Ekihiro Seki
#150,275
Most Influential Person Now
Researcher
Ekihiro Seki's AcademicInfluence.com Rankings
Ekihiro Sekicomputer-science Degrees
Computer Science
#7856
World Rank
#8268
Historical Rank
Computational Linguistics
#1657
World Rank
#1674
Historical Rank
Machine Learning
#3054
World Rank
#3092
Historical Rank
Artificial Intelligence
#3350
World Rank
#3399
Historical Rank
Download Badge
Computer Science
Ekihiro Seki's Degrees
- PhD Computer Science University of Tokyo
- Masters Computer Science Kyoto University
- Bachelors Computer Science Kyoto University
Similar Degrees You Can Earn
Why Is Ekihiro Seki Influential?
(Suggest an Edit or Addition)Ekihiro Seki's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition) (2012) (2913)
- TLR4 enhances TGF-β signaling and hepatic fibrosis (2007) (1003)
- Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1 (2021) (811)
- TLR4 enhances TGF-beta signaling and hepatic fibrosis. (2007) (788)
- NF-κB Restricts Inflammasome Activation via Elimination of Damaged Mitochondria (2016) (752)
- SOCS-1 participates in negative regulation of LPS responses. (2002) (681)
- Hepatic inflammation and fibrosis: Functional links and key pathways (2015) (649)
- Toll‐like receptors and adaptor molecules in liver disease: Update (2008) (647)
- Toll-like receptor 9 promotes steatohepatitis by induction of interleukin-1beta in mice. (2010) (579)
- New mitochondrial DNA synthesis enables NLRP3 inflammasome activation (2018) (551)
- Hepatic recruitment of macrophages promotes nonalcoholic steatohepatitis through CCR2. (2012) (415)
- A liver full of JNK: signaling in regulation of cell function and disease pathogenesis, and clinical approaches. (2012) (401)
- Gene expression profiles during hepatic stellate cell activation in culture and in vivo. (2007) (400)
- CCR1 and CCR5 promote hepatic fibrosis in mice. (2009) (391)
- Toll-like receptor signaling in the liver. (2006) (390)
- Identification of Liver Cancer Progenitors Whose Malignant Progression Depends on Autocrine IL-6 Signaling (2013) (387)
- CCR2 promotes hepatic fibrosis in mice (2009) (383)
- ER stress cooperates with hypernutrition to trigger TNF-dependent spontaneous HCC development. (2014) (374)
- Role of innate immunity and the microbiota in liver fibrosis: crosstalk between the liver and gut (2012) (357)
- p62, Upregulated during Preneoplasia, Induces Hepatocellular Carcinogenesis by Maintaining Survival of Stressed HCC-Initiating Cells. (2016) (333)
- Critical Roles of Myeloid Differentiation Factor 88-Dependent Proinflammatory Cytokine Release in Early Phase Clearance of Listeria monocytogenes in Mice1 (2002) (298)
- Correlation between liver histology and novel magnetic resonance imaging in adult patients with non‐alcoholic fatty liver disease – MRI accurately quantifies hepatic steatosis in NAFLD (2012) (291)
- Disruption of TAK1 in hepatocytes causes hepatic injury, inflammation, fibrosis, and carcinogenesis (2009) (264)
- Heritability of Hepatic Fibrosis and Steatosis Based on a Prospective Twin Study. (2015) (255)
- Hepatic stellate cells secrete angiopoietin 1 that induces angiogenesis in liver fibrosis. (2008) (246)
- Lipopolysaccharide-Induced IL-18 Secretion from Murine Kupffer Cells Independently of Myeloid Differentiation Factor 88 That Is Critically Involved in Induction of Production of IL-12 and IL-1β1 (2001) (236)
- Toll‐like receptors in alcoholic liver disease, non‐alcoholic steatohepatitis and carcinogenesis (2013) (232)
- Gastric bypass surgery improves metabolic and hepatic abnormalities associated with nonalcoholic fatty liver disease. (2006) (229)
- Toll‐like receptor 2 and palmitic acid cooperatively contribute to the development of nonalcoholic steatohepatitis through inflammasome activation in mice (2013) (229)
- Recent advancement of molecular mechanisms of liver fibrosis (2015) (227)
- Toll-like receptor 4 mediates synergism between alcohol and HCV in hepatic oncogenesis involving stem cell marker Nanog (2009) (218)
- Identification of gelsolin, a Ca2+-dependent regulatory protein of actin gel-sol transformation, and its intracellular distribution in a variety of cells and tissues (1981) (217)
- Transforming growth factor beta signaling in hepatocytes participates in steatohepatitis through regulation of cell death and lipid metabolism in mice (2014) (208)
- ASC is essential for LPS‐induced activation of procaspase‐1 independently of TLR‐associated signal adaptor molecules (2004) (205)
- Involvement of p21 and p27 in the regulation of CDK activity and cell cycle progression in the regenerating liver (1998) (204)
- Innate immunity in alcoholic liver disease. (2011) (193)
- Inflammation and Liver Cancer: Molecular Mechanisms and Therapeutic Targets (2019) (184)
- Loss of MMP 13 attenuates murine hepatic injury and fibrosis during cholestasis (2006) (178)
- Cyclin D1 promotes mitogen-independent cell cycle progression in hepatocytes. (1999) (175)
- The nicotinamide adenine dinucleotide phosphate oxidase (NOX) homologues NOX1 and NOX2/gp91phox mediate hepatic fibrosis in mice (2011) (171)
- c-Jun N-terminal kinase-1 from hematopoietic cells mediates progression from hepatic steatosis to steatohepatitis and fibrosis in mice. (2009) (166)
- Contribution of Toll‐like receptor/myeloid differentiation factor 88 signaling to murine liver regeneration (2005) (161)
- Toll-Like Receptors in Liver Fibrosis: Cellular Crosstalk and Mechanisms (2012) (160)
- CX3CL1‐CX3CR1 interaction prevents carbon tetrachloride‐induced liver inflammation and fibrosis in mice (2010) (158)
- Toll-like receptor 4 mediates alcohol-induced steatohepatitis through bone marrow-derived and endogenous liver cells in mice. (2011) (157)
- CCAAT/Enhancer-binding Protein-α Cooperates with p21 to Inhibit Cyclin-dependent Kinase-2 Activity and Induces Growth Arrest Independent of DNA Binding* (2001) (149)
- Liver damage, inflammation, and enhanced tumorigenesis after persistent mTORC1 inhibition. (2014) (143)
- Liver Cancer Initiation Requires p53 Inhibition by CD44-Enhanced Growth Factor Signaling. (2018) (138)
- Evidence That Cyclin D1 Mediates Both Growth and Proliferation Downstream of TOR in Hepatocytes* (2003) (138)
- Role of Toll-Like Receptors and Their Downstream Molecules in the Development of Nonalcoholic Fatty Liver Disease (2011) (132)
- Toll-Like Receptor Signaling and Liver Fibrosis (2010) (131)
- Transforming growth factor-β signaling in hepatocytes promotes hepatic fibrosis and carcinogenesis in mice with hepatocyte-specific deletion of TAK1. (2013) (130)
- TAK1-mediated autophagy and fatty acid oxidation prevent hepatosteatosis and tumorigenesis. (2014) (126)
- Transient expression of cyclin D1 is sufficient to promote hepatocyte replication and liver growth in vivo. (2001) (125)
- Regulation of cyclin‐dependent kinase inhibitor p21WAF1/Cip1/Sdi1 gene expression in hepatic regeneration (1997) (123)
- A TLR2/S100A9/CXCL-2 signaling network is necessary for neutrophil recruitment in acute and chronic liver injury in the mouse (2014) (122)
- Effect of weight loss on magnetic resonance imaging estimation of liver fat and volume in patients with nonalcoholic steatohepatitis. (2015) (118)
- Roles of caspase-1 in Listeria infection in mice. (2004) (118)
- Plasmodium berghei Infection in Mice Induces Liver Injury by an IL-12- and Toll-Like Receptor/Myeloid Differentiation Factor 88-Dependent Mechanism1 (2001) (117)
- Origin of myofibroblasts in liver fibrosis (2012) (115)
- Differential regulation of cyclins D1 and D3 in hepatocyte proliferation (2002) (112)
- TNFα in Liver Fibrosis (2015) (112)
- Ectopic expression of cyclin D3 corrects differentiation of DM1 myoblasts through activation of RNA CUG-binding protein, CUGBP1. (2008) (109)
- Angiotensin‐converting‐enzyme 2 inhibits liver fibrosis in mice (2009) (109)
- Selective inactivation of NF-κB in the liver using NF-κB decoy suppresses CCl4-induced liver injury and fibrosis (2007) (104)
- TLR2 and TLR9 contribute to alcohol-mediated liver injury through induction of CXCL1 and neutrophil infiltration. (2015) (100)
- Fatty Acid Amide Hydrolase Determines Anandamide-induced Cell Death in the Liver* (2006) (100)
- Distinct patterns of cyclin D1 regulation in models of liver regeneration and human liver. (1995) (98)
- Age-specific CUGBP1-eIF2 Complex Increases Translation of CCAAT/Enhancer-binding Protein β in Old Liver* (2006) (94)
- Short Term Cyclin D1 Overexpression Induces Centrosome Amplification, Mitotic Spindle Abnormalities, and Aneuploidy* (2005) (92)
- Reduced nicotinamide adenine dinucleotide phosphate oxidase mediates fibrotic and inflammatory effects of leptin on hepatic stellate cells (2008) (90)
- Liver homeostasis is maintained by midlobular zone 2 hepatocytes (2021) (89)
- GIV/Girdin is a central hub for pro-fibrogenic signalling networks during liver fibrosis (2014) (88)
- Promotion of cholangiocarcinoma growth by diverse cancer-associated fibroblast subpopulations. (2021) (88)
- Differential regulation of the retinoblastoma family of proteins during cell proliferation and differentiation. (1998) (82)
- Transcriptional Repression of the Transforming Growth Factor β (TGF-β) Pseudoreceptor BMP and Activin Membrane-bound Inhibitor (BAMBI) by Nuclear Factor κB (NF-κB) p50 Enhances TGF-β Signaling in Hepatic Stellate Cells* (2014) (79)
- S6 kinase 1 is required for rapamycin-sensitive liver proliferation after mouse hepatectomy. (2011) (79)
- TAK1 regulates hepatic cell survival and carcinogenesis (2014) (78)
- Regulation of the hepatocyte cell cycle by type I collagen matrix: role of cyclin D1. (1999) (78)
- C/EBPα triggers proteasome‐dependent degradation of cdk4 during growth arrest (2002) (76)
- Tumor restriction by type I collagen opposes tumor-promoting effects of cancer-associated fibroblasts. (2021) (75)
- Genomewide microRNA down‐regulation as a negative feedback mechanism in the early phases of liver regeneration (2011) (74)
- Role and cellular source of nicotinamide adenine dinucleotide phosphate oxidase in hepatic fibrosis (2010) (74)
- Nrf2 Activation Protects the Liver From Ischemia/Reperfusion Injury in Mice (2014) (73)
- Distinct proliferative and transcriptional effects of the D-type cyclins in vivo (2008) (70)
- Effects of chronic ethanol consumption on cytokine regulation of liver regeneration. (1998) (70)
- Inhibition of type I natural killer T cells by retinoids or following sulfatide‐mediated activation of type II natural killer T cells attenuates alcoholic liver disease in mice (2015) (67)
- Cyclin D1 inhibits hepatic lipogenesis via repression of carbohydrate response element binding protein and hepatocyte nuclear factor 4α (2012) (65)
- Hyaluronan synthase 2–mediated hyaluronan production mediates Notch1 activation and liver fibrosis (2019) (63)
- p38α inhibits liver fibrogenesis and consequent hepatocarcinogenesis by curtailing accumulation of reactive oxygen species. (2013) (63)
- Selective inactivation of NF-kappaB in the liver using NF-kappaB decoy suppresses CCl4-induced liver injury and fibrosis. (2007) (62)
- Cyclin and cyclin-dependent kinase 1 mRNA expression in models of regenerating liver and human liver diseases. (1993) (62)
- Expression of cyclin‐dependent kinase inhibitor p21 in human liver (1998) (61)
- Induction of cytochrome CYPIA1 and formation of toxic metabolites of benzo[a]pyrene by rat aorta: a possible role in atherogenesis. (1994) (61)
- Cyclin D3 Maintains Growth-Inhibitory Activity of C/EBPα by Stabilizing C/EBPα-cdk2 and C/EBPα-Brm Complexes (2006) (60)
- Nuclear factor κB decoy oligodeoxynucleotides prevent endotoxin‐induced fatal liver failure in a murine model (2003) (60)
- l-Tryptophan-mediated Enhancement of Susceptibility to Nonalcoholic Fatty Liver Disease Is Dependent on the Mammalian Target of Rapamycin* (2011) (59)
- Cytokine-induced inflammatory liver injuries. (2003) (58)
- Integrative genomic analysis of mouse and human hepatocellular carcinoma (2018) (57)
- Alpha‐1 antitrypsin Z protein (PiZ) increases hepatic fibrosis in a murine model of cholestasis (2007) (56)
- Induction of hepatocyte proliferation and liver hyperplasia by the targeted expression of cyclin E and skp2 (2001) (56)
- E2F/p107 and E2F/p130 complexes are regulated by C/EBPα in 3T3-L1 adipocytes (1999) (55)
- Demonstration of cooperative contribution of MET- and EGFR-mediated STAT3 phosphorylation to liver regeneration by exogenous suppressor of cytokine signalings. (2008) (54)
- Akt-mediated Liver Growth Promotes Induction of Cyclin E through a Novel Translational Mechanism and a p21-mediated Cell Cycle Arrest* (2007) (53)
- Activation of cyclin-dependent kinases CDC2 and CDK2 in hepatocellular carcinoma. (2002) (53)
- Mechanisms of MAFG Dysregulation in Cholestatic Liver Injury and Development of Liver Cancer. (2018) (52)
- Toll‐like receptor 7‐mediated type I interferon signaling prevents cholestasis‐ and hepatotoxin‐induced liver fibrosis (2014) (51)
- Alcoholic liver disease: A current molecular and clinical perspective☆ (2018) (51)
- Amino Acids Regulate Hepatocyte Proliferation through Modulation of Cyclin D1 Expression* (2003) (50)
- The Role of Collagen Structure in Mitogen Stimulation of ERK, Cyclin D1 Expression, and G1-S Progression in Rat Hepatocytes* (2003) (50)
- Investigating the role of the extracellular environment in modulating hepatic stellate cell biology with arrayed combinatorial microenvironments. (2009) (49)
- Chemokines and Chemokine Receptors in the Development of NAFLD. (2018) (49)
- Serum Amyloid A Induces Inflammation, Proliferation and Cell Death in Activated Hepatic Stellate Cells (2016) (46)
- TRIF Differentially Regulates Hepatic Steatosis and Inflammation/Fibrosis in Mice (2017) (46)
- Non‐alcoholic steatohepatitis‐induced fibrosis: Toll‐like receptors, reactive oxygen species and Jun N‐terminal kinase (2011) (46)
- Regulation of G1 cyclin-dependent kinases in the liver: role of nuclear localization and p27 sequestration. (1999) (44)
- Acid sphingomyelinase regulates glucose and lipid metabolism in hepatocytes through AKT activation and AMP-activated protein kinase suppression (2011) (43)
- Insulin Resistance Increases MRI-Estimated Pancreatic Fat in Nonalcoholic Fatty Liver Disease and Normal Controls (2013) (42)
- Regulation of G(1) cyclin-dependent kinases in the liver: role of nuclear localization and p27 sequestration. (1999) (41)
- Role of acid sphingomyelinase of Kupffer cells in cholestatic liver injury in mice (2010) (39)
- Cdk2 plays a critical role in hepatocyte cell cycle progression and survival in the setting of cyclin D1 expression in vivo (2009) (39)
- Hepatic Stellate Cell–Macrophage Crosstalk in Liver Fibrosis and Carcinogenesis (2020) (39)
- MicroRNA-942 mediates hepatic stellate cell activation by regulating BAMBI expression in human liver fibrosis (2018) (38)
- C/EBPalpha triggers proteasome-dependent degradation of cdk4 during growth arrest. (2002) (38)
- The contribution of toll‐like receptor signaling to the development of liver fibrosis and cancer in hepatocyte‐specific TAK1‐deleted mice (2018) (38)
- Cyclin D3 maintains growth-inhibitory activity of C/EBPalpha by stabilizing C/EBPalpha-cdk2 and C/EBPalpha-Brm complexes. (2006) (37)
- Toll‐like receptor signaling in liver regeneration, fibrosis and carcinogenesis (2011) (36)
- NOD‐like receptor C4 Inflammasome Regulates the Growth of Colon Cancer Liver Metastasis in NAFLD (2019) (35)
- G&agr;12 ablation exacerbates liver steatosis and obesity by suppressing USP22/SIRT1-regulated mitochondrial respiration (2018) (34)
- Growth Hormone Corrects Proliferation and Transcription of Phosphoenolpyruvate Carboxykinase in Livers of Old Mice via Elimination of CCAAT/Enhancer-binding Protein α-Brm Complex* (2007) (34)
- Rapamycin‐sensitive induction of eukaryotic initiation factor 4F in regenerating mouse liver (2004) (33)
- Erratum to: Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition) (Autophagy, 12, 1, 1-222, 10.1080/15548627.2015.1100356 (2016) (33)
- Repeated hepatocyte injury promotes hepatic tumorigenesis in hepatitis C virus transgenic mice (2003) (33)
- Editorial :Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). DOI: 10.1080/15548627.2015.1100356;WOS:000373595400001; 2-s2.0-85013763791&;PMID: 26799652 (2016) (31)
- Proteasome inhibition attenuates hepatic injury in the bile duct-ligated mouse. (2006) (31)
- Restrictions in Cell Cycle Progression of Adult Vestibular Supporting Cells in Response to Ectopic Cyclin D1 Expression (2011) (31)
- Blockage of HGF/c-Met system by gene therapy (adenovirus-mediated NK4 gene) suppresses hepatocellular carcinoma in mice. (2006) (31)
- Mutation of the 5′-Untranslated Region Stem-Loop Structure Inhibits α1(I) Collagen Expression in Vivo* (2010) (31)
- Activation of the Transcription Factor GLI1 by WNT Signaling Underlies the Role of SULFATASE 2 as a Regulator of Tissue Regeneration* (2013) (29)
- Glial cell line-derived neurotrophic factor (GDNF) mediates hepatic stellate cell activation via ALK5/Smad signalling (2019) (28)
- Contribution of CD1d-unrestricted hepatic DX5+ NKT cells to liver injury in Plasmodium berghei-parasitized erythrocyte-injected mice. (2004) (28)
- LPS-TLR4 Pathway Mediates Ductular Cell Expansion in Alcoholic Hepatitis (2016) (23)
- S-adenosylmethionine and methylthioadenosine inhibit cancer metastasis by targeting microRNA 34a/b-methionine adenosyltransferase 2A/2B axis (2017) (23)
- A negative reciprocal regulatory axis between cyclin D1 and HNF4α modulates cell cycle progression and metabolism in the liver (2020) (22)
- A randomized trial of Chinese herbal medicines for the treatment of symptomatic hepatitis C. (2004) (22)
- Reciprocal Regulation Between Forkhead Box M1/NF‐κB and Methionine Adenosyltransferase 1A Drives Liver Cancer (2020) (22)
- Cyclin D1 represses peroxisome proliferator-activated receptor alpha and inhibits fatty acid oxidation (2016) (22)
- E2F/p107 and E2F/p130 complexes are regulated by C/EBPalpha in 3T3-L1 adipocytes. (1999) (22)
- Systemic mediators induce fibrogenic effects in normal liver after partial bile duct ligation (2006) (20)
- NCOA5, IL-6, type 2 diabetes, and HCC: The deadly quartet. (2014) (20)
- E1A modulates phosphorylation of p130 and p107 by differentially regulating the activity of G1/S cyclin/CDK complexes (2001) (20)
- Murine macrophage autophagy protects against alcohol-induced liver injury by degrading interferon regulatory factor 1 (IRF1) and removing damaged mitochondria (2019) (18)
- Modeling alcohol-associated liver disease in a human Liver-Chip. (2021) (18)
- Neurotropin Suppresses Inflammatory Cytokine Expression and Cell Death through Suppression of NF-κB and JNK in Hepatocytes (2014) (18)
- The role of NF-κB in hepatocarcinogenesis: Promoter or suppressor? (2007) (18)
- The liver fibrosis niche: Novel insights into the interplay between fibrosis-composing mesenchymal cells, immune cells, endothelial cells, and extracellular matrix. (2020) (17)
- Role of innate immune response in liver regeneration (2007) (17)
- Cyclin D1 regulates hepatic estrogen and androgen metabolism. (2010) (16)
- Evidence for a Novel Regulatory Interaction Involving Cyclin D1, Lipid Droplets, Lipolysis, and Cell Cycle Progression in Hepatocytes (2019) (16)
- The TM6SF2 variants, novel genetic predictors for nonalcoholic steatohepatitis. (2015) (15)
- Changes in cell cycle‐associated gene expression in a model of impaired liver regeneration (1994) (15)
- Liver epithelial cells proliferate under hypoxia and protect the liver from ischemic injury via expression of HIF-1 alpha target genes. (2012) (14)
- Toll-Like Receptor Signaling in Liver Diseases (2011) (14)
- Exosome Migration Inhibitory Factor as a Marker and Therapeutic Target for Pancreatic Cancer. (2016) (14)
- The mitochondrial chaperone Prohibitin 1 negatively regulates interleukin-8 in human liver cancers (2018) (13)
- Interventional Potential of Recombinant Feline Hepatocyte Growth Factor in a Mouse Model of Non-alcoholic Steatohepatitis (2018) (13)
- Promotion of cholangiocarcinoma growth by diverse cancer-associated fibroblast subpopulations. (2021) (13)
- The role of NF-kappaB in hepatocarcinogenesis: promoter or suppressor? (2007) (12)
- MEK inhibition suppresses K-Ras wild-type cholangiocarcinoma in vitro and in vivo via inhibiting cell proliferation and modulating tumor microenvironment (2019) (12)
- HEDGEHOG Signal in hepatocytes mediates macrophage recruitment: A new mechanism and potential therapeutic target for fatty liver disease (2016) (11)
- Influence of transcriptional regulation and mRNA stability on hemopexin gene expression in regenerating liver. (1994) (11)
- Oral administration of PEGylated TLR7 ligand ameliorates alcohol-associated liver disease via the induction of IL-22 (2020) (11)
- Microbiome-obesity-liver cancer interaction: senescence of hepatic stellate cells and bile acids play new roles. (2014) (10)
- TAK1-dependent autophagy: A suppressor of fatty liver disease and hepatic oncogenesis (2014) (9)
- Hepatocyte TGF‐β Signaling Inhibiting WAT Browning to Promote NAFLD and Obesity Is Associated With Let‐7b‐5p (2022) (9)
- Cell Metabolism Previews NCOA 5 , IL-6 , Type 2 Diabetes , and HCC : The Deadly Quartet (2014) (9)
- Depletion of mitochondrial methionine adenosyltransferase α1 triggers mitochondrial dysfunction in alcohol-associated liver disease (2022) (8)
- TAK1: A Molecular Link Between Liver Inflammation, Fibrosis, Steatosis, and Carcinogenesis (2021) (6)
- CYLD and HCC: when being too sensitive to your dirty neighbors results in self-destruction. (2012) (6)
- Modeling alcoholic liver disease in a human Liver-Chip (2020) (6)
- Apoptosis in Liver Injury and Liver Diseases (2009) (5)
- Inhibition of hyaluronan synthesis by 4-methylumbelliferone ameliorates non-alcoholic steatohepatitis in choline-deficient l-amino acid-defined diet-induced murine model (2021) (5)
- MafG, A Novel Target of FXR that Regulates Bile Acid Homeostasis. (2015) (5)
- Finding a new role for NEMO: A key player in preventing hepatocyte apoptosis and liver tumorigenesis by inhibiting RIPK1 (2016) (5)
- Hyaluronan synthase 2, a target of miR-200c, promotes carbon tetrachloride-induced acute and chronic liver inflammation via regulation of CCL3 and CCL4 (2022) (4)
- Effect of Weight Loss on MRI Estimation of Liver Fat and Volume in Patients With Nonalcoholic Steatohepatitis (2015) (4)
- Novel fate-tracing strategies show that hepatic stellate cells mediate fibrosis in vivo. (2014) (4)
- MET and epidermal growth factor signaling: The pillars of liver regeneration? (2016) (4)
- 88-Dependent Mechanism Receptor/Myeloid Differentiation Factor Liver Injury by an IL-12- and Toll-Like Infection in Mice Induces berghei Plasmodium (2001) (3)
- Global Spread of a Local Fire: Transmission of Endoplasmic Reticulum Stress via Connexin 43. (2021) (3)
- Cell Cycle Control in the Liver (2009) (3)
- Deregulated 14-3-3ζ and methionine adenosyltransferase α1 interplay promotes liver cancer tumorigenesis in mice and humans (2021) (3)
- Acrolein, a New Villain in the Development of Alcoholic Liver Disease (2016) (2)
- Astrocyte elevated gene-1 (AEG-1): a new potential therapeutic target for the treatment of nonalcoholic steatohepatitis (NASH). (2018) (2)
- Increase in Alcoholic Hepatitis as an Etiology for Liver Transplantation in the United States: A 2004–2018 Analysis (2020) (2)
- Transfusions to tattoos The danger of hepatitis C (1996) (2)
- 456 TAK1-Mediated Signaling Regulates AMPK and Autophagy Pathways That Prevent Hepatic Steatosis and Hepatocarcinogenesis in Mice (2013) (2)
- Rebleeding from gastroduodenal peptic ulcers in the age of endoscopic therapy (1996) (2)
- Markedly Increased Rate of Primary Liver Malignancies at Autopsy in Male US Veterans (2017) (2)
- A new mechanism of action of glucagon‐like peptide‐1 agonist in hepatic steatosis: Promotion of hepatic insulin clearance through induction of carcinoembryonic antigen‐related cell adhesion molecule 1 (2018) (2)
- An Epigenetic Switch Between Differentiation and Proliferation in Hepatoblastoma (2021) (2)
- Kupffer Cell TLR2/3 Signaling: A Pathway for EGCG Amelioration of Ethanol-Induced Hepatic Injury (2019) (2)
- Molecular and Cellular Pathobiology p 38 a Inhibits Liver Fibrogenesis and Consequent Hepatocarcinogenesis by Curtailing Accumulation of Reactive Oxygen Species (2012) (1)
- Toll‐like Receptors in Liver Disease (2020) (1)
- Serum Glial Cell Line-Derived Neurotrophic Factor (sGDNF) Is a Novel Biomarker in Predicting Cirrhosis in Patients with Chronic Hepatitis B (2021) (1)
- NF-κB restricts NLRP3 inflammasome activation via p62-dependent mitophagy which eliminates mitochondrial signals (2016) (1)
- Inhibition of hyaluronan synthesis by 4-methylumbelliferone ameliorates non-alcoholic steatohepatitis in choline-deficient l-amino acid-defined diet-induced murine model (2021) (1)
- Crossing the Rubicon: Adipose Tissue Autophagy Breaks Out NAFLD (2021) (1)
- AKT-MEDIATED LIVER GROWTH PROMOTES INDUCTION OF CYCLIN E THROUGH A NOVEL MECHANISM AND A p21-MEDIATED CELL CYCLE ARREST (2007) (1)
- The Way to the Liver Is Through the Pituitary Gland (2017) (1)
- Neurotropin Inhibits Lipid Accumulation by Maintaining Mitochondrial Function in Hepatocytes via AMPK Activation (2020) (1)
- 364 High Molecular Weight Adiponectin Inhibits Proliferation of Hepatic Stellate Cells Via Activation of AMP-Activated Protein Kinase (Ampk) (2008) (1)
- 690 Palmitic Acid and TLR2 Cooperatively Contribute to the Development of Nonalcoholic Steatohepatitis Through Inflammasome Activation (2012) (1)
- 43 Toll-Like Receptor 2 and 9 Promote Alcoholic Liver Injury Through Induction of CXCL-1 and CXCL-2 (2014) (1)
- Targeting A-kinase anchoring protein 12 phosphorylation in hepatic stellate cells regulates liver injury and fibrosis in mouse models (2022) (1)
- Hyaluronan in liver fibrosis: basic mechanisms, clinical implications, and therapeutic targets (2023) (1)
- ene Expression Profiles During Hepatic Stellate Cell Activation in ulture and In Vivo (2007) (1)
- Effects of chronic ethanol consumption on cytokine regulation of liver regeneration. (1998) (1)
- Hepatocyte Death in Liver Inflammation, Fibrosis, and Tumorigenesis (2017) (1)
- 105 Fatty acid amide hydrolase is a crucial determinant of anandamide-induced cell death in hepatic cell populations and mediates liver injury in vivo (2006) (1)
- 695 Fetuin-a Binding to TLR4 Regulates NASH and Fibrosis: The Role of TRIF (2014) (1)
- Nuclear Receptors: Opening Up New Avenues of Pediatric Fatty Liver Research (2018) (0)
- 4. Kupffer cells (2015) (0)
- New mitochondrial DNA synthesis enables NLRP3 inflammasome activation (2018) (0)
- Table of contents (2016) (0)
- Selected Summary An intestine-derived HDL as a novel regulator of the activity of gut-derived LPS: Ushering in a new era of research on the gut-liver axis. (2021) (0)
- S1887 Knockout of Sulfatase 2 (SULF2) Decreases Liver Regeneration After Partial Hepatectomy (2010) (0)
- Paper alert (2016) (0)
- MicroRNA-942 mediates hepatic stellate cell activation by regulating BAMBI expression in human liver fibrosis (2018) (0)
- Endocannabinoid Degradation and Oxidative Defense Mechanisms Determine Anandamide-induced Cell Death in Liver Cell Populations (2006) (0)
- Sa1651 TLR7 Signaling As a Mechanism and Therapeutic Target for Mouse Model of Alcoholic Hepatitis (2016) (0)
- Cyclin D1 regulates adipose triglyceride lipase (ATGL) to influence hepatic lipid droplet metabolism and cell proliferation (2016) (0)
- Intestinal Lipolysis Mitigates Nonalcoholic Fatty Liver Disease: New Roles for Carboxylesterase 2c in the Intestine (2019) (0)
- toll-like receptors their downstream molecules in the development of nonalcoholic Fatty liver disease. (2011) (0)
- Basic and Clinical Advances in Chronic Liver Inflammation (2016) (0)
- FAP: Not Just a Biomarker but Druggable Target in Liver Fibrosis (2023) (0)
- 647 TLR7 Signaling As Potential Therapeutic Target for Mouse Model of Alcoholic Hepatitis (2015) (0)
- MEK inhibition suppresses K-Ras wild-type cholangiocarcinoma in vitro and in vivo via inhibiting cell proliferation and modulating tumor microenvironment (2019) (0)
- The Contribution of Toll-Like Receptor Signaling to the Development of Liver Fibrosis and Cancer in Hepatocyte-Specific TAK 1-Deleted Mice Short Title : TLR 4 and TLR 9 Promote Liver Fibrosis and HCC In TAK 1 Knockout Mice (2017) (0)
- Capsaicin receptor TRPV1 maintains quiescence of hepatic stellate cells in the liver via recruitment of SARM1. (2023) (0)
- CCR2 Promotes the Progression of NASH in Mice (2011) (0)
- Cyclin D1 regulates hepatic lipid metabolism (2010) (0)
- Tumor Suppressor Down-Regulation Promotes Hepatocyte Proliferation: A New GANKster on the Block (2018) (0)
- M1565 The Role of Ccr2 in Hepatic Fibrosis and Cancer (2008) (0)
- Reply: To PMID 23996730. (2014) (0)
- Breast cancer liver metastasis: Pathogenesis and clinical implications (2022) (0)
- S3114 Painless Jaundice With a Significantly Elevated CA 19-9: It Is Not Always Pancreaticobiliary Cancer (2022) (0)
- Tu1272: GP130 PROMOTES THE DEVELOPMENT OF HEPATOCELLULAR CARCINOMA THROUGH INHIBITION OF BECLIN1-MEDIATED ABERRANT MITOPHAGY (2022) (0)
- Tu1028 Correlation Between Liver Histology and Novel Magnetic Resonance Imaging in Adult Patients With Nonalcoholic Fatty Liver Disease (2012) (0)
- 74 Toll-Like Receptor (TLR) 2 in Kupffer Cells Plays a Crucial Role in the Development of Steatohepatitis in Mice (2010) (0)
- 2 Sequence of Primers Used for Real-Time Quantitative PCR Gene Forward Reverse 18 s AGTCCCTGCCCTTTGTACACA CGATCCGAGGGCCTCACTA Bax GATCAGCTCGGGCACTTTAG TTGCTGATGGCAACTTCAAC Dgat 1 TCACCACACACCAATTCAGG GACGGCTACTGGGATCTGA Tnf AGGGTCTGGGCCATAGAACT CCACCACGCTCTTCTGTCTAC Il 1 b GGTCAAAGGTTTGGAAGCAG TGTGA (2013) (0)
- 90: UBC13-MEDIATED P62 UBIQUITINATION PROTECTS AGAINST NONALCOHOLIC STEATOHEPATITIS LINKED TO DEFECT IN MITOPHAGY (2022) (0)
- The ability of a matrix to support cell spreading correlates with its ability to promote cell growth ( (1999) (0)
- Reply (2014) (0)
- 644 Toll-Like Receptor (TLR) 9 Mediates Steatosis and Fibrosis Through Il1β in Diet-Induced Steatohepatitis in Mice (2009) (0)
- 383 Ablation of TGFbeta Receptor II Inhibits Liver Injury, Inflammation, Fibrosis and Carcinogenesis in Hepatocyte Specific TAK1 Deleted Mice (2012) (0)
- Extracellular matrix combinations differentially modulate hepatic stellate cell biology (2008) (0)
- 362 Phagocytic and Non-Phagocytic NADPH-Oxidase Isoforms Differentially Regulate Fibrosis But Not Steatosis in the Liver (2008) (0)
- 802 Tgfb Signaling Participates in Steatohepatitis Through the Induction of Cell Death and Suppression of Beta-Oxidation in Mice (2013) (0)
- Cytokine Release in Early Phase Clearance of Factor 88-Dependent Proinflammatory Critical Roles of Myeloid Differentiation (2002) (0)
- Phagocytic and non-phagocytic NADPH-oxidase isoforms differentially regulate fibrosis but not steatosis in the liver (2008) (0)
- A comparison of standard and induction interferon therapy with and without initial ribavirin in treatment na (2000) (0)
- Glial cell line-derived neurotrophic factor (GDNF) mediates hepatic stellate cell activation via ALK5/Smad signaling (2019) (0)
- The Role of IL-22 in a therapeutic effect of a new TLR7 ligand 1Z1 on mouse alcoholic steatohepatitis. (2017) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Ekihiro Seki?
Ekihiro Seki is affiliated with the following schools:
