David Robinson Goodlett
#145,518
Most Influential Person Now
David Robinson Goodlett's AcademicInfluence.com Rankings
David Robinson Goodlettchemistry Degrees
Chemistry
#3838
World Rank
#4881
Historical Rank
Analytical Chemistry
#160
World Rank
#167
Historical Rank
Physical Chemistry
#554
World Rank
#606
Historical Rank

David Robinson Goodlettbiology Degrees
Biology
#10546
World Rank
#13879
Historical Rank
Biochemistry
#1674
World Rank
#1809
Historical Rank

Download Badge
Chemistry Biology
David Robinson Goodlett's Degrees
- PhD Chemistry University of California, Berkeley
- Bachelors Chemistry University of California, Berkeley
Why Is David Robinson Goodlett Influential?
(Suggest an Edit or Addition)David Robinson Goodlett's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Molecular characterization of mitochondrial apoptosis-inducing factor (1999) (4165)
- The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5 (2001) (3608)
- Integrated genomic and proteomic analyses of a systematically perturbed metabolic network. (2001) (2037)
- Mass spectrometry in proteomics. (2001) (1313)
- Integrated Genomic and Proteomic Analyses of Gene Expression in Mammalian Cells*S (2004) (777)
- A type VI secretion system of Pseudomonas aeruginosa targets a toxin to bacteria. (2010) (766)
- HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences. (1998) (492)
- Transcription factor Foxp3 and its protein partners form a complex regulatory network (2012) (373)
- Mass spectrometry based targeted protein quantification: methods and applications. (2009) (366)
- The study of macromolecular complexes by quantitative proteomics (2003) (336)
- Identification of Flow-dependent Endothelial Nitric-oxide Synthase Phosphorylation Sites by Mass Spectrometry and Regulation of Phosphorylation and Nitric Oxide Production by the Phosphatidylinositol 3-Kinase Inhibitor LY294002* (1999) (333)
- Growth phenotypes of Pseudomonas aeruginosa lasR mutants adapted to the airways of cystic fibrosis patients (2007) (318)
- A type VI secretion-related pathway in Bacteroidetes mediates interbacterial antagonism. (2014) (265)
- A suite of algorithms for the comprehensive analysis of complex protein mixtures using high-resolution LC-MS (2006) (265)
- Experimental protein mixture for validating tandem mass spectral analysis. (2002) (255)
- A widespread bacterial type VI secretion effector superfamily identified using a heuristic approach. (2012) (255)
- Comparison of Francisella tularensis genomes reveals evolutionary events associated with the emergence of human pathogenic strains (2007) (243)
- Comparative metaproteomics reveals ocean-scale shifts in microbial nutrient utilization and energy transduction (2010) (237)
- Differential stable isotope labeling of peptides for quantitation and de novo sequence derivation. (2001) (236)
- Precursor acquisition independent from ion count: how to dive deeper into the proteomics ocean. (2009) (235)
- Proteomic analysis of human prostasomes (2003) (235)
- Genetic basis of proteome variation in yeast (2007) (231)
- Multiplexed and data-independent tandem mass spectrometry for global proteome profiling. (2014) (221)
- Gene Expression Analyzed by High-resolution State Array Analysis and Quantitative Proteomics (2004) (204)
- Normalization of NAD+ Redox Balance as a Therapy for Heart Failure (2016) (200)
- Approaching complete peroxisome characterization by gas‐phase fractionation (2002) (192)
- Pancreatic cancer proteome: the proteins that underlie invasion, metastasis, and immunologic escape. (2005) (189)
- Quantitative proteomic analysis of Myc oncoprotein function (2002) (186)
- Salivary α-synuclein and DJ-1: potential biomarkers for Parkinson's disease. (2011) (185)
- Quantitative proteomics of cerebrospinal fluid from patients with Alzheimer disease. (2005) (177)
- Lack of In Vitro and In Vivo Recognition of Francisella tularensis Subspecies Lipopolysaccharide by Toll-Like Receptors (2006) (176)
- An Interbacterial NAD(P)+ Glycohydrolase Toxin Requires Elongation Factor Tu for Delivery to Target Cells (2015) (171)
- Genetically distinct pathways guide effector export through the type VI secretion system (2014) (170)
- The SOX2 response program in glioblastoma multiforme: an integrated ChIP-seq, expression microarray, and microRNA analysis (2011) (169)
- Human symbionts inject and neutralize antibacterial toxins to persist in the gut (2016) (164)
- Human Toll‐like receptor 4 responses to P. gingivalis are regulated by lipid A 1‐ and 4′‐phosphatase activities (2009) (161)
- Mass spectrometric characterization of proteins extracted from Jurkat T cell detergent‐resistant membrane domains (2001) (159)
- Quantitative proteomic analysis of age-related changes in human cerebrospinal fluid (2005) (157)
- Quantitative mass spectrometry reveals a role for the GTPase Rho1p in actin organization on the peroxisome membrane (2004) (156)
- Analysis of α-Synuclein-associated Proteins by Quantitative Proteomics*[boxs] (2004) (152)
- LPS remodeling is an evolved survival strategy for bacteria (2012) (151)
- Shotgun collision‐induced dissociation of peptides using a time of flight mass analyzer (2003) (150)
- The Role of TLRs in Anti-cancer Immunity and Tumor Rejection (2019) (145)
- Capillary electrophoresis-mass spectrometry. (1993) (143)
- Surface acoustic wave nebulization of peptides as a microfluidic interface for mass spectrometry. (2010) (142)
- Quantitative proteomic analysis indicates increased synthesis of a quinolone by Pseudomonas aeruginosa isolates from cystic fibrosis airways (2003) (140)
- Salivary tau species are potential biomarkers of Alzheimer's disease. (2011) (136)
- Quantitative Proteomic Analysis of Proteins Released by Neoplastic Prostate Epithelium (2004) (132)
- Coordinate regulation of energy transduction modules in Halobacterium sp. analyzed by a global systems approach (2002) (128)
- Strain competition restricts colonization of an enteric pathogen and prevents colitis (2016) (128)
- Transferrin receptor-dependent cytotoxicity of artemisinin-transferrin conjugates on prostate cancer cells and induction of apoptosis. (2009) (126)
- Kin cell lysis is a danger signal that activates antibacterial pathways of Pseudomonas aeruginosa (2015) (123)
- Quantitative proteomic profiling of pancreatic cancer juice (2006) (119)
- Increased quantitative proteome coverage with 13C/12C‐based, acid‐cleavable isotope‐coded affinity tag reagent and modified data acquisition scheme (2005) (119)
- Chemical cross-linking and mass spectrometry as a low-resolution protein structure determination technique. (2010) (113)
- VgrG-5 Is a Burkholderia Type VI Secretion System-Exported Protein Required for Multinucleated Giant Cell Formation and Virulence (2014) (112)
- A combined dataset of human cerebrospinal fluid proteins identified by multi‐dimensional chromatography and tandem mass spectrometry (2007) (109)
- Genetic Variation Shapes Protein Networks Mainly through Non-transcriptional Mechanisms (2011) (107)
- Evidence for the presence of disease-perturbed networks in prostate cancer cells by genomic and proteomic analyses: a systems approach to disease. (2005) (106)
- Analysis of the plasma proteome using iTRAQ and TMT-based Isobaric labeling. (2018) (105)
- Analysis of alpha-synuclein-associated proteins by quantitative proteomics. (2004) (104)
- Protein identification with a single accurate mass of a cysteine-containing peptide and constrained database searching. (2000) (104)
- A Deep Proteome Analysis Identifies the Complete Secretome as the Functional Unit of Human Cardiac Progenitor Cells (2017) (104)
- Protein Identification Using Top-Down Spectra* (2012) (101)
- Rules governing protein identification by mass spectrometry. (2005) (100)
- The Application of New Software Tools to Quantitative Protein Profiling Via Isotope-coded Affinity Tag (ICAT) and Tandem Mass Spectrometry (2003) (99)
- Comparison of Pancreas Juice Proteins from Cancer Versus Pancreatitis Using Quantitative Proteomic Analysis (2007) (96)
- A microcapillary trap cartridge-microcapillary high-performance liquid chromatography electrospray ionization emitter device capable of peptide tandem mass spectrometry at the attomole level on an ion trap mass spectrometer with automated routine operation. (2003) (95)
- Quantitative Proteomics Analysis Reveals That Proteins Differentially Expressed in Chronic Pancreatitis Are Also Frequently Involved in Pancreatic Cancer*S (2007) (95)
- xComb: a cross-linked peptide database approach to protein-protein interaction analysis. (2010) (93)
- Observation of duplex DNA-drug noncovalent complexes by electrospray ionization mass spectrometry (1994) (92)
- DJ-1 isoforms in whole blood as potential biomarkers of Parkinson disease (2012) (91)
- Genome-specific gas-phase fractionation strategy for improved shotgun proteomic profiling of proteotypic peptides. (2008) (90)
- Attomole level capillary electrophoresis-mass spectrometric protein analysis using 5 .mu.m i.d. capillaries (1992) (89)
- Proteomic Analysis of the Intestinal Epithelial Cell Response to Enteropathogenic Escherichia coli* (2004) (89)
- Observation of a noncovalent ribonuclease S-protein/S-peptide complex by electrospray ionization mass spectrometry (1993) (89)
- Direct observation of a DNA quadruplex by electrospray ionization mass spectrometry. (1993) (88)
- Structural Modification of Lipopolysaccharide Conferred by mcr-1 in Gram-Negative ESKAPE Pathogens (2017) (88)
- Faster, quantitative, and accurate precursor acquisition independent from ion count. (2011) (86)
- Multiplex targeted proteomic assay for biomarker detection in plasma: a pancreatic cancer biomarker case study. (2012) (85)
- Mapping PARP-1 auto-ADP-ribosylation sites by liquid chromatography-tandem mass spectrometry. (2013) (84)
- A Francisella Mutant in Lipid A Carbohydrate Modification Elicits Protective Immunity (2008) (83)
- Quantitative Glycoproteomics Analysis Reveals Changes in N-Glycosylation Level Associated with Pancreatic Ductal Adenocarcinoma (2014) (83)
- Diatom Proteomics Reveals Unique Acclimation Strategies to Mitigate Fe Limitation (2013) (82)
- Mining the acute respiratory distress syndrome proteome: identification of the insulin-like growth factor (IGF)/IGF-binding protein-3 pathway in acute lung injury. (2006) (82)
- Identification of a Novel Phosphorylation Site, Ser-170, as a Regulator of Bad Pro-apoptotic Activity* (2002) (81)
- Effect of artemisinin derivatives on apoptosis and cell cycle in prostate cancer cells (2010) (81)
- Detection of hydroxamate siderophores in coastal and Sub-Antarctic waters off the South Eastern Coast of New Zealand (2011) (81)
- Structural heterogeneity and environmentally regulated remodeling of Francisella tularensis subspecies novicida lipid a characterized by tandem mass spectrometry (2007) (80)
- Dynamic Changes in the Subcellular Distribution of Gpd1p in Response to Cell Stress* (2009) (80)
- Ser(2194) is a highly conserved major phosphorylation site of the hepatitis C virus nonstructural protein NS5A. (2000) (79)
- Quantitative proteomic analysis of chromatin-associated factors (2003) (78)
- System-based proteomic analysis of the interferon response in human liver cells (2004) (77)
- Proteomic analysis of Pseudomonas aeruginosa grown under magnesium limitation (2003) (76)
- Intersection of the Kap123p-Mediated Nuclear Import and Ribosome Export Pathways (2003) (76)
- Use of small‐diameter capillaries for increasing peptide and protein detection sensitivity in capillary electrophoresis‐mass spectrometry (1993) (76)
- Characterization of protein cross-links via mass spectrometry and an open-modification search strategy. (2008) (74)
- The Application of New Software Tools to Quantitative Protein Profiling Via Isotope-coded Affinity Tag (ICAT) and Tandem Mass Spectrometry (2003) (74)
- MglA Regulates Francisella tularensis subsp. novicida (Francisella novicida) Response to Starvation and Oxidative Stress (2007) (72)
- Shotgun proteomics implicates extracellular matrix proteins and protease systems in neuronal development induced by astrocyte cholinergic stimulation (2009) (69)
- Initial Proteome Analysis of Model Microorganism Haemophilus influenzae Strain Rd KW20 (2003) (68)
- Sulfur oxidizers dominate carbon fixation at a biogeochemical hot spot in the dark ocean (2013) (66)
- Landscape of the SOX2 protein–protein interactome (2011) (66)
- Proteomic identification of potential susceptibility factors in drug-induced liver disease. (2005) (64)
- Induced sputum proteome in healthy subjects and asthmatic patients. (2011) (64)
- Secreted Effectors Encoded within and outside of the Francisella Pathogenicity Island Promote Intramacrophage Growth. (2016) (62)
- Pro-CrossLink. Software tool for protein cross-linking and mass spectrometry. (2006) (62)
- Advances in proteomic prostate cancer biomarker discovery. (2010) (61)
- ICAT-based comparative proteomic analysis of non-replicating persistent Mycobacterium tuberculosis. (2006) (60)
- Proteomic Analysis of an Extreme Halophilic Archaeon, Halobacterium sp. NRC-1* (2003) (60)
- Assessing Bias in Experiment Design for Large Scale Mass Spectrometry-based Quantitative Proteomics*S (2007) (58)
- Determination of pyrophosphorylated forms of lipid A in Gram-negative bacteria using a multivaried mass spectrometric approach (2008) (58)
- DNA methylation and Transcriptome Changes Associated with Cisplatin Resistance in Ovarian Cancer (2017) (57)
- Proteomic biomarker discovery in cerebrospinal fluid for neurodegenerative diseases. (2006) (57)
- Surface Acoustic Wave Nebulization Produces Ions with Lower Internal Energy than Electrospray Ionization (2012) (57)
- Identification of the ESKAPE pathogens by mass spectrometric analysis of microbial membrane glycolipids (2017) (57)
- Identification of phosphorylation sites using microimmobilized metal affinity chromatography. (2005) (57)
- Precursor ion independent algorithm for top-down shotgun proteomics (2009) (57)
- Quantitative proteomics investigation of pancreatic intraepithelial neoplasia (2009) (56)
- Deciphering diatom biochemical pathways via whole-cell proteomics. (2009) (56)
- Ovine uterine morphogenesis: histochemical aspects of endometrial development in the fetus and neonate. (1988) (56)
- Identification of the Interactions between Cytochrome P450 2E1 and Cytochrome b5 by Mass Spectrometry and Site-directed Mutagenesis* (2006) (55)
- Surface acoustic wave nebulization facilitating lipid mass spectrometric analysis. (2012) (54)
- Exploration of the normal human bronchoalveolar lavage fluid proteome (2008) (53)
- Comparison of a Label-Free Quantitative Proteomic Method Based on Peptide Ion Current Area to the Isotope Coded Affinity Tag Method (2008) (52)
- Plasticity of Cytochrome P450 2B4 as Investigated by Hydrogen-Deuterium Exchange Mass Spectrometry and X-ray Crystallography* (2010) (52)
- Large‐scale evaluation of quantitative reproducibility and proteome coverage using acid cleavable isotope coded affinity tag mass spectrometry for proteomic profiling (2005) (52)
- Characterization of hepatic glutathione S-transferases in coho salmon (Oncorhynchus kisutch). (2007) (51)
- Interactions between CusF and CusB identified by NMR spectroscopy and chemical cross-linking coupled to mass spectrometry. (2011) (51)
- Peptide chiral purity determination: hydrolysis in deuterated acid, derivatization with Marfey's reagent and analysis using high-performance liquid chromatography-electrospray ionization-mass spectrometry. (1995) (51)
- Structural modification of LPS in colistin-resistant, KPC-producing Klebsiella pneumoniae (2017) (50)
- Data-dependent modulation of solid-phase extraction capillary electrophoresis for the analysis of complex peptide and phosphopeptide mixtures by tandem mass spectrometry: application to endothelial nitric oxide synthase. (1999) (50)
- Data-independent proteomic screen identifies novel tamoxifen agonist that mediates drug resistance. (2011) (48)
- Identifying and tracking proteins through the marine water column: insights into the inputs and preservation mechanisms of protein in sediments. (2012) (46)
- Identification and type III‐dependent secretion of the Yersinia pestis insecticidal‐like proteins (2007) (45)
- Stromal mesenchyme cell genes of the human prostate and bladder (2005) (45)
- Detecting cross-linked peptides by searching against a database of cross-linked peptide pairs. (2010) (44)
- Protein structure modeling. (2010) (44)
- Systematic investigation of lycopene effects in LNCaP cells by use of novel large‐scale proteomic analysis software (2007) (43)
- Tandem mass spectrometry investigation of ADP-ribosylated kemptide (2009) (43)
- Of mice and men: comparative proteomics of bronchoalveolar fluid (2009) (43)
- Proteins that underlie neoplastic progression of ulcerative colitis (2009) (42)
- A divergent Pseudomonas aeruginosa palmitoyltransferase essential for cystic fibrosis‐specific lipid A (2014) (42)
- On the benefits of acquiring peptide fragment ions at high measured mass accuracy (2008) (42)
- The Proteome Folding Project: proteome-scale prediction of structure and function. (2011) (41)
- Cross-linking mass spectrometry and mutagenesis confirm the functional importance of surface interactions between CYP3A4 and holo/apo cytochrome b(5). (2012) (41)
- Reduced elution speed detection for capillary electrophoresis/mass spectrometry (1993) (41)
- Lipid A structural modifications in extreme conditions and identification of unique modifying enzymes to define the Toll-like receptor 4 structure-activity relationship. (2017) (40)
- Proteomics without polyacrylamide: qualitative and quantitative uses of tandem mass spectrometry in proteome analysis (2002) (40)
- Mitochondrial Dysfunction in NnaD Mutant Flies and Purkinje Cell Degeneration Mice Reveals a Role for Nna Proteins in Neuronal Bioenergetics (2010) (40)
- Interlaboratory Study for Characterizing Monoclonal Antibodies by Top-Down and Middle-Down Mass Spectrometry. (2020) (39)
- Interactions of the Transmembrane Polymeric Rings of the Salmonella enterica Serovar Typhimurium Type III Secretion System (2010) (39)
- Substrate Specificity and Ligand Interactions of CYP26A1, the Human Liver Retinoic Acid Hydroxylase (2011) (39)
- Increasing information from shotgun proteomic data by accounting for misassigned precursor ion masses (2008) (38)
- An six-amino acid motif in the alpha3 domain of MICA is the cancer therapeutic target to inhibit shedding. (2009) (38)
- Acquisition of Iron by Alkaliphilic Bacillus Species (2010) (37)
- Effects of transferrin conjugates of artemisinin and artemisinin dimer on breast cancer cell lines. (2013) (37)
- Advances in protein complex analysis by chemical cross-linking coupled with mass spectrometry (CXMS) and bioinformatics. (2016) (36)
- Urinary proteome analysis of irritable bowel syndrome (IBS) symptom subgroups. (2012) (36)
- Urinary proteomics evaluation in interstitial cystitis/painful bladder syndrome: a pilot study. (2010) (36)
- Identification and characterization of biomarkers of organophosphorus exposures in humans. (2010) (36)
- Formylated peptides from cyanogen bromide digests identified by fast atom bombardment mass spectrometry. (1990) (36)
- Quantitative Mass Spectrometry Analysis Using PAcIFIC for the Identification of Plasma Diagnostic Biomarkers for Abdominal Aortic Aneurysm (2011) (36)
- Comprehensive structure characterization of lipid a extracted from Yersinia pestis for determination of its phosphorylation configuration (2010) (35)
- A Review of Tandem Mass Spectrometry Characterization of Adenosine Diphosphate-Ribosylated Peptides. (2012) (35)
- On the relevance of peptide sequence permutations in shotgun proteomics studies. (2011) (35)
- Electron capture in spin-trap capped peptides. An experimental example of ergodic dissociation in peptide cation-radicals (2007) (35)
- Serum Proteomes Distinguish Children Developing Type 1 Diabetes in a Cohort With HLA-Conferred Susceptibility (2015) (34)
- Comprehensive glycosylation profiling of IgG and IgG-fusion proteins by top-down MS with multiple fragmentation techniques. (2016) (34)
- Proteomics on Fixed Tissue Specimens - A Review. (2009) (34)
- Identification of the Active Site of DS-epimerase 1 and Requirement of N-Glycosylation for Enzyme Function* (2009) (34)
- Optimization of reversed-phase microcapillary liquid chromatography for quantitative proteomics. (2004) (33)
- Proteomic approach to studying parkinson’s disease (2004) (33)
- Molecular and Biological Characterization of Streptococcal SpyA-mediated ADP-ribosylation of Intermediate Filament Protein Vimentin* (2012) (31)
- Rapid Microbial Identification and Antibiotic Resistance Detection by Mass Spectrometric Analysis of Membrane Lipids. (2019) (31)
- Proteomic Profiling of Bronchoalveolar Lavage Fluid in Critically Ill Patients with Ventilator-Associated Pneumonia (2013) (31)
- Multi-Omics Strategies Uncover Host-Pathogen Interactions. (2019) (30)
- Comparison of Data Acquisition Strategies on Quadrupole Ion Trap Instrumentation for Shotgun Proteomics (2014) (30)
- New structural proteins of Halobacterium salinarum gas vesicle revealed by comparative proteomics analysis. (2011) (29)
- Automated Lipid A Structure Assignment from Hierarchical Tandem Mass Spectrometry Data (2011) (29)
- RETRACTION: All-Trans-Retinoic Acid Enhances Mitochondrial Function in Models of Human Liver (2016) (29)
- Identification of secreted glycoproteins of human prostate and bladder stromal cells by comparative quantitative proteomics (2009) (28)
- Characterization of proteome of human cerebrospinal fluid. (2006) (28)
- Interactions between Casein Kinase Iε (CKIε) and Two Substrates from Disparate Signaling Pathways Reveal Mechanisms for Substrate-Kinase Specificity (2009) (27)
- Evaluation of P450 Inhibition and Induction by Artemisinin Antimalarials in Human Liver Microsomes and Primary Human Hepatocytes (2012) (26)
- Site-specific activity of the acyltransferases HtrB1 and HtrB2 in Pseudomonas aeruginosa lipid A biosynthesis. (2015) (26)
- Proteomic classification of acute leukemias by alignment-based quantitation of LC-MS/MS data sets. (2012) (26)
- Norharmane matrix enhances detection of endotoxin by MALDI-MS for simultaneous profiling of pathogen, host and vector systems (2016) (25)
- A pseudo-atomic model for the capsid shell of bacteriophage lambda using chemical cross-linking/mass spectrometry and molecular modeling. (2013) (25)
- CXC Chemokines Exhibit Bactericidal Activity against Multidrug-Resistant Gram-Negative Pathogens (2017) (24)
- Shotgun proteomic analysis of a chromatophore-enriched preparation from the purple phototrophic bacterium Rhodopseudomonas palustris (2004) (23)
- Role of pagL and lpxO in Bordetella bronchiseptica Lipid A Biosynthesis (2011) (23)
- The path to preservation: Using proteomics to decipher the fate of diatom proteins during microbial degradation (2010) (23)
- Rapid microbial identification and colistin resistance detection via MALDI-TOF MS using a novel on-target extraction of membrane lipids (2020) (21)
- Bioengineering radioresistance by overproduction of RPA, a mammalian-type single-stranded DNA-binding protein, in a halophilic archaeon (2014) (21)
- Global Analysis of Condition-specific Subcellular Protein Distribution and Abundance* (2013) (21)
- Screen-printed digital microfluidics combined with surface acoustic wave nebulization for hydrogen-deuterium exchange measurements. (2016) (21)
- Sensitive Top-Down Proteomics Analysis of a Low Number of Mammalian Cells Using a Nanodroplet Sample Processing Platform. (2020) (20)
- WaveletQuant, an improved quantification software based on wavelet signal threshold de-noising for labeled quantitative proteomic analysis (2010) (20)
- Rapid lipid a structure determination via surface acoustic wave nebulization and hierarchical tandem mass spectrometry algorithm. (2016) (20)
- The Human Diabetes Proteome Project (HDPP): From network biology to targets for therapies and prevention (2013) (20)
- Shotgun MS proteomic analysis of bronchoalveolar lavage fluid in normal subjects (2014) (19)
- Lipid raft proteins and their identification in T lymphocytes. (2004) (19)
- Characterization of microsomal fraction proteome in human lymphoblasts reveals the down‐regulation of galectin‐1 by interleukin‐12 (2005) (19)
- Proteome analysis of tissues by mass spectrometry. (2019) (19)
- Autopiquer - a Robust and Reliable Peak Detection Algorithm for Mass Spectrometry (2017) (19)
- Comparison of a Salmonella typhimurium proteome defined by shotgun proteomics directly on an LTQ-FT and by proteome pre-fractionation on an LCQ-DUO. (2006) (18)
- Serum Proteomic Profiling to Identify Biomarkers of Premature Carotid Atherosclerosis (2018) (18)
- Global Analysis and Comparison of the Transcriptomes and Proteomes of Group A Streptococcus Biofilms (2016) (18)
- Identification, cloning, expression, and purification of Francisella lpp3: an immunogenic lipoprotein. (2010) (18)
- Mass Spectrometry-based Structural Analysis and Systems Immunoproteomics Strategies for Deciphering the Host Response to Endotoxin. (2018) (18)
- Early evolutionary loss of the lipid A modifying enzyme PagP resulting in innate immune evasion in Yersinia pestis (2020) (17)
- A comprehensive characterization of the T‐cell antigen receptor complex composition by microcapillary liquid chromatography‐tandem mass spectrometry (2000) (17)
- Chemical cross‐linking, mass spectrometry, and in silico modeling of proteasomal 20S core particles of the haloarchaeon Haloferax volcanii (2012) (17)
- A Prospective Study of Acinetobacter baumannii Complex Isolates and Colistin Susceptibility Monitoring by Mass Spectrometry of Microbial Membrane Glycolipids (2018) (17)
- Longitudinal Plasma Proteomics Analysis Reveals Novel Candidate Biomarkers in Acute COVID-19 (2022) (16)
- Surface acoustic wave nebulization device with dual interdigitated transducers improves SAWN-MS performance. (2016) (16)
- Glycosylation characterization of therapeutic mAbs by top- and middle-down mass spectrometry (2015) (16)
- Pathogen Identification Direct From Polymicrobial Specimens Using Membrane Glycolipids (2018) (15)
- Quantitative proteomic characterization and comparison of T helper 17 and induced regulatory T cells (2018) (15)
- Label-Free Quantitation for Clinical Proteomics. (2016) (15)
- Shotgun proteomics as a viable approach for biological discovery in the Pacific oyster (2013) (14)
- Proteome Analysis of Halobacterium sp. NRC-1 Facilitated by the Biomodule Analysis Tool BMSorter*S (2006) (14)
- Improving mass and liquid chromatography based identification of proteins using bayesian scoring. (2005) (14)
- RACK1 Associates with Muscarinic Receptors and Regulates M2 Receptor Trafficking (2010) (14)
- Phosphorylation within the cysteine-rich region of dystrophin enhances its association with β-dystroglycan and identifies a potential novel therapeutic target for skeletal muscle wasting. (2014) (13)
- Hyper-phosphorylation of Sequestosome-1 Distinguishes Resistance to Cisplatin in Patient Derived High Grade Serous Ovarian Cancer Cells* (2017) (13)
- Covalent Modification and Time-Dependent Inhibition of Human CYP2E1 by the meta-Isomer of Acetaminophen (2012) (12)
- Optimized surface acoustic wave nebulization facilitates bacterial phenotyping (2017) (12)
- Proteomic landscape of bronchoalveolar lavage fluid in human immunodeficiency virus infection. (2014) (12)
- Evaluation of electrophoretic protein extraction and database‐driven protein identification from marine sediments (2012) (12)
- Mass Spectrometry-Based Serum Proteomics for Biomarker Discovery and Validation. (2017) (11)
- Deep-sea microbes as tools to refine the rules of innate immune pattern recognition (2021) (11)
- Organophosphorus inhibitors of insect juvenile hormone esterase (1991) (11)
- Top Down Tandem Mass Spectrometric Analysis of a Chemically Modified Rough-Type Lipopolysaccharide Vaccine Candidate (2018) (11)
- Stable isotopic labeling and mass spectrometry as a means to determine differences in protein expression (2003) (11)
- Assessment of the Therapeutic Potential of Persimmon Leaf Extract on Prediabetic Subjects (2017) (10)
- Protein recycling in Bering Sea algal incubations (2014) (10)
- Proteomics of Diabetes, Obesity, and Related Disorders (2018) (10)
- Metabolic capabilities and systems fluctuations in Haloarcula marismortui revealed by integrative genomics and proteomics analyses. (2011) (10)
- Quantitative in vitro kinase reaction as a guide for phosphoprotein analysis by mass spectrometry. (2000) (10)
- Producing Isotopic Distribution Models for Fully Apodized Absorption Mode FT-MS. (2015) (9)
- Fragmentation‐free LC‐MS can identify hundreds of proteins (2011) (9)
- The progress and potential of proteomic biomarkers for type 1 diabetes in children (2017) (9)
- Quantitative targeted proteomic analysis of potential markers of tyrosine kinase inhibitor (TKI) sensitivity in EGFR mutated lung adenocarcinoma. (2018) (8)
- Identification of Fatigue Biomarkers in Treated and Treatment-Naive HIV Patients (2014) (8)
- Electrophoretic Extraction and Proteomic Characterization of Proteins Buried in Marine Sediments (2014) (8)
- Minimize the Detection of False Positives by the Software Program DetectShift for 18O-Labeled Cross-Linked Peptide Analysis (2008) (8)
- Sequence assignment of ADP-ribosylated peptides is facilitated as peptide length increases. (2010) (8)
- Identification and characterization of a drug‐sensitive strain enables puromycin‐based translational assays in Saccharomyces cerevisiae (2014) (8)
- Use of captive spray ionization to increase throughput of the data-independent acquisition technique PAcIFIC. (2016) (8)
- Detection of Carbofuran-Protein Adducts in Serum of Occupationally Exposed Pesticide Factory Workers in Pakistan. (2016) (7)
- Host-pathogen dynamics through targeted secretome analysis of stimulated macrophages. (2018) (7)
- Structural derivation of lipid A from Cronobacter sakazakii using tandem mass spectrometry. (2016) (7)
- Ideker Perturbed Metabolic Network Integrated Genomic and Proteomic Analyses of a Systematically (2013) (7)
- Model-based Spectral Library Approach for Bacterial Identification via Membrane Glycolipids. (2019) (7)
- An Update on MRMAssayDB: A Comprehensive Resource for Targeted Proteomics Assays in the Community (2021) (7)
- The Human Diabetes Proteome Project (HDPP): The 2014 update (2015) (7)
- A statistical approach to peptide identification from clustered tandem mass spectrometry data (2012) (7)
- Droplet delivery and nebulization system using surface acoustic wave for mass spectrometry. (2020) (6)
- On-tissue derivatization of lipopolysaccharide for detection of lipid A using MALDI-MSI. (2020) (6)
- MicroPOTS Analysis of Barrett’s Esophageal Cell Line Models Identifies Proteomic Changes after Physiologic and Radiation Stress (2021) (6)
- Polydimethylsiloxane microchannel coupled to surface acoustic wave nebulization mass spectrometry. (2016) (6)
- Temporal proteomic profiling reveals changes that support Burkholderia biofilms. (2019) (6)
- Comparison of different digestion methods for proteomic analysis of isolated cells and FFPE tissue samples. (2021) (5)
- Dataset describing the development, optimization and application of SRM/MRM based targeted proteomics strategy for quantification of potential biomarkers of EGFR TKI sensitivity (2018) (5)
- Mass Spectrometric Characterization of Proteins Extracted from Jurkat T Cell Detergent-Resistant Membrane Domains (2001) (5)
- HLA Class I Signal Sequences Certainof TAP-Dependent Peptides Derived from HLA-E Surface Expression Depends on Binding (1998) (5)
- Evaluation of CYPs inhibition and induction by artemisinin antimalarials in human liver microsomes and primary human hepatocytes (2012) (5)
- Determination and comparison of the Francisella tularensis subsp.novicida U112 proteome to other bacterial proteomes. (2008) (5)
- Basic Concepts of Gene Expression (2004) (5)
- Streamlined Analysis of Cardiolipins in Prokaryotic and Eukaryotic Samples Using Norharmane Matrix by MALDI-MSI. (2020) (5)
- Interfaces with Structure Dynamics of the Workhorses from Cells Revealed through Cross-Linking Mass Spectrometry (CLMS) (2021) (5)
- Towards an integrated analytical technology for the generation of multidimensional protein expression maps. (1998) (5)
- Systematic Analysis of Yeast Proteome Reveals Peptide Detectability Factors for Mass Spectrometry. (2015) (5)
- Quantitative Protein Profile Comparisons Using the Isotope‐Coded Affinity Tag Method (2003) (4)
- Pharmacokinetics and toxicokinetics of an orally active tripeptide, IRI-695, in animals. (1996) (4)
- Analysis of venom sac constituents from the solitary, hunting wasp Cerceris rybyensis. (2019) (4)
- Species-Specific Endotoxin Stimulus Determines Toll-Like Receptor 4- and Caspase 11-Mediated Pathway Activation Characteristics (2021) (4)
- Elucidation of Covalent Modifications and Noncovalent Associations in Proteins by Electrospray Ionization Mass Spectrometry (1993) (4)
- Interpreting BERT architecture predictions for peptide presentation by MHC class I proteins (2021) (3)
- On the use of hydrogen/deuterium exchange mass spectrometry data to improve de novo protein structure prediction. (2009) (3)
- Proteomic profile of vitreous in patients with tubercular uveitis. (2020) (3)
- Rapid Food Product Analysis by Surface Acoustic Wave Nebulization Coupled Mass Spectrometry (2018) (3)
- Surface acoustic wave nebulization (2015) (3)
- Correction to "Toll-like Receptor 4-Independent Effects of Lipopolysaccharide Identified Using Longitudinal Serum Proteomics". (2021) (3)
- Biomedical Applications of Proteomics (2005) (3)
- Preparation and Use of an Integrated Microcapillary HPLC Column and ESI Device for Proteomic Analysis. (2007) (3)
- Mass Spectrometry Imaging of Microbes (2020) (2)
- Evaluation of Fast and Sensitive Proteome Profiling of FF and FFPE Kidney Patient Tissues (2022) (2)
- A Qit-q-Tof mass spectrometer for two-dimensional tandem mass spectrometry. (2007) (2)
- Strategies and Methods for Proteome Analysis (2000) (2)
- DIA-MS proteome analysis of formalin-fixed paraffin-embedded glioblastoma tissues. (2022) (2)
- Trends in Sample Preparation for Proteome Analysis (2021) (2)
- Evaluation of P 450 Inhibition and Induction by Artemisinin Antimalarials in Human Liver Microsomes and Primary Human Hepatocytes (2012) (2)
- An ambient detection system for visualization of charged particles generated with ionization methods at atmospheric pressure. (2016) (2)
- The effects of p53 gene inactivation on mutant proteome expression in a human melanoma cell model. (2020) (2)
- Analysis of venom sac constituents from the solitary, aculeate wasp Cerceris rybyensis (2019) (2)
- Serum Proteomic Profiling to Identify Biomarkers of Premature Carotid Atherosclerosis (2018) (2)
- Caulobacter lipid A is conditionally dispensable in the absence of fur and in the presence of anionic sphingolipids (2022) (2)
- Tritiated diimide: a regio- and stereo-selective tritium-labelling reagent (1993) (2)
- Quantitative proteomics profiling of neoplastic progression of ulcerative colitis: O-0020. (2008) (2)
- A Novel Lipid-Based MALDI-TOF Assay for the Rapid Detection of Colistin-Resistant Enterobacter Species (2022) (2)
- The effect of embryonic origin on the osteoinductive potential of bone allografts (2019) (1)
- Large precursor tolerance database search - a simple approach for estimation of the amount of spectra with precursor mass shifts in proteomic data. (2013) (1)
- VirulenceGiant Cell Formation and System-Exported Protein Required for VgrG-5 Is a Burkholderia Type VI Secretion (2014) (1)
- Author response: Kin cell lysis is a danger signal that activates antibacterial pathways of Pseudomonas aeruginosa (2015) (1)
- Making a Case for Data-independent Tandem Mass Spectrometry Workflows. (2010) (1)
- Droplet Delivery Control for Surface Acoustic Wave Nebulization Mass Spectrometry (2019) (1)
- LPS remodeling is an evolved survival strategy for bacteria (Proceedings of the National Academy of Sciences United States of America (2012) 109, (8716-8721) DOI (2012) (1)
- , Systematically Perturbed Metabolic Network Integrated Genomic and Proteomic Analyses of a (2010) (1)
- Quantitative Analysis of Proteomes and Subproteomes by Isotope-Coded Affinity Tag and Solid-Phase Glycoprotein Capture (2005) (1)
- Enhanced longitudinal differential expression detection in proteomics with robust reproducibility optimization regression (2021) (1)
- Capillary electrophoresis - electrospray ionization mass spectrometry in small diameter capillaries (1992) (1)
- MGMS2: Membrane Glycolipid Mass Spectrum Simulator for polymicrobial samples. (2020) (1)
- TLR4-Independent Effects of LPS Identified Using Longitudinal Serum Proteomics. (2020) (1)
- Lipid A Structural Determination from a Single Colony. (2022) (1)
- Mass Spectrometry in Pharmaceutical Analysis (2006) (1)
- A comprehensive library of canonical and non-canonical MHC class I antigens for cancer vaccine development. (2022) (0)
- Correction to: Top Down Tandem Mass Spectrometric Analysis of a Chemically Modified Rough-Type Lipopolysaccharide Vaccine Candidate (2018) (0)
- IDENTIFYING MITOCHONDRIAL PROTEINS IN PLASMA OF FATIGUE HIV-PATIENTS AND CONTROLS (2011) (0)
- Improving coverage in a proteomics experiment by use of an advanced de novo sequencing program (2002) (0)
- Enterovirus-associated changes in plasma proteome of children with genetic susceptibility to type 1 diabetes (2016) (0)
- Proteomic analysis of an extreme halophilic archaeon Halobacterium species NRC-1 (2002) (0)
- Proteomics in Toxicology (2014) (0)
- RIS 1 GTAAGCCCATTGAGTCCACGC TCACTTGGTCGCCACCCCCGA ChGn TGCAGCAGTGCCTTTCGATAG GTCGAAATAAGATGAGCCGTTTGA TNC CAGACATCACTGAAAATTCGGCTAC GCAAAGATTCTCAGTGTGTATTCCG EDNRB GCAAACCGCAGAGATAATGACG TCAAGATATTGGGACCGTTTCG STC 2 CAAGTCATTCATCAAAGACGCCTT CCTTTCATTTCACCTCCGGATATC BF ACTCCATGGTCTTTGGCCCAG AGTGGATTG (2015) (0)
- Secretion System Serovar Typhimurium Type III Salmonella enterica of the Interactions of the Transmembrane Polymeric Rings 2010 (2010) (0)
- Book Review: Biomedical Applications of Proteomics (2005) (0)
- Offline Micro-IMAC Enrichment of Phosphoproteins. (2007) (0)
- The immunopeptidome from a genomic perspective: Establishing the non-canonical landscape of MHC class I-associated peptides. (2023) (0)
- Abstract 4798: Pilot study of plasma biomarker candidates for pancreatic cancer detection - a targeted proteomics approach (2012) (0)
- Intestinal Deletion of 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase Promotes Expansion of the Resident Stem Cell Compartment (2022) (0)
- Transcriptomics Analysis Uncovers Transient Ceftazidime Tolerance in Burkholderia Biofilms. (2021) (0)
- L001 Abdominal aortic aneurysm: searching for plasma biomarkers (2009) (0)
- Benchmarking tools for detecting longitudinal differential expression in proteomics data allows establishing a robust reproducibility optimization regression approach (2022) (0)
- Caulobacter requires anionic sphingolipids and deactivation of fur to lose lipid A (2022) (0)
- LETTER TO THE EDITOR Salivary a -synuclein and DJ-1: potential biomarkers for Parkinson’s disease (2011) (0)
- Pathogen Identification Direct From Polymicrobial Specimens Using Membrane Glycolipids (2018) (0)
- Rickettsia Typhi Peptidoglycan Mapping with Data-Dependent Tandem Mass Spectrometry (2021) (0)
- Cytoplasmic switch of ARS2 isoforms promotes nonsense-mediated mRNA decay and arsenic sensitivity (2021) (0)
- High-throughput reversed-phase microcapillary liquid chromatographic system as a nanoscale electrospray ionization source for tandem mass spectrometry (2002) (0)
- Characterization of Surface Acoustic Wave Nebulization: Atomization dynamics and resulting droplet size distribution (2012) (0)
- Abstract 123: Intestinal Deletion Of 3-hydroxy-3-methylglutaryl-coenzyme A Reductase Promotes Expansion Of The Resident Stem Cell Compartment (2021) (0)
- Sample Preparation Methods for Targeted Single-Cell Proteomics. (2023) (0)
- FOCUS: PROTEOMICS Quantitative Proteomic Analysis of Chromatin-Associated Factors (2011) (0)
- Identification of the ESKAPE pathogens by mass spectrometric analysis of microbial membrane glycolipids (2017) (0)
- Bioengineering radioresistance by overproduction of RPA, a mammalian-type single-stranded DNA-binding protein, in a halophilic archaeon (2013) (0)
- Shotgun proteomics reveals biochemistry of normal and acute respiratory distress syndrome bronchoalveolar lavage fluid proteome (2008) (0)
- A Brief Overview of Proteomics at the 50th ASMS Conference (2002) (0)
- Abstract 20223: Deep Proteome Analysis Identified Complete Secretome as the Functional Unit of Human Cardiac Progenitor Cells (2016) (0)
- Rapid and quantitative proteome analysis and corresponding methods (2001) (0)
- From caffeine to protein (2011) (0)
- Analysis of Phosphopeptides by {micro}LC-ESI-MS/MS. (2007) (0)
- All-Trans-Retinoic Acid Enhances Mitochondrial Function in Models of Human Liver s (2016) (0)
- Rickettsia typhi peptidoglycan mapping with data-dependent tandem mass spectrometry (2022) (0)
- A Sensitive GC-MS Method for Quantitation of Lipid A Backbone Components and Terminal Phosphate Modifications. (2022) (0)
- Meet the Editorial Board (2004) (0)
- Using Data-Independent Mass Spectrometry to Extend Detectable Dynamic Range without Prior Fractionation (2013) (0)
- Chapter 13:Surface Acoustic Wave Nebulization (2014) (0)
- URINARY PROTEOMICS APPROACH TO INTERSTITIAL CYSTITIS/PAINFUL BLADDER SYNDROME PATHOPHYSIOLOGY (2009) (0)
- MS Visualization and Interpretation Software (MS-VIS), a Tool for Visualizing Mass Spectra and Analyzing Mass Lists. (2021) (0)
- Application of shotgun peptide sequencing (2002) (0)
- Phosphorus stress in Prochlorococcus: Physiology, Gene Expression and Proteomics (Poster) (2010) (0)
- O-0020: Quantitative proteomics profiling of neoplastic progression of ulcerative colitis (2008) (0)
- Quantitative Proteomic Analysis of Interferon Response in Human Liver Cells Using the Isotope Coded Affinity Tag Method and Novel Bioinformatics Tools Isotope of Phosphopeptides for Multiparallel Kinase Target Analysis and Identification of Phosphorylation Sites (2003) (0)
- Shotgun Analysis Of Induced Sputum Proteome In Health And Asthma (2010) (0)
- Gene Expression: Basic Concepts (2008) (0)
- DNA methylation and Transcriptome Changes Associated with Cisplatin Resistance in Ovarian Cancer (2017) (0)
- Abstract 9949: NADH/NAD+ Sensitive Protein Hyper-acetylation Links Mitochondrial Dysfunction to Cardiac Susceptibility to Stress (2015) (0)
- The immunopeptidome from a genomic perspective: Establishing immune-relevant regions for cancer vaccine design (2022) (0)
- A Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry Direct-from-Urine-Specimen Diagnostic for Gram-Negative Pathogens (2022) (0)
- Characterizing Bacterial Secretion Systems Using Mass Spectrometry (2012) (0)
- All‐trans retinoic acid promotes fatty acid oxidation in human hepatoma (HepG2) cells (LB612) (2014) (0)
- Meet the Editors: David R. Goodlett. (2018) (0)
- Abstract 2203: A SRM/MRM based targeted proteomics strategy for absolute quantification of potential biomarkers of TKI sensitivity in EGFR mutated lung adenocarcinoma (2017) (0)
- FROM CAFFEINE TO PROTEIN: THE DETECTION OF A WIDE RANGE OF MOLECULES BY SURFACE ACOUSTIC WAVE NEBULIZATION (SAWN) MASS SPECTROMETRY (2011) (0)
- New methods and instrumentation for the characterization of biopolymers using electrospray ionization-mass spectrometry (1992) (0)
- Bioinformatics strategies for the comprehensive characterization of immunopeptidome landscapes (2022) (0)
- Shotgun proteomics implicates extracellular matrix proteins and protease systems in neuronal development induced by astrocyte cholinergic stimulation: Astrocyte secretome and neuronal development (2010) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With David Robinson Goodlett?
David Robinson Goodlett is affiliated with the following schools: