (256)
- Delivery of mRNA vaccines with heterocyclic lipids increases anti-tumor efficacy by STING-mediated immune cell activation (2019) (252)
- A polymer library approach to suicide gene therapy for cancer. (2004) (248)
- Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation. (2012) (247)
- Polymeric Materials for Gene Delivery and DNA Vaccination (2009) (247)
- Monocyte-Directed RNAi Targeting CCR2 Improves Infarct Healing in Atherosclerosis-Prone Mice (2013) (241)
- Action and reaction: the biological response to siRNA and its delivery vehicles. (2012) (239)
- Accelerating the Translation of Nanomaterials in Biomedicine. (2015) (235)
- Gold, poly(beta-amino ester) nanoparticles for small interfering RNA delivery. (2009) (231)
- Sustained antigen availability during germinal center initiation enhances antibody responses to vaccination (2016) (227)
- Poly-beta amino ester-containing microparticles enhance the activity of nonviral genetic vaccines. (2004) (225)
- Strategies, design, and chemistry in siRNA delivery systems. (2019) (220)
- In vivo silencing of the transcription factor IRF5 reprograms the macrophage phenotype and improves infarct healing. (2013) (218)
- High throughput methods applied in biomaterial development and discovery. (2010) (211)
- BCL2A1 is a lineage-specific antiapoptotic melanoma oncogene that confers resistance to BRAF inhibition (2013) (207)
- Small RNA combination therapy for lung cancer (2014) (203)
- Alginate encapsulation as long-term immune protection of allogeneic pancreatic islet cells transplanted into the omental bursa of macaques (2018) (194)
- Islets transplanted in immunoisolation devices: a review of the progress and the challenges that remain. (2011) (193)
- Lipidoid-coated iron oxide nanoparticles for efficient DNA and siRNA delivery. (2013) (191)
- In vivo compatibility of graphene oxide with differing oxidation states. (2015) (186)
- Synthesis of poly(beta-amino ester)s with thiol-reactive side chains for DNA delivery. (2006) (186)
- Polymer-Lipid Nanoparticles for Systemic Delivery of mRNA to the Lungs. (2016) (183)
- Nanoparticles targeting the infarcted heart. (2011) (177)
- Silencing or stimulation? siRNA delivery and the immune system. (2011) (175)
- Combinatorial synthesis of chemically diverse core-shell nanoparticles for intracellular delivery (2011) (175)
- Colony Stimulating Factor-1 Receptor is a central component of the foreign body response to biomaterial implants in rodents and non-human primates (2017) (171)
- Glucose-responsive insulin activity by covalent modification with aliphatic phenylboronic acid conjugates (2015) (169)
- Effective RNAi-mediated gene silencing without interruption of the endogenous microRNA pathway (2007) (163)
- CRISPR/Cas9-mediated genome editing induces exon skipping by alternative splicing or exon deletion (2017) (162)
- An elastic second skin. (2016) (159)
- Partial DNA-guided Cas9 enables genome editing with reduced off-target activity. (2018) (158)
- RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo. (2019) (153)
- Materials for stem cell factories of the future. (2014) (153)
- Inhaled Nanoformulated mRNA Polyplexes for Protein Production in Lung Epithelium (2019) (150)
- Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions (2011) (148)
- Polymeric Nanoparticle PET/MR Imaging Allows Macrophage Detection in Atherosclerotic Plaques (2013) (147)
- RNAi targeting multiple cell adhesion molecules reduces immune cell recruitment and vascular inflammation after myocardial infarction (2016) (146)
- Biodegradable polymeric vectors for gene delivery to human endothelial cells. (2006) (142)
- Macrophages retain hematopoietic stem cells in the spleen via VCAM-1 (2015) (140)
- Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery (2016) (138)
- Heme oxygenase-1 is an anti-inflammatory host factor that promotes murine plasmodium liver infection. (2008) (137)
- The influence of scaffold elasticity on germ layer specification of human embryonic stem cells. (2011) (133)
- An injectable thiol-acrylate poly(ethylene glycol) hydrogel for sustained release of methylprednisolone sodium succinate. (2011) (133)
- Direct patterning of mammalian cells onto porous tissue engineering substrates using agarose stamps. (2005) (131)
- Supramolecular PEGylation of biopharmaceuticals (2016) (129)
- Barcoded nanoparticles for high throughput in vivo discovery of targeted therapeutics (2017) (129)
- Tissue-specific gene delivery via nanoparticle coating. (2010) (128)
- Nanoparticulate cellular patches for cell-mediated tumoritropic delivery. (2010) (128)
- Claudin-3 gene silencing with siRNA suppresses ovarian tumor growth and metastasis (2009) (126)
- Efficacy and immunogenicity of unmodified and pseudouridine-modified mRNA delivered systemically with lipid nanoparticles in vivo. (2016) (123)
- Materials for Diabetes Therapeutics (2012) (123)
- Effect of molecular weight of amine end-modified poly(β-amino ester)s on gene delivery efficiency and toxicity. (2012) (122)
- High-throughput membrane surface modification to control NOM fouling. (2009) (117)
- Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells (2012) (116)
- Synthesis and Biological Evaluation of Ionizable Lipid Materials for the In Vivo Delivery of Messenger RNA to B Lymphocytes (2017) (115)
- Microneedles for drug delivery via the gastrointestinal tract. (2015) (114)
- Electrostatic ligand coatings of nanoparticles enable ligand-specific gene delivery to human primary cells. (2007) (114)
- Multiparametric approach for the evaluation of lipid nanoparticles for siRNA delivery (2013) (114)
- An RNA nanoparticle vaccine against Zika virus elicits antibody and CD8+ T cell responses in a mouse model (2017) (113)
- Localized Delivery of Dexamethasone from Electrospun Fibers Reduces the Foreign Body Response (2012) (112)
- Painting blood vessels and atherosclerotic plaques with an adhesive drug depot (2012) (112)
- Ly6Clo monocytes drive immunosuppression and confer resistance to anti-VEGFR2 cancer therapy (2017) (112)
- Genetic and hypoxic alterations of the microRNA-210-ISCU1/2 axis promote iron–sulfur deficiency and pulmonary hypertension (2015) (111)
- Small‐Molecule End‐Groups of Linear Polymer Determine Cell‐type Gene‐Delivery Efficacy (2009) (110)
- DNA-controlled assembly of a NaTl lattice structure from gold nanoparticles and protein nanoparticles. (2010) (109)
- Endothelial TGF-β signalling drives vascular inflammation and atherosclerosis (2019) (108)
- Comprehensive proteomic characterization of stem cell-derived extracellular matrices. (2017) (107)
- Real-time in vivo detection of biomaterial-induced reactive oxygen species. (2011) (106)
- Nanoparticles for gene transfer to human embryonic stem cell colonies. (2008) (106)
- CRISPR–Cas: a tool for cancer research and therapeutics (2019) (105)
- Reduction of measurement noise in a continuous glucose monitor by coating the sensor with a zwitterionic polymer (2018) (104)
- Rapid Optimization of Gene Delivery by Parallel End-modification of Poly(β-amino ester)s. (2007) (104)
- Degradable Terpolymers with Alkyl Side Chains Demonstrate Enhanced Gene Delivery Potency and Nanoparticle Stability (2013) (103)
- Structure/property studies of polymeric gene delivery using a library of poly(beta-amino esters). (2005) (102)
- Remotely activated protein-producing nanoparticles. (2012) (100)
- Electrospun drug-eluting sutures for local anesthesia. (2012) (99)
- Adenine base editing in an adult mouse model of tyrosinemia (2019) (98)
- Optimization of a Degradable Polymer-Lipid Nanoparticle for Potent Systemic Delivery of mRNA to the Lung Endothelium and Immune Cells. (2018) (97)
- Biomanufacturing for clinically advanced cell therapies (2018) (97)
- Injectable and Glucose-Responsive Hydrogels Based on Boronic Acid-Glucose Complexation. (2016) (97)
- Synergistic lipid compositions for albumin receptor mediated delivery of mRNA to the liver (2020) (97)
- Multiplexed RNAi therapy against brain tumor-initiating cells via lipopolymeric nanoparticle infusion delays glioblastoma progression (2017) (95)
- Nanoparticle-delivered suicide gene therapy effectively reduces ovarian tumor burden in mice. (2009) (94)
- Dendrimer-Inspired Nanomaterials for the in Vivo Delivery of siRNA to Lung Vasculature. (2014) (93)
- Silencing of CCR2 in myocarditis. (2015) (92)
- In vitro-in vivo translation of lipid nanoparticles for hepatocellular siRNA delivery. (2012) (92)
- Lipid-derived nanoparticles for immunostimulatory RNA adjuvant delivery (2012) (91)
- Polymer surface functionalities that control human embryoid body cell adhesion revealed by high throughput surface characterization of combinatorial material microarrays. (2010) (91)
- Precision cancer mouse models through genome editing with CRISPR-Cas9 (2015) (89)
- Uremic Toxin Indoxyl Sulfate Promotes Proinflammatory Macrophage Activation Via the Interplay of OATP2B1 and Dll4-Notch Signaling: Potential Mechanism for Accelerated Atherogenesis in Chronic Kidney Disease (2019) (89)
- Poly(glycoamidoamine) Brushes Formulated Nanomaterials for Systemic siRNA and mRNA Delivery in Vivo. (2016) (88)
- Enhanced function of immuno-isolated islets in diabetes therapy by co-encapsulation with an anti-inflammatory drug. (2013) (87)
- Discovery of Novel Materials with Broad Resistance to Bacterial Attachment Using Combinatorial Polymer Microarrays (2013) (86)
- The clinical progress of mRNA vaccines and immunotherapies (2022) (85)
- Genome-Wide CRISPR Screen Identifies Regulators of Mitogen-Activated Protein Kinase as Suppressors of Liver Tumors in Mice. (2017) (85)
- Glucose-responsive insulin by molecular and physical design (2017) (83)
- Combinatorial extracellular matrices for human embryonic stem cell differentiation in 3D. (2010) (81)
- Ultrasound-mediated gastrointestinal drug delivery (2015) (80)
- Locally Delivered Growth Factor Enhances the Angiogenic Efficacy of Adipose‐Derived Stromal Cells Transplanted to Ischemic Limbs (2009) (79)
- Stem cell membrane engineering for cell rolling using peptide conjugation and tuning of cell-selectin interaction kinetics. (2012) (77)
- Nanoparticle-Delivered Multimeric Soluble CD40L DNA Combined with Toll-Like Receptor Agonists as a Treatment for Melanoma (2009) (76)
- Neutrophil Responses to Sterile Implant Materials (2015) (76)
- Cell-Cycle-Targeting MicroRNAs as Therapeutic Tools against Refractory Cancers. (2017) (76)
- Reduction of the therapeutic dose of silencing RNA by packaging it in extracellular vesicles via a pre-microRNA backbone (2020) (76)
- Combinatorial approach to determine functional group effects on lipidoid-mediated siRNA delivery. (2010) (74)
- Five years of siRNA delivery: spotlight on gold nanoparticles. (2011) (74)
- Nanoparticle-formulated siRNA targeting integrins inhibits hepatocellular carcinoma progression in mice (2014) (73)
- Glucose-Responsive Nanoparticles for Rapid and Extended Self-Regulated Insulin Delivery. (2019) (72)
- Myocardial Delivery of Lipidoid Nanoparticle Carrying modRNA Induces Rapid and Transient Expression. (2016) (72)
- mRNA Delivery for Therapeutic Anti-HER2 Antibody Expression In Vivo. (2019) (72)
- Long-Term Implant Fibrosis Prevention in Rodents and Non-Human Primates Using Localized Deliverable Crystals (2019) (71)
- Interaction between integrin α5 and PDE4D regulates endothelial inflammatory signalling (2016) (71)
- Correction: Corrigendum: Long-term glycemic control using polymer-encapsulated human stem cell–derived beta cells in immune-competent mice (2016) (70)
- Discovery of a Novel Polymer for Human Pluripotent Stem Cell Expansion and Multilineage Differentiation (2015) (69)
- Engineered PLGA microparticles for long-term, pulsatile release of STING agonist for cancer immunotherapy (2020) (69)
- Synthesis of poly(beta-amino ester)s optimized for highly effective gene delivery. (2003) (68)
- Knockdown and knockout of β1-integrin in hepatocytes impairs liver regeneration through inhibition of growth factor signalling (2014) (68)
- Lipid‐Like Nanoparticles for Small Interfering RNA Delivery to Endothelial Cells (2009) (68)
- Facile synthetic route for surface-functionalized magnetic nanoparticles: cell labeling and magnetic resonance imaging studies. (2011) (66)
- Electrostatic surface modifications to improve gene delivery (2010) (66)
- Microfluidic Fabrication of Colloidal Nanomaterials-Encapsulated Microcapsules for Biomolecular Sensing. (2017) (66)
- Ionizable amphiphilic dendrimer-based nanomaterials with alkyl-chain-substituted amines for tunable siRNA delivery to the liver endothelium in vivo. (2014) (64)
- Combinatorial library of lipidoids for in vitro DNA delivery. (2012) (61)
- FRET-labeled siRNA probes for tracking assembly and disassembly of siRNA nanocomplexes. (2012) (61)
- Endothelial siRNA delivery in nonhuman primates using ionizable low–molecular weight polymeric nanoparticles (2018) (61)
- Synergistic silencing: combinations of lipid-like materials for efficacious siRNA delivery. (2011) (60)
- Ionizable Amino‐Polyesters Synthesized via Ring Opening Polymerization of Tertiary Amino‐Alcohols for Tissue Selective mRNA Delivery (2018) (60)
- Rapid Biocompatibility Analysis of Materials via In Vivo Fluorescence Imaging of Mouse Models (2010) (59)
- Nanomechanical control of cell rolling in two dimensions through surface patterning of receptors. (2008) (59)
- pH-Triggered Microparticles for Peptide Vaccination1 (2004) (58)
- High throughput discovery of new fouling-resistant surfaces. (2011) (58)
- Reconstitution of an SOS Response Pathway Derepression of Transcription in Response to DNA Breaks (1998) (57)
- Smart approaches to glucose-responsive drug delivery (2015) (55)
- Report of the Key Opinion Leaders Meeting on Stem Cell-derived Beta Cells. (2018) (54)
- MicroRNA regulation of endothelial TREX1 reprograms the tumour microenvironment (2016) (54)
- The NIH Somatic Cell Genome Editing program (2021) (53)
- Chondrogenic Priming Adipose-Mesenchymal Stem Cells for Cartilage Tissue Regeneration (2011) (53)
- Lipid‐Like Nanomaterials for Simultaneous Gene Expression and Silencing In Vivo (2014) (53)
- Bacterial Attachment to Polymeric Materials Correlates with Molecular Flexibility and Hydrophilicity (2014) (52)
- Dendrimeric siRNA for Efficient Gene Silencing. (2015) (52)
- Photo-response behavior of electrospun nanofibers based on spiropyran-cyclodextrin modified polymer. (2010) (52)
- Chemical modifications of adenine base editor mRNA and guide RNA expand its application scope (2020) (51)
- A versatile reporter system for CRISPR-mediated chromosomal rearrangements (2015) (51)
- A retrievable implant for the long-term encapsulation and survival of therapeutic xenogeneic cells (2020) (51)
- Biomaterials for Personalized Cell Therapy (2019) (51)
- A Stiff Injectable Biodegradable Elastomer (2013) (48)
- Beta-amino ester polymers facilitate in vivo DNA transfection and adjuvant plasmid DNA immunization. (2005) (48)
- Directing human embryonic stem cell differentiation by non-viral delivery of siRNA in 3D culture. (2011) (48)
- A defined synthetic substrate for serum-free culture of human stem cell derived cardiomyocytes with improved functional maturity identified using combinatorial materials microarrays (2015) (48)
- Corrigendum: Long-term glycemic control using polymer-encapsulated human stem cell–derived beta cells in immune-competent mice (2016) (48)
- YY1 Regulates Melanocyte Development and Function by Cooperating with MITF (2012) (48)
- Sequence-Defined Oligomers from Hydroxyproline Building Blocks for Parallel Synthesis Applications. (2016) (47)
- Surface tension-assisted additive manufacturing (2018) (45)
- Customizable Lipid Nanoparticle Materials for the Delivery of siRNAs and mRNAs. (2018) (45)
- Alkane-modified short polyethyleneimine for siRNA delivery. (2011) (45)
- Rational design of a biomimetic cell penetrating peptide library. (2013) (44)
- A Facile and Versatile Method to Endow Biomaterial Devices with Zwitterionic Surface Coatings (2017) (44)
- Nanoparticle-encapsulated siRNAs for gene silencing in the haematopoietic stem-cell niche (2020) (43)
- Endothelial miR-30c suppresses tumor growth via inhibition of TGF-&bgr;–induced Serpine1 (2019) (42)
- Spatiotemporal effects of a controlled-release anti-inflammatory drug on the cellular dynamics of host response. (2011) (42)
- Ex Vivo Cytosolic Delivery of Functional Macromolecules to Immune Cells (2015) (42)
- Modelling human embryoid body cell adhesion to a combinatorial library of polymer surfaces. (2012) (41)
- A Novel Family of Biodegradable Poly(ester amide) Elastomers (2011) (41)
- Spatial Control of Gene Expression by Nanocarriers Using Heparin Masking and Ultrasound-Targeted Microbubble Destruction. (2016) (40)
- Loss of α-catenin elicits a cholestatic response and impairs liver regeneration (2014) (40)
- Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells (2013) (40)
- Macrophage Notch Ligand Delta-Like 4 Promotes Vein Graft Lesion Development: Implications for the Treatment of Vein Graft Failure. (2015) (40)
- Rapid, Single-Cell Analysis and Discovery of Vectored mRNA Transfection In Vivo with a loxP-Flanked tdTomato Reporter Mouse (2017) (40)
- Poly(β‐amino ester)‐co‐poly(caprolactone) Terpolymers as Nonviral Vectors for mRNA Delivery In Vitro and In Vivo (2018) (39)
- Rapid optimization of gene delivery by parallel end-modification of poly(beta-amino ester)s. (2007) (39)
- Therapeutic angiogenesis using genetically engineered human endothelial cells. (2012) (37)
- Delivery of Tissue-Targeted Scalpels: Opportunities and Challenges for In Vivo CRISPR/Cas-Based Genome Editing. (2020) (37)
- Prediction of Broad-Spectrum Pathogen Attachment to Coating Materials for Biomedical Devices. (2018) (37)
- BOLA (BolA Family Member 3) Deficiency Controls Endothelial Metabolism and Glycine Homeostasis in Pulmonary Hypertension (2019) (37)
- Ultrasound-Mediated Delivery of RNA to Colonic Mucosa of Live Mice. (2017) (36)
- High throughput surface characterization: A review of a new tool for screening prospective biomedical material arrays (2010) (36)
- Melanin‐like Hydrogels Derived from Gallic Macromers (2012) (36)
- MicroRNA 139-5p coordinates APLNR-CXCR4 crosstalk during vascular maturation (2015) (36)
- Therapeutic effect of orally administered microencapsulated oxaliplatin for colorectal cancer. (2012) (35)
- High throughput screening for biomaterials discovery. (2014) (34)
- Nanotechnology for in vivo targeted siRNA delivery. (2014) (34)
- High throughput optimization of stem cell microenvironments. (2009) (34)
- Knocking down barriers: advances in siRNA delivery (2010) (34)
- Automated ARGET ATRP Accelerates Catalyst Optimization for the Synthesis of Thiol-Functionalized Polymers. (2012) (34)
- Stem Cell Factor Gene Transfer Improves Cardiac Function After Myocardial Infarction in Swine (2012) (33)
- Cell-compatible, multicomponent protein arrays with subcellular feature resolution. (2008) (33)
- Drug Delivery–mediated Control of RNA Immunostimulation (2009) (33)
- Degradable polyelectrolyte multilayers that promote the release of siRNA. (2011) (32)
- Poly(beta-amino esters): procedures for synthesis and gene delivery. (2009) (30)
- S100A9-RAGE Axis Accelerates Formation of Macrophage-Mediated Extracellular Vesicle Microcalcification in Diabetes Mellitus (2020) (29)
- Systemic delivery of mRNA and DNA to the lung using polymer-lipid nanoparticles. (2021) (27)
- Niemann-Pick C1 Affects the Gene Delivery Efficacy of Degradable Polymeric Nanoparticles (2014) (27)
- Partial least squares regression as a powerful tool for investigating large combinatorial polymer libraries (2009) (27)
- Combinatorial synthesis with high throughput discovery of protein-resistant membrane surfaces. (2013) (26)
- Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing (2017) (25)
- Nucleic acid-mediated intracellular protein delivery by lipid-like nanoparticles. (2014) (25)
- MicroRNA regulation of the MRN complex impacts DNA damage, cellular senescence, and angiogenic signaling (2018) (24)
- Microfabrication of homogenous, asymmetric cell-laden hydrogel capsules. (2009) (24)
- Silencing the CSF-1 Axis Using Nanoparticle Encapsulated siRNA Mitigates Viral and Autoimmune Myocarditis (2018) (24)
- Gene delivery properties of end-modified poly(beta-amino ester)s. (2007) (23)
- A high throughput micro-array system of polymer surfaces for the manipulation of primary pancreatic islet cells. (2010) (23)
- Polymers with hydro-responsive topography identified using high throughput AFM of an acrylate microarray. (2011) (22)
- Degradable poly(amino alcohol esters) as potential DNA vectors with low cytotoxicity. (2003) (21)
- Assessing siRNA pharmacodynamics in a luciferase-expressing mouse. (2008) (21)
- Organ-targeted high-throughput in vivo biologics screen identifies materials for RNA delivery. (2014) (20)
- Frataxin deficiency promotes endothelial senescence in pulmonary hypertension. (2021) (20)
- Poly(β-amino ester)-DNA complexes: time-resolved fluorescence and cellular transfection studies. (2011) (19)
- Development of siRNA-probes for studying intracellular trafficking of siRNA nanoparticles. (2012) (19)
- Genome editing with Cas 9 in adult mice corrects a disease mutation and phenotype Citation (2014) (19)
- Polymer Microarrays for High Throughput Discovery of Biomaterials (2012) (18)
- A novel high-throughput cell-based method for integrated quantification of type I interferons and in vitro screening of immunostimulatory RNA drug delivery. (2009) (18)
- Analysis and prediction of defects in UV photo-initiated polymer microarrays (2012) (18)
- Nanoparticle delivery of suicide DNA for epithelial ovarian cancer therapy. (2008) (18)
- Inhibiting Integrin α5 Cytoplasmic Domain Signaling Reduces Atherosclerosis and Promotes Arteriogenesis (2018) (18)
- Microgel encapsulated nanoparticles for glucose-responsive insulin delivery. (2020) (18)
- pH-Triggered Microparticles for Peptide Vaccination (2004) (18)
- Simultaneous spatiotemporal tracking and oxygen sensing of transient implants in vivo using hot-spot MRI and machine learning (2019) (17)
- Rationally designed tumor-penetrating nanocomplexes. (2012) (16)
- Large-Scale Quantitative Proteomics Identifies the Ubiquitin Ligase Nedd4-1 as an Essential Regulator of Liver Regeneration. (2017) (15)
- Poly(Limonene Thioether) Scaffold for Tissue Engineering (2016) (15)
- High Throughput Layer-by-Layer Films for Extracting Film Forming Parameters and Modulating Film Interactions with Cells. (2016) (15)
- Minicells overcome tumor drug-resistance (2009) (15)
- Delivery of small interfering RNA for inhibition of endothelial cell apoptosis by hypoxia and serum deprivation. (2008) (14)
- Corrigendum: Combinatorial hydrogel library enables identification of materials that mitigate the foreign body response in primates (2016) (14)
- Ly 6 Clo monocytes drive immunosuppression and confer resistance to anti-VEGFR 2 cancer therapy (2019) (13)
- Splenic progenitors aid in maintaining high neutrophil numbers at sites of sterile chronic inflammation (2016) (13)
- Downregulation of the Arg/N-degron Pathway Sensitizes Cancer Cells to Chemotherapy In Vivo. (2020) (13)
- Magnetic Retrieval of Encapsulated Beta Cell Transplants from Diabetic Mice Using Dual‐Function MRI Visible and Retrievable Microcapsules (2020) (12)
- Lipidoid mRNA Nanoparticles for Myocardial Delivery in Rodents. (2017) (12)
- Flexible Multielectrode Array for Skeletal Muscle Conditioning, Acetylcholine Receptor Stabilization and Epimysial Recording After Critical Peripheral Nerve Injury (2019) (12)
- Silencing of CCR 2 in myocarditis (2015) (11)
- Engineered insulin-polycation complexes for glucose-responsive delivery with high insulin loading. (2021) (11)
- Abstract 2: Naked CanScript, an 18-base pair sequence, has tumor cell-specific promoter activity in vivo: Implications for targeted gene therapy (2010) (10)
- Systems Approach to Discovery of Therapeutic Targets for Vein Graft Disease (2021) (10)
- In Vivo RNAi-Mediated eIF3m Knockdown Affects Ribosome Biogenesis and Transcription but Has Limited Impact on mRNA-Specific Translation (2019) (10)
- DNA nanotherapy for pre-neoplastic cervical lesions. (2013) (10)
- Macrophage Notch Ligand Delta-Like 4 Promotes Vein Graft Lesion DevelopmentSignificance (2015) (9)
- Engineering synthetically modified insulin for glucose-responsive diabetes therapy (2015) (9)
- Chemical Tuning of Fibers Drawn from Extensible Hyaluronic Acid Networks. (2020) (9)
- Degradable Poly( bb -amino ester)s for Gene Delivery (2004) (8)
- Translation elongation factor 2 depletion by siRNA in mouse liver leads to mTOR-independent translational upregulation of ribosomal protein genes (2020) (8)
- RNAi-nanoparticulate manipulation of gene expression as a new functional genomics tool in the liver. (2016) (8)
- Corrigendum: Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype (2014) (7)
- Adenine base editing in an adult mouse model of tyrosinaemia (2019) (7)
- Thermally Switchable Polymers Achieve Controlled Escherichia coli Detachment (2014) (7)
- Cytosolic delivery of siRNA by ultra-high affinity dsRNA binding proteins (2017) (7)
- mRNA therapeutics: beyond vaccine applications. (2021) (7)
- Inside Front Cover: Combinatorial Modification of Degradable Polymers Enables Transfection of Human Cells Comparable to Adenovirus (Adv. Mater. 19/2007) (2007) (5)
- Identification of cell cycle-targeting microRNAs through genome-wide screens (2017) (5)
- Polyimide Electrode-Based Electrical Stimulation Impedes Early Stage Muscle Graft Regeneration (2019) (5)
- High-throughput methods for screening polymeric transfection reagents. (2013) (4)
- Selective targeting of MYC mRNA by stabilized antisense oligonucleotides (2021) (2)
- Chemical modifications of adenine base editor mRNA and guide RNA expand its application scope (2020) (2)
- An RNA nanoparticle vaccine against Zika virus elicits antibody and CD8+ T cell responses in a mouse model (2017) (2)
- Nanoscale delivery platforms for RNA therapeutics: Challenges and the current state of the art. (2022) (2)
- CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity (2010) (1)
- Advances in the delivery of RNA therapeutics: from concept to clinical reality (2017) (1)
- In Vivo RNA Delivery to Hematopoietic Stem and Progenitor Cells via Targeted Lipid Nanoparticles (2023) (1)
- Activation of the Unfolded Protein Response with the First-in-Class P97 Inhibitor CB-5083 Induces Stable Disease Regression and Overcomes Ara-C Resistance in AML (2015) (1)
- Conducting Polymers: Stretchable Polymeric Multielectrode Array for Conformal Neural Interfacing (Adv. Mater. 9/2014) (2014) (1)
- Corrigendum: Combinatorial discovery of polymers resistant to bacterial attachment (2014) (1)
- Abstract 130: Better Living Through Chemistry: A Novel Breast Implant Surface Coating Significantly Reduces Peri-Prosthetic Capsule Formation (2017) (0)
- Peptide-encoding mRNA barcodes for the high-throughput in vivo screening of libraries of lipid nanoparticles for mRNA delivery. (2023) (0)
- Erratum: Glucose-responsive insulin by molecular and physical design. (2017) (0)
- Author Correction: Colony stimulating factor-1 receptor is a central component of the foreign body response to biomaterial implants in rodents and non-human primates (2021) (0)
- Poly (beta-amino-esters) biodegradable and uses of the same. (2004) (0)
- INVESTIGATING THE EFFECTS OF ANTI-INFLAMMATORY DRUGS ON MATERIAL BIOCOMPATIBILITY BY IN VIVO FLUORESCENT IMAGING (2010) (0)
- Precision cancer mouse models through genome editing with CRISPR-Cas9 (2015) (0)
- Identification of a long non-coding RNA regulator of liver carcinoma cell survival (2020) (0)
- Systems Approach Identified PPARα as a Therapeutic Target for Vein Graft Disease: the Effects of the Specific Activator Pemafibrate on Macrophage Activation (2018) (0)
- Abstract: A Novel Breast Implant Surface Chemistry Significantly Reduces Acute and Chronic Peri-Prosthetic Capsule Formation in a Murine Model (2017) (0)
- Enhanced Angiogenesis for Tissue Regeneration using Human Stem Cells and Biodegradable Nanoparticulate Polymeric Vectors (2008) (0)
- Poly (beta-amino esters) and uses thereof. (2004) (0)
- AUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAUGAGCGU UCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAU CGGAUCGUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCC GUGUUGGGUGCCCUGUUCAUCGGUGUGGCUGUGGCCCCAGCUAAC GACAUCUACAACGAGCGCGAGCUGCUGAACAGCAUGGGCAUCAGCC AGCCCACCGUCGUAUUCGUGAGCAAGAAAGGGCUGCAAAAGAUCCU CAACGUGCAAAAGAAGCUAC (2016) (0)
- Ly6C[superscript lo] monocytes drive immunosuppression and confer resistance to anti-VEGFR2 cancer therapy (2019) (0)
- Synergistic lipid compositions for albumin receptor mediated delivery of mRNA to the liver (2020) (0)
- Liposome Mediated Delivery of siRNA to Hepatic Stellate Cells (2012) (0)
- DNA-controlled assembly of an NaTl lattice structure from gold and protein nanoparticles (2010) (0)
- Supplementary Material 17 (2014) (0)
- Reduction of the therapeutic dose of silencing RNA by packaging it in extracellular vesicles via a pre-microRNA backbone (2020) (0)
- Characterization of Acoustically Induced Rotary Saturation ( AIRS ) Effect for Active Contrast Modulation in Molecular Imaging (2011) (0)
- Control of liver size by RNAi-mediated multiplex knockdown and its application for discovery of regulatory mechanisms (2015) (0)
- Biomanufacturing for clinically advanced cell therapies (2018) (0)
- Supplementary Material 21 (2015) (0)
- Biodegradable poly (beta-amino esters) and applications thereof (2004) (0)
- Supplementary Material 22 (2015) (0)
- MicroRNA perturbation of the MRN complex buffers DNA damage response from VEGF signaling (2017) (0)
- Draft 2 Real-time in vivo detection of biomaterial-induced reactive oxygen species 1 (2016) (0)
- Challenges in the development of immunoisolation devices (2020) (0)
- Combinatorial development of novel polymers resistant to bacterial attachment (2012) (0)
- C2TB00379A 1035..1043 (2013) (0)
- Supplementary Material 25 (2015) (0)
- Intra-vital microscopy of haematopoietic progenitor cells in the bone marrow (2015) (0)
- Combinatorial discovery of novel polymers resistant to bacterial attachment (2012) (0)
- Identi fi cation of polymer surface adsorbed proteins implicated in pluripotent human embryonic stem cell expansion † (2016) (0)
- 1 Branched siRNA nanostructures for enhanced gene silencing (2013) (0)
- Vascularized Muscle Flap to Reduce Wound Breakdown During Flexible Electrode-Mediated Functional Electrical Stimulation After Peripheral Nerve Injury (2020) (0)
- Abstract 15. Better Living through Chemistry: A Novel Breast Implant Surface Coating Significantly Reduces Peri-Prosthetic Capsule Formation (2017) (0)
- Combinatorial design of nanoparticles for pulmonary mRNA delivery and genome editing. (2023) (0)
- Engineered 3D-printed artificial axons The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters (2017) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Daniel G Anderson?
Daniel G Anderson is affiliated with the following schools: