Florent Soubrier
#133,284
Most Influential Person Now
Researcher
Florent Soubrier's AcademicInfluence.com Rankings
Florent Soubriercomputer-science Degrees
Computer Science
#5973
World Rank
#6300
Historical Rank
Machine Learning
#1786
World Rank
#1809
Historical Rank
Artificial Intelligence
#2034
World Rank
#2068
Historical Rank
Database
#3095
World Rank
#3225
Historical Rank

Download Badge
Computer Science
Florent Soubrier's Degrees
- PhD Computer Science Université Paris Cité
- Masters Computer Science Université Paris Cité
Similar Degrees You Can Earn
Why Is Florent Soubrier Influential?
(Suggest an Edit or Addition)Florent Soubrier's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. (1990) (3849)
- Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction (1992) (2045)
- Molecular basis of human hypertension: Role of angiotensinogen (1992) (1883)
- PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). (1992) (1344)
- Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. (1992) (1250)
- Protective role of interleukin-10 in atherosclerosis. (1999) (843)
- Angiotensin II type 1 receptor gene polymorphisms in human essential hypertension. (1994) (744)
- Two putative active centers in human angiotensin I-converting enzyme revealed by molecular cloning. (1988) (695)
- Genetics and genomics of pulmonary arterial hypertension. (2009) (641)
- Chromosomal mapping of two genetic loci associated with blood-pressure regulation in hereditary hypertensive rats (1991) (614)
- Synergistic effects of angiotensin-converting enzyme and angiotensin-II type 1 receptor gene polymorphisms on risk of myocardial infarction (1994) (444)
- Structure of the angiotensin I-converting enzyme gene. Two alternate promoters correspond to evolutionary steps of a duplicated gene. (1991) (425)
- The deletion/insertion polymorphism of the angiotensin converting enzyme gene and cardiovascular‐renal risk (1997) (405)
- EIF2AK4 mutations cause pulmonary veno-occlusive disease, a recessive form of pulmonary hypertension (2013) (344)
- Mutations of the TGF‐β type II receptor BMPR2 in pulmonary arterial hypertension (2006) (344)
- Peptidyl dipeptidase A: angiotensin I-converting enzyme. (1995) (315)
- Clinical outcomes of pulmonary arterial hypertension in carriers of BMPR2 mutation. (2008) (303)
- Influence of angiotensin-converting enzyme and angiotensin II type 1 receptor gene polymorphisms on aortic stiffness in normotensive and hypertensive patients. (1996) (286)
- Plasma Level and Gene Polymorphism of Angiotensin‐Converting Enzyme in Relation to Myocardial Infarction (1994) (280)
- Clinical outcomes of pulmonary arterial hypertension in patients carrying an ACVRL1 (ALK1) mutation. (2010) (275)
- The angiotensin I converting enzyme gene and predisposition to high blood pressure. (1993) (255)
- BMPR2 mutations and survival in pulmonary arterial hypertension: an individual participant data meta-analysis (2016) (249)
- Sustained increase in aortic endothelial nitric oxide synthase expression in vivo in a model of chronic high blood flow. (1996) (244)
- Endoglin germline mutation in a patient with hereditary haemorrhagic telangiectasia and dexfenfluramine associated pulmonary arterial hypertension (2004) (242)
- Whole-genome sequencing of patients with rare diseases in a national health system (2020) (239)
- Identification of rare sequence variation underlying heritable pulmonary arterial hypertension (2018) (238)
- Hypoxia-Induced Apelin Expression Regulates Endothelial Cell Proliferation and Regenerative Angiogenesis (2008) (234)
- Gene structure, polymorphism and mapping of the human endothelial nitric oxide synthase gene. (1994) (233)
- Guidelines for splicing analysis in molecular diagnosis derived from a set of 327 combined in silico/in vitro studies on BRCA1 and BRCA2 variants (2012) (232)
- Identification of new polymorphisms of the angiotensin I-converting enzyme (ACE) gene, and study of their relationship to plasma ACE levels by two-QTL segregation-linkage analysis. (1996) (232)
- Structural analysis and evaluation of the aldosterone synthase gene in hypertension. (1998) (229)
- BMPR2 gene rearrangements account for a significant proportion of mutations in familial and idiopathic pulmonary arterial hypertension (2006) (218)
- Genotype-phenotype relationships for the renin-angiotensin-aldosterone system in a normal population. (1999) (214)
- Identification of Hypoxia-response Element in the Human Endothelial Nitric-oxide Synthase Gene Promoter* (2003) (200)
- Genetic susceptibility for human familial essential hypertension in a region of homology with blood pressure linkage on rat chromosome 10. (1997) (191)
- Role of truncating mutations in MME gene in fetomaternal alloimmunisation and antenatal glomerulopathies (2004) (190)
- Pulmonary Arterial Hypertension: A Current Perspective on Established and Emerging Molecular Genetic Defects (2015) (187)
- Expression and characterization of recombinant human angiotensin I-converting enzyme. Evidence for a C-terminal transmembrane anchor and for a proteolytic processing of the secreted recombinant and plasma enzymes. (1991) (182)
- A novel channelopathy in pulmonary arterial hypertension. (2013) (181)
- Gene expression and tissue localization of the two isoforms of angiotensin I converting enzyme. (1993) (179)
- Lack of evidence for linkage of the endothelial cell nitric oxide synthase gene to essential hypertension. (1995) (176)
- Genetics and genomics of pulmonary arterial hypertension (2019) (169)
- Molecular genetic characterization of SMAD signaling molecules in pulmonary arterial hypertension (2011) (166)
- Influence of angiotensin II type 1 receptor polymorphism on aortic stiffness in never-treated hypertensive patients. (1995) (165)
- Pulmonary veno-occlusive disease (2016) (156)
- Myocardial recruitment during ANF mRNA increase with volume overload in the rat. (1986) (153)
- The testicular transcript of the angiotensin I‐converting enzyme encodes for the ancestral, non‐duplicated form of the enzyme (1989) (151)
- Angiotensinogen: a candidate gene involved in preeclampsia? (1993) (150)
- Cloning and Expression of an Evolutionary Conserved Single-domain Angiotensin Converting Enzyme from Drosophila melanogaster(*) (1995) (147)
- Evidence for a familial pregnancy-induced hypertension locus in the eNOS-gene region. (1997) (144)
- Human Mineralocorticoid Receptor Genomic Structure and Identification of Expressed Isoforms (*) (1995) (140)
- Pulmonary arterial hypertension associated with fenfluramine exposure: report of 109 cases (2008) (135)
- Genetic determinants of diastolic and pulse pressure map to different loci in Lyon hypertensive rats (1993) (130)
- Genetics and genomics of pulmonary arterial hypertension. (2013) (124)
- High-level protein secretion into blood circulation after electric pulse-mediated gene transfer into skeletal muscle. (2000) (120)
- Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France (2004) (117)
- Somatic mosaicism and double somatic hits can lead to MSI colorectal tumors (2013) (115)
- Recent advances in knowledge of the structure and function of the angiotensin I converting enzyme (1995) (112)
- Angiotensin-1-converting enzyme (ACE) plasma concentration is influenced by multiple ACE-linked quantitative trait nucleotides. (2002) (107)
- Evaluation of the angiotensinogen locus in human essential hypertension: a European study. (1998) (106)
- Clinical phenotypes and outcomes of heritable and sporadic pulmonary veno-occlusive disease: a population-based study. (2017) (104)
- Similar Frequencies of Renin Gene Restriction Fragment Length Polymorphisms in Hypertensive and Normotensive Subjects (1990) (101)
- Genome-wide association analysis identifies a susceptibility locus for pulmonary arterial hypertension (2013) (99)
- hypertension Angiotensin II type 1 receptor gene polymorphisms in human essential (2009) (98)
- The Wnt/beta‐catenin pathway is activated during advanced arterial aging in humans (2011) (98)
- Absence of influence of gender and BMPR2 mutation type on clinical phenotypes of pulmonary arterial hypertension (2010) (95)
- M235T variant of the human angiotensinogen gene in unselected hypertensive patients (1993) (94)
- Circulating and cellular markers of endothelial dysfunction with aging in rats. (1997) (93)
- Whole genome sequencing of a sporadic primary immunodeficiency cohort (2018) (92)
- Molecular biology of the angiotensin I converting enzyme: I. Biochemistry and structure of the gene. (1993) (91)
- Nonproportional changes in plasma renin concentration, renal renin content, and rat renin messenger RNA. (1985) (87)
- Genetic counselling in a national referral centre for pulmonary hypertension (2015) (85)
- Phenotypic Characterization of EIF2AK4 Mutation Carriers in a Large Cohort of Patients Diagnosed Clinically With Pulmonary Arterial Hypertension (2017) (84)
- High-resolution genetic mapping of the ACE-linked QTL influencing circulating ACE activity (2002) (84)
- Molecular biology of the angiotensin I converting enzyme: II. Structure-function. Gene polymorphism and clinical implications. (1993) (83)
- Genetic determinants of risk in pulmonary arterial hypertension: international genome-wide association studies and meta-analysis (2019) (81)
- A single cDNA encodes two isoforms of stathmin, a developmentally regulated neuron-enriched phosphoprotein. (1989) (80)
- Occupational exposure to organic solvents: a risk factor for pulmonary veno-occlusive disease (2015) (79)
- Genetic Variability in the Renin-Angiotensin System: Prevalence of Alleles and Genotypes (1997) (79)
- Identification of two active site residues in human angiotensin I-converting enzyme. (1994) (77)
- Diagnosis of Constitutional Mismatch Repair-Deficiency Syndrome Based on Microsatellite Instability and Lymphocyte Tolerance to Methylating Agents. (2015) (77)
- Drosophila melanogaster angiotensin I-converting enzyme expressed in Pichia pastoris resembles the C domain of the mammalian homologue and does not require glycosylation for secretion and enzymic activity. (1996) (72)
- Detection of putative functional angiotensinogen (AGT) gene variants controlling plasma AGT levels by combined segregation-linkage analysis (2002) (71)
- Genetic analyses in a cohort of children with pulmonary hypertension (2016) (70)
- Quantitative PCR high‐resolution melting (qPCR‐HRM) curve analysis, a new approach to simultaneously screen point mutations and large rearrangements: application to MLH1 germline mutations in Lynch syndrome (2009) (70)
- Pulmonary Hypertension in Patients With Neurofibromatosis Type I (2011) (64)
- Molecular biology and genetics of the angiotensin-I-converting enzyme: potential implications in cardiovascular diseases. (1996) (64)
- The angiotensin converting enzyme in the kidney. (1989) (64)
- Molecular cloning and nucleotide sequence of a human renin cDNA fragment. (1983) (63)
- Study of V1-vascular Vasopressin Receptor Gene Microsatellite Polymorphisms in Human Essential Hypertension☆ (2000) (63)
- No alteration in the primary structure of the mineralocorticoid receptor in a family with pseudohypoaldosteronism. (1994) (63)
- The contribution of germline rearrangements to the spectrum of BRCA2 mutations (2006) (61)
- Molecular genetics of the renin-angiotensin-aldosterone system in human hypertension. (1997) (61)
- Genetic and Environmental Influences on Left Ventricular Mass: A Family Study (2000) (61)
- Arginine vasopressin gene expression in chronic cardiac failure in rats. (1990) (61)
- BMPR2 mutation status influences bronchial vascular changes in pulmonary arterial hypertension (2016) (61)
- Screening for Lynch Syndrome in Colorectal Cancer: Are We Doing Enough? (2012) (60)
- The insertion/deletion polymorphism of the angiotensin-converting enzyme gene and car-diovascular-renal risk : a meta-analysis (1997) (59)
- Role of the renin-angiotensin system in blood pressure regulation and in human hypertension: new insights from molecular genetics. (1995) (59)
- Characterization of an Upstream Enhancer Region in the Promoter of the Human Endothelial Nitric-oxide Synthase Gene* (2000) (58)
- Germline RAD51C mutations in ovarian cancer susceptibility (2013) (58)
- Functional mechanisms underlying pleiotropic risk alleles at the 19p13.1 breast–ovarian cancer susceptibility locus (2016) (58)
- Sib pair linkage analysis of renin gene haplotypes in human essential hypertension (2004) (57)
- Widening the landscape of heritable pulmonary hypertension mutations in paediatric and adult cases (2019) (56)
- Characterization of GDF2 Mutations and Levels of BMP9 and BMP10 in Pulmonary Arterial Hypertension. (2020) (55)
- Structural analysis and evaluation of the 11β‐hydroxysteroid dehydrogenase type 2 (11β‐HSD2) gene in human essential hypertension (1998) (54)
- Point Mutation in the Stalk of Angiotensin-Converting Enzyme Causes a Dramatic Increase in Serum Angiotensin-Converting Enzyme But No Cardiovascular Disease (2001) (52)
- Evaluation of the SA locus in human hypertension. (1995) (52)
- Unexplained polyposis: a challenge for geneticists, pathologists and gastroenterologists (2012) (47)
- Increased Shedding of Angiotensin-converting Enzyme by a Mutation Identified in the Stalk Region* (2001) (47)
- Dinucleotide repeat polymorphism in the human angiotensinogen gene. (1991) (47)
- Proteomic identification of target proteins in normal but nonfertilizing sperm. (2014) (46)
- Phorbol Ester Induction of Angiotensin-Converting Enzyme Transcription Is Mediated by Egr-1 and AP-1 in Human Endothelial Cells via ERK1/2 Pathway (2002) (46)
- Familial breast cancer and DNA repair genes: Insights into known and novel susceptibility genes from the GENESIS study, and implications for multigene panel testing (2018) (45)
- Angiotensin I-converting enzyme genotype influences arterial response to injury in normotensive rats. (1998) (45)
- Atorvastatin prevents Plasmodium falciparum cytoadherence and endothelial damage (2011) (44)
- Study of V(1)-vascular vasopressin receptor gene microsatellite polymorphisms in human essential hypertension. (2000) (44)
- Differential expression of rat frizzled-related frzb-1 and frizzled receptor fz1 and fz2 genes in the rat aorta after balloon injury. (2000) (43)
- Induction of Angiotensin I-converting Enzyme Transcription by a Protein Kinase C-dependent Mechanism in Human Endothelial Cells* (1998) (41)
- Angiotensin II (type-1) receptor locus: CA repeat polymorphism and genetic mapping. (1994) (41)
- Familial pulmonary arterial hypertension by KDR heterozygous loss of function (2020) (40)
- Pulmonary vascular remodeling patterns and expression of general control nonderepressible 2 (GCN2) in pulmonary veno-occlusive disease. (2017) (40)
- [Li-Fraumeni syndrome: update, new data and guidelines for clinical management]. (2001) (40)
- Can the genetic factors influence the treatment of systemic hypertension? The case of the renin-angiotensin-aldosterone system. (1992) (39)
- Mechanisms of exertional dyspnoea in pulmonary veno-occlusive disease with EIF2AK4 mutations (2014) (39)
- Lack of referral for genetic counseling and testing in BRCA1/2 and Lynch syndromes: a nationwide study based on 240,134 consultations and 134,652 genetic tests (2013) (38)
- Loss-of-Function ABCC8 Mutations in Pulmonary Arterial Hypertension (2018) (38)
- Clinical implications of the molecular biology of the renin-angiotensin system. (1990) (38)
- Inhibition of apelin expression by BMP signaling in endothelial cells. (2012) (37)
- No evidence for point mutations of the calcium-sensing receptor in familial idiopathic hypercalciuria. (2001) (37)
- Hereditary hemorrhagic telangiectasia: evidence for regional founder effects of ACVRL1 mutations in French and Italian patients (2008) (37)
- Molecular genetics and clinical features of Chinese idiopathic and heritable pulmonary arterial hypertension patients (2011) (36)
- Small platelet microparticle levels are increased in pulmonary arterial hypertension (2013) (36)
- Genetic basis of hypertension. (1995) (36)
- A parametric copula model for analysis of familial binary data. (1999) (35)
- Prospective evaluation of genetic abnormalities and telomerase expression in exfoliated urinary cells for bladder cancer detection. (2002) (34)
- Angiotensin I converting enzyme gene: regulation, polymorphism and implications in cardiovascular diseases. (1994) (33)
- Characteristics of pulmonary arterial hypertension in affected carriers of a mutation located in the cytoplasmic tail of bone morphogenetic protein receptor type 2. (2015) (32)
- Detection and localization of renin messenger RNA in human pathologic tissues using in situ hybridization. (1988) (31)
- Glucagon receptor gene mutation (Gly40Ser) in human essential hypertension: the PEGASE study. (1999) (31)
- Renin gene expression in the aging kidney: effect of sodium restriction (1995) (31)
- Localization of renin gene expression to monkey ovarian theca cells by in situ hybridization. (1992) (30)
- MYH biallelic mutation can inactivate the two genetic pathways of colorectal cancer by APC or MLH1 transversions (2010) (30)
- Resident PW1+ Progenitor Cells Participate in Vascular Remodeling During Pulmonary Arterial Hypertension. (2016) (29)
- Blood pressure gene at the angiotensin I-converting enzyme locus: chronicle of a gene foretold. (1998) (28)
- Segmental homology between the promoter region of the human renin gene and the mouse ren1 and ren2 promoter regions. (1986) (28)
- ACVRL1 germinal mosaic with two mutant alleles in hereditary hemorrhagic telangiectasia associated with pulmonary arterial hypertension (2012) (27)
- Functional analysis of the human somatic angiotensin I-converting enzyme gene promoter. (1993) (27)
- Profiling of Aortic Smooth Muscle Cell Gene Expression in Response to Chronic Inhibition of Nitric Oxide Synthase in Rats (2004) (27)
- Molecular genetics of the renin-angiotensin-aldosterone system in human hypertension (1995) (27)
- De Novo Truncating Mutations in WASF1 Cause Intellectual Disability with Seizures (2018) (26)
- The Angiotensin I‐Converting Enzyme (Kininase II): Progress in Molecular and Genetic Structure (1990) (26)
- The TP53 Arg72Pro and MDM2 309G>T polymorphisms are not associated with breast cancer risk in BRCA1 and BRCA2 mutation carriers (2009) (25)
- Screening for pulmonary arterial hypertension in adults carrying a BMPR2 mutation (2020) (24)
- Clinical and genetic findings in children with central nervous system arteriovenous fistulas (2017) (24)
- Altered endothelial gene expression associated with hereditary haemorrhagic telangiectasia (2007) (24)
- Circulating and cellular markers of endothelial dysfunction with aging in rats. (1997) (24)
- Infertilité masculine chez les patients normospermiques : analyse protéomique des spermes normaux non fécondants en fécondation in vitro classique (2009) (23)
- The high‐molecular‐mass kininogen deficient rat expresses all kininogen mRNA species, but does not export the high‐molecular‐mass kininogen synthesized (1988) (22)
- The angiotensin I-converting enzyme gene polymorphism: implication in hypertension and myocardial infarction. (1994) (21)
- Genetic studies of the renin‐angiotensin system in arterial hypertension associated with non‐insulin‐dependent diabetes mellitus (1997) (21)
- Clinical and genetic characteristics of Chinese patients with hereditary haemorrhagic telangiectasia–associated pulmonary hypertension (2013) (21)
- Clinical implications of CTNNA1 germline mutations in asymptomatic carriers (2018) (21)
- Biochemical and immunological characterization of ectopic tumoral renin. (1982) (20)
- Prevalence of mutations in APC, CTNNB1, and BRAF in Tunisian patients with sporadic colorectal cancer. (2008) (20)
- Monoclonal antibody against human renin. (1981) (19)
- Chronic graft dysfunction in renal transplant patients1: potential role of plasminogen activator inhibitor type 1 (2002) (19)
- A one-step prescreening for point mutations and large rearrangement in BRCA1 and BRCA2 genes using quantitative polymerase chain reaction and high-resolution melting curve analysis. (2010) (19)
- A genetic study of angiotensin I-converting enzyme levels in human semen (1995) (19)
- Oral contraceptive use and ovarian cancer risk for BRCA1/2 mutation carriers: an international cohort study (2021) (18)
- Arginine vasopressin gene regulation in the homozygous Brattleboro rat. (1990) (18)
- Bayesian Inference Associates Rare KDR Variants With Specific Phenotypes in Pulmonary Arterial Hypertension (2019) (18)
- Single-cell Study of Two Rat Models of Pulmonary Arterial Hypertension Reveals Connections to Human Pathobiology and Drug Repositioning. (2020) (17)
- Comparison of Human and Experimental Pulmonary Veno-Occlusive Disease. (2020) (17)
- The genetic basis of hypertension. (1994) (17)
- A study of chimeras constructed with the two domains of angiotensin I-converting enzyme. (1996) (17)
- Short report: HYPERGENE a clinical and genetic database for genetic analysis of human hypertension (1994) (16)
- [Unexpected in vitro fertilization failure in patients with normal sperm: a proteomic analysis]. (2009) (16)
- Molecular biology of the angiotensin I converting enzyme (1996) (16)
- Phenotype and outcome of pulmonary arterial hypertension patients carrying a TBX4 mutation (2020) (16)
- A mutant renin gene in familial elevation of prorenin. (1994) (16)
- Mendelian randomisation analysis of red cell distribution width in pulmonary arterial hypertension (2019) (16)
- The application of molecular genetics to the study of familial arterial hypertension. (1990) (15)
- Identification of two polymorphisms in the early growth response protein-1 gene: possible association with lipid variables (2000) (15)
- Molecular biology and molecular genetics of nitric oxide synthase genes. (1996) (15)
- Evidence against haploinsuffiency of human ataxin 10 as a cause of spinocerebellar ataxia type 10 (2010) (15)
- GENESIS: a French national resource to study the missing heritability of breast cancer (2016) (15)
- A case-only study to identify genetic modifiers of breast cancer risk for BRCA1/BRCA2 mutation carriers (2021) (15)
- Regional mapping of the human renin gene to 1q32 by in situ hybridization. (1989) (15)
- Mutation du gène MSH2 dans le syndrome de Muir-Torre (1999) (14)
- Structural analysis and evaluation of the 11beta-hydroxysteroid dehydrogenase type 2 (11beta-HSD2) gene in human essential hypertension. (1998) (14)
- Mendelian randomisation and experimental medicine approaches to interleukin-6 as a drug target in pulmonary arterial hypertension (2021) (13)
- Functional study of the germinal angiotensin I-converting enzyme promoter. (1992) (13)
- Bone Morphogenetic Proteins Protect Pulmonary Microvascular Endothelial Cells From Apoptosis by Upregulating &agr;-B-Crystallin (2013) (13)
- Somatic mutation of MutYH in Tunisian patients with sporadic colorectal cancer (2007) (13)
- Molecular characterization of the mineralocorticoid receptor in pseudohypoaldosteronism (1995) (13)
- Renin-angiotensin system genes as candidate genes in cardiovascular diseases. (1993) (12)
- Biological heterogeneity in idiopathic pulmonary arterial hypertension identified through unsupervised transcriptomic profiling of whole blood (2021) (12)
- Expression and Characterization of Recombinant Human Angiotensin I-converting Enzyme (2001) (12)
- Somatic c.34G>T KRAS mutation: a new prescreening test for MUTYH-associated polyposis? (2015) (11)
- Isoform‐specific regulation of nitric oxide synthase mRNA in the kidney by sodium and blood pressure (1998) (11)
- RENIN SECRETION FROM MALIGNANT PULMONARY METASTATIC TUMOUR CELLS OF VASCULAR ORIGIN (1987) (11)
- Role of rare variants in undetermined multiple adenomatous polyposis and early-onset colorectal cancer (2012) (11)
- From an ACE polymorphism to genome-wide searches for eQTL. (2013) (11)
- The enigma of pseudohypoaldosteronism (1994) (11)
- The Peculiar Characteristics of the Amino Acid Sequence of Angiotensin I‐Converting Enzyme, as Determined by cDNA Cloning of the Human Endothelial Enzyme (1989) (11)
- HYPERGENE: a clinical and genetic database for genetic analysis of human hypertension (1994) (11)
- Counter-regulation by atorvastatin of gene modulations induced by L-NAME hypertension is associated with vascular protection. (2009) (10)
- The enigma of pseudohypoaldosteronism. (1994) (10)
- A monoclonal antibody for immunopurification of human renin. (1981) (10)
- No evidence of the APC D1822V missense variant's pathogenicity in Tunisian patients with sporadic colorectal cancer. (2009) (9)
- Progenitor/Stem Cells in Vascular Remodeling during Pulmonary Arterial Hypertension (2021) (9)
- Lack of Association of the Prothrombin Gene Variant G20210A with Myocardial Infarction in Caucasian Males (2000) (8)
- Plasticity-related gene-1 inhibits lysophosphatidic acid-induced vascular smooth muscle cell migration and proliferation and prevents neointima formation. (2012) (8)
- Deep vein thrombosis during enoxaparin prophylactic treatment in a young pregnant woman homozygous for factor V Leiden and heterozygous for the G127 ← A mutation in the thrombomodulin gene (2000) (8)
- Role and identification of the genes involved in human hypertension. (1994) (8)
- L'endothélium, site de production et de métabolisme des peptides vaso-actifs (1993) (8)
- First genetic analysis in Tunisian familial adenomatous polyposis probands. (2008) (8)
- The deletion/insertion polymorphism of the ACE gene and cardiovascular-renal risk (1997) (7)
- Non‐invasive CT screening for pulmonary arteriovenous malformations in children with confirmed hereditary hemorrhagic telangiectasia: Results from two pediatric centers (2017) (7)
- Phenotype and outcome of PAH patients carrying a TBX4 mutation. (2020) (7)
- [Medical care of brain malformative vascular diseases discovered during the pre- or neonatal period]. (2013) (7)
- Pulmonary arterial hypertension in familial hemiplegic migraine with ATP1A2 channelopathy (2013) (7)
- The frequency of the factor V gene R506Q mutation varies between regions of France. (1995) (6)
- Frequent mutation in North African patients with MUTYH‐associated polyposis (2011) (6)
- RASA1 phenotype overlaps with hereditary haemorrhagic telangiectasia: two case reports (2020) (6)
- Mouse submaxillary renin: a useful model for the study of renal renin. (1983) (6)
- Prise en charge des malformations vasculaires cérébrales découvertes en période ante- ou néonatale (2013) (5)
- Proteomic analysis of BRCA1‐depleted cell line reveals a putative role for replication protein A2 up‐regulation in BRCA1 breast tumor development (2010) (5)
- An emerging phenotype of pulmonary arterial hypertension patients carrying SOX17 variants (2022) (5)
- Pulmonary arterial hypertension in a patient with Cowden syndrome and anorexigen exposure. (2011) (5)
- Activation of renin in an anaplastic pulmonary adenocarcinoma. (1981) (5)
- [Mutation in the MSH2 gene in Muir-Torre syndrome]. (1999) (5)
- Search for the genes of human essential hypertension (1993) (4)
- A ploidy-agnostic method for estimating telomere length from whole genome sequencing data. (2018) (4)
- Modalités de fonctionnement d’un centre de suivi des femmes à haut risque de cancer du sein et de l’ovaire : une expérience à l’hôpital Tenon (2010) (4)
- TET2: A Bridge Between DNA Methylation and Vascular Inflammation. (2020) (4)
- Nitric oxide synthase genes: candidate genes among many others. (1999) (4)
- The D/I polymorpism of the ACE gene and cardiovascular-renal risk (1997) (3)
- Clinical Outcomes of Pulmonary Arterial Hypertension in Carriers of ACVRL1 (ALK1) Mutation. (2009) (3)
- Platelet‐Derived Growth Factor Receptor Type α Activation Drives Pulmonary Vascular Remodeling Via Progenitor Cell Proliferation and Induces Pulmonary Hypertension (2022) (3)
- Higher prevalence of splenic artery aneurysms in hereditary hemorrhagic telangiectasia: Vascular implications and risk factors (2020) (3)
- [Molecular aspects of the expression and regulation of endothelial nitric oxide synthase]. (2000) (3)
- Un gène pour l'hypertension artérielle pulmonaire primitive. (2001) (3)
- Gordon’s syndrome, renal tubule, chromosome 17 and essential hypertension: a credible link? (1998) (3)
- A new hybrid record linkage process to make epidemiological databases interoperable: application to the GEMO and GENEPSO studies involving BRCA1 and BRCA2 mutation carriers (2020) (3)
- Letters to the Editor will be published, if suitable, as space permits. They should not exceed 1000 words (typed, double-spaced) in length and may be subject to editing or abridgment. (2007) (3)
- Diffusion et validation des tests génétiques en France (2009) (3)
- A7: Search for susceptibility loci to hypertension in a region on human chromosome 20Q, the homologous region to rat chromosome 3 (1997) (2)
- Association between blood pressure, hypertension and polymorphisms of the aldosterone synthase and ?-adducin genes in a Belgian population study (2000) (2)
- M1291 Familial Pancreatic Cancer: BRCA2, CDKN2A and CDk 4 Gene Alterations and Screening of Relatives (2009) (2)
- Genomics of Pulmonary Arterial Hypertension (2013) (2)
- A recombinant form of angiotensin converting enzyme expressed from baculovirus-infected insect cells. (1994) (2)
- Disruption of GCN2 Pathway Aggravates Vascular and Parenchymal Remodeling During Pulmonary Fibrosis. (2022) (2)
- Molecular Genetics of Hypertension (1999) (2)
- Human MutationMETHODS Quantitative PCR High-Resolution Melting ( qPCR-HRM ) Curve Analysis , a New Approach to Simultaneously Screen Point Mutations and Large Rearrangements : Application to MLH 1 Germline Mutations in Lynch Syndrome (2009) (2)
- Aspects moléculaires de l'expression et de la régulation de la synthase endothéliale du monoxyde d'azote : Monoxyde d'azote et système cardiovasculaire (2000) (2)
- [Polymorphism of the renin-angiotensin-aldosterone system: molecular and epidemiogenetic aspects]. (1998) (2)
- Lung Progenitor Cells Expressing PW1 Gene Participate in Vascular Remodeling During Pulmonary Arterial Hypertension (2015) (2)
- Whole-genome sequencing of a sporadic primary immunodeficiency cohort (2020) (2)
- Molecular Genetic Diagnosis of Pulmonary Arterial Hypertension: An Increased Complexity. (2016) (2)
- [A gene for primary pulmonary artery hypertension]. (2001) (2)
- mutation type on clinical phenotypes of pulmonary arterial hypertension (2010) (2)
- Place de la génétique dans l'évaluation du risque chez l'hypertendu. (1997) (2)
- Somatic mutational landscape of extracranial arteriovenous malformations and phenotypic correlations (2022) (2)
- In Vitro fertilization failure of normozoospermic men: search for a lack of testicular isozyme of angiotensin-converting enzyme (2013) (1)
- Comparative mapping of novel simple sequence repeat markers in a hypertension-related region on rat chromosome 1 (1997) (1)
- Somatic mosaicism and double somatic hits can lead to MSI colorectal tumors (2012) (1)
- IFCT0401-bio trial: Pathological and EGF-r molecular analysis of tumor-biopsy samples from patients with non-resectable, pneumonic-type adenocarcinoma (P-ADC) treated by gefinitib. Preliminary results from surgical specimens. (2006) (1)
- Prenatal molecular diagnosis in RASA1‐related disease (2017) (1)
- Can the genes of hypertension be identified? (1998) (1)
- Facteur V Leiden, hyperhomocystéinémie, mutation C677T de la MTHFR, mutation G20210A de la prothrombine et complications obstétricales (1999) (1)
- Arteriovenous Cerebral High Flow Shunts in Children: From Genotype to Phenotype (2022) (1)
- Identification of novel rare sequence variation underlying heritable pulmonary arterial hypertension (2018) (1)
- Diagnostic chest X-rays and breast cancer risk among women with a hereditary predisposition to breast cancer unexplained by a BRCA1 or BRCA2 mutation (2021) (1)
- The Inhibition Of MRP4, A New Target In Pulmonary Arterial Hypertension, Prevents And Reverses Hypoxia-induced Pulmonary Hypertension In Mice (2010) (1)
- [Molecular biology and genetics of NO synthases]. (1995) (1)
- A CELSR1 variant in a patient with pulmonary arterial hypertension (2021) (1)
- Referral for genetic counseling and testing in BRCA1/2 and Lynch syndromes: A nationwide study based on 240,134 consultations and 134,652 genetic tests. (2013) (1)
- The vascular wall as a target for association studies by the candidate gene approach. (1996) (1)
- Molecular cloning and complete amino acid sequence of human angiotensin i converting enzyme (1988) (1)
- Conseil génétique dans la maladie de Rendu-Osler (2004) (1)
- Novel causative genes for heritable pulmonary arterial hypertension (2017) (1)
- Angiotensin I-converting enzyme (ACE) gene structure and polymorphism: Relation to enzyme function and gene expression (2018) (1)
- Publisher Correction: Whole-genome sequencing of a sporadic primary immunodeficiency cohort (2020) (1)
- Rare variant analysis of 4241 pulmonary arterial hypertension cases from an international consortium implicates FBLN2, PDGFD, and rare de novo variants in PAH (2021) (1)
- Molecular Genetics and Familial Arterial Hypertension (1991) (1)
- [Normal pulmonary capillary pressure in hemodynamic pulmonary edema]. (1978) (0)
- Pulmonary arterial lesions and interstitial remodeling patterns in histology differentiate EIF2AK4 mutation-carriers from non-carriers with pulmonary veno-occlusive disease (2015) (0)
- PlasmaLevel andGenePolymorphism ofAngiotensin-Converting Enzymein Relation toMyocardial Infarction (1994) (0)
- [Role of genetics in the risk assessment of hypertensive patients]. (1997) (0)
- Identification of the BMP target genes in vascular cells (2006) (0)
- PROFILING OF AORTIC SMOOTH MUSCLE CELLS GENE EXPRESSION IN RESPONSE TO ACCELERATED HYPERTENSION IN RATS: P1.154 (2004) (0)
- Nucleic acid encoding the converting enzyme (ACE) human testicular and its applications, in particular for the in vitro detection of said enzyme in the body. (1990) (0)
- Abstract 12841: Mutations in the BMPR2 Gene Are Associated With Worse Survival in Patients With Pulmonary Arterial Hypertension (2015) (0)
- Diagnostic chest X-rays and breast cancer risk among women with a hereditary predisposition to breast cancer unexplained by a BRCA1 or BRCA2 mutation (2021) (0)
- 5022Clinical phenotypes and outcomes of heritable and sporadic pulmonary veno-occlusive disease (2017) (0)
- Receptor for advanced glycation endproducts controls deleterious lung inflammation in severe Pseudomonas aeruginosa pneumonia in immunosuppressed mice (2012) (0)
- [Hereditary factors of essential arterial hypertension]. (1990) (0)
- Disease gene discovery for Familial IgA Nephropathy (FIgAN) by Whole Exome Sequencing (WES) (2015) (0)
- Publisher Correction: Telomerecat: A ploidy-agnostic method for estimating telomere length from whole genome sequencing data (2018) (0)
- Author response for "A CELSR1 variant in a patient with pulmonary arterial hypertension" (2021) (0)
- Nucleic acid encoding the angiotensin converting enzyme (ACE) human, and its applications, especially for the in vitro diagnosis of hypertension (1988) (0)
- Major genetic risk factors in familial breast and colorectal cancers in North Tunisia (2008) (0)
- Identification of rare sequence variation underlying heritable pulmonary arterial hypertension (2018) (0)
- Method for detection and in vitro diagnostic kit of a predisposition to myocardial infarction (1994) (0)
- Novel uAUG creating variants in the 5’UTR of ENG causing Hereditary Hemorrhagic Telangiectasia (2022) (0)
- Telomerecat: A ploidy-agnostic method for estimating telomere length from whole genome sequencing data (2018) (0)
- Detection and Localization ofRenin Messenger RNA in Human Pathologic Tissues Using In Situ Hybridization (2007) (0)
- I039 Role of PRG-1, a neuronal phospholipid phosphatase, in the function of vascular smooth muscle cells (2009) (0)
- Abstract 14753: Loss of Function ABCC8 Mutations Are Associated With Pulmonary Arterial Hypertension (2017) (0)
- Gene variants of angiotensinogen and predisposition to hypertension (1993) (0)
- 1.P.377 Evaluation of the angiotensinogen locus in human essential hypertension: An European study (1997) (0)
- [Diagnostic value of computerized tomography in severe renal tissue infections (author's transl)]. (1981) (0)
- Clinical and Molecular Findings in a Cohort of Children with Central Nervous System Arteriovenous Fistulas (2017) (0)
- Phenotype and outcome of PAH patients carrying a TBX4 mutation (2020) (0)
- 25 Testing a genetic linkage between the renin gene and arterial hypertension: analysis of 98 hypertensive sibling pairs (1991) (0)
- Biologie moléculaire et génétique des NO synthases. (1995) (0)
- Conseil génétique dans l’hypertension artérielle pulmonaire (2012) (0)
- Identification de deux loci associés à la régulation de la pression artérielle chez le rat génétiquement hypertendu (1991) (0)
- Structure et expression des genes des enzymes de maturation du systeme renine-angiotensine (1990) (0)
- Déterminisme génétique de l'hypertension artérielle humaine et rôle potentiel du gène de la rénine (1991) (0)
- Modifications du génome des cellules germinales et de l’embryon humains (2016) (0)
- Prédisposition génétique au cancer du sein et de l'ovaire : Aspects moléculaires et génétiques (2003) (0)
- TET2 (2020) (0)
- CO.61 Cancer du pancréas familial (CaPaFa) : prévalence des mutations des gènes CDKN2A, CDK4 et BRCA2 et résultats préliminaires du dépistage par imagerie des sujets apparentés (2009) (0)
- 2 SPLF Automne 2007: Étude de la régulation de l’Apeline par les BMP dans les cellules vasculaires pulmonaires (2008) (0)
- Polymorphisme du gène de l'enzyme de conversion et maladies cardiovasculaires (1995) (0)
- La démarche de validation d'un logiciel : Réflexions méthodologiques et aspects d'un cas pratique (2000) (0)
- Caractéristiques des patients atteints de maladie veino-occlusive porteurs de mutations du gène EIF2AK4 (2016) (0)
- Femmes à haut risque de cancer mammaire : vers des unités et réseaux de surveillance (2011) (0)
- Rapport et recommandations sur la mise en œuvre en France des techniques de séquençage de nouvelle génération (2016) (0)
- The Renin Gene (1987) (0)
- Génétique des cancers de l’ovaire et prise en charge des personnes à haut risque (2012) (0)
- Hypertension pulmonaire associée à la neurofibromatose de type 1 : données du registre français de l’hypertension pulmonaire (2020) (0)
- Comparaison de trois réactifs pour la détection de la résistance à la protéine C activée liée à la mutation du facteur V Leiden en cours de grossesse (1998) (0)
- Formes héréditaires de cancer du sein et de l’ovaire : dépistage, suivi et prise en charge (2010) (0)
- Antécédents familiaux et évaluation du risque de cancer du sein : quelles femmes pour la consultation d'oncogénétique (1997) (0)
- Architecture génétique de l’hypertension pulmonaire : des gènes aux médicaments (2017) (0)
- Le conseil génétique dans le centre de référence de l’hypertension pulmonaire sévère (2016) (0)
- Prédispositions héréditaires au cancer de l’endomètre1 (2022) (0)
- Manifestations cutanées chez neuf patients porteurs de mutations bialléliques de MUTYH (2011) (0)
- Consultation d'oncogénétique en pathologie colique et stratégie de surveillance (2016) (0)
- Les apports de la génétique moléculaire à la compréhension de l'hypertension artérielle essentielle (1991) (0)
- Facteur auriculaire natriurétique (1988) (0)
- 20 Mutation de endogline chez une patiente ayant une maladie de Rendu-Osler et une hypertension artérielle pulmonaire (2004) (0)
- Relation phénotype/génotype chez les patients atteints d’une HTAP héritable due à une mutation affectant l’acide-aminé Arg873 de BMPRII (2014) (0)
- The Renin Gene: Structure and Processing of Renin (1984) (0)
- [Genetics and genomics of pulmonary arterial hypertension]. (2014) (0)
- GGGAGAAGGT GGGC TGGC CGCAGTACAAC TGGACGCC GAACTC CGCTCGCT CAGAAGGGGCCCCTC CCAGACAGCGGC CGCG TCAGCTTC CT GGGC CT GGAC CT GGAT GC GCAGCAGGCCCGCGTGGGCCAGTGG (0)
- Pulmonary hypertension genes as major diagnostic tools (2018) (0)
- Clinical phenotypes and outcomes of pulmonary veno-occlusive disease in carriers of bi-allelicEIF2AK4mutations (2016) (0)
- Genetics of Pulmonary Arterial Hypertension and the Concept of Heritable Pulmonary Arterial Hypertension (2012) (0)
- [Modalities for the functionning of a Care Center for women at high risk for breast and ovarian cancers: The French experience of Tenon Hospital]. (2010) (0)
- Familial pancreatic cancer (FPC): Report of a French series and identification a novel genetic alteration of p12 (2014) (0)
- Nucleic acid encoding the angiotensin converting enzyme (ACE) human testicular, and its applications, especially for the in vitro screening of this enzyme in the body (1989) (0)
- Means and methods for the study of genetic polymorphism of the angiotensin 1-converting enzyme. (1991) (0)
- Genetic Counselling In The French Pulmonary Hypertension Referral Center (2012) (0)
- GENESIS: a French national resource to study the missing heritability of breast cancer (2016) (0)
- [Comparison of three reactants for the detection of activated protein C resistance due to mutation of factor V Leiden during pregnancy]. (1998) (0)
- The application of molecular genetics to the study of familial arterial hypertension. (1989) (0)
- T-cell dysregulation and inflammatory process in Gcn2 (Eif2ak4-/-) deficient rats in basal and stress conditions. (2023) (0)
- Mendelian randomization analysis of red cell distribution width in pulmonary arterial hypertension (2019) (0)
- 1.P.293 Polymorphisms of the endothelial nitric oxide synthase gene are unrelated to coronary heart disease in the ECTIM study (1997) (0)
- Whole-genome sequencing of patients with rare diseases in a national health system (2020) (0)
- Clinical and molecular genetic features of pulmonary hypertension in patients with hereditary hemorrhagic telangiectasia. (2008) (0)
- [Prevalence of factor V Leiden, hyperhomocysteinemia, prothrombin G20210A, and methylene tetrahydrofolate reductase C677T mutations in obstetrical complications]. (1999) (0)
- 1 .P 377 Evaluation of the angiotensinogen locus in human essential lipidic composition of de patients with arterial hypertension and without hypertension: An European study obesity. (1997) (0)
- Do we know all there is to know about Familial Adenomatous Polyposis ? PATHOLOGIE COLIQUE CASE REPORT (2007) (0)
- Methods Patient Population Hypertensive Index Cases and Sibships With Multiple Hypertensive Subjects (2005) (0)
- Short report: HYPERGENE (1994) (0)
- Clinical and genetic findings in children with CNS arteriovenous fistulas Running head : Genetic findings in cerebrospinal AVFs (2017) (0)
- [From positional cloning to gene identification and its function in genetic diseases]. (1994) (0)
- Progenitor Cells Participate in Vascular Remodeling During Pulmonary Arterial Hypertension (2016) (0)
- Hypertension Summer School 1992 (1993) (0)
- Pulmonary hypertension associated with neurofibromatosis type 1: data from the French Pulmonary Hypertension Registry (2019) (0)
- Comparison between three clotting assays for the detection of activated protein C linked to the presence of the factor V Leiden during pregnancy (1998) (0)
- Characteristics and outcomes of heritable pulmonary veno-occlusive disease due toEIF2AK4mutations (2015) (0)
- The FANCM:p.Arg658* truncating variant is associated with risk of triple-negative breast cancer (2019) (0)
- [Molecular analysis of genetic predispositions to breast cancer]. (1999) (0)
- The deletion/insertion polymorphism of the angiotensin converting enzyme gene and risk of cardiovascular and renal diseases (1998) (0)
- Pulmonary arterial hypertension associated with fenfluramine exposure : report of 109 cases. Commentary (2008) (0)
- Screening of pulmonary arterial hypertension in BMPR2 mutation carriers (2020) (0)
- ResearchAbsence of influence of gender and BMPR 2 mutation type on clinical phenotypes of pulmonary arterial hypertension (2010) (0)
- No 2 August 1994 pendent studies in populations covered by World Health Organization / MONICA CHD (2005) (0)
- Nucleic acid encoding for human testicular angiotensin converting enzyme (ACE), and its applications, especially for the in vitro detection of the enzyme in the organism (1990) (0)
- APPLICATION OF HUMAN RENIN ANTIBODIES (1983) (0)
- Linkage studies in essential hypertension (1995) (0)
- 33 Hypergene: a database for genetic analysis of hypertension (1993) (0)
- 0074 : Resident PW1+ progenitor cells participate in vascular remodeling during pulmonary arterial hypertension (2016) (0)
- Novel BMPR2 Mutation Spectrum Including Large Rearrangement In Chinese Idiopathic And Familial Pulmonary Arterial Hypertension Cohort (2011) (0)
- CN2 regulates BMP signaling: Consequence for PVOD pathobiology and therapeutic management (2020) (0)
- The Platelet-Derived Growth Factor Pathway in Pulmonary Arterial Hypertension: Still an Interesting Target? (2022) (0)
- Whole Exome Sequencing (WES) revealed underlying complexity in genetic studies of Familial IgA Nephropathy (flgAN) (2015) (0)
- GCN2 regulates BMP signaling: consequence for PVOD pathobiology and therapeutic management (2020) (0)
- [Genetics of cardio-vascular complications of diabetes]. (1996) (0)
- Author Correction: Biological heterogeneity in idiopathic pulmonary arterial hypertension identified through unsupervised transcriptomic profiling of whole blood (2022) (0)
- BMP signaling induces proliferation of endothelial cells via activation of VEGF/VEGFR and Ang1/Tie2 signaling pathways (2006) (0)
- Genetic counselling in pulmonary arterial hypertension: Experience from the French referal centre (2011) (0)
- Genetic determinants of risk and survival in pulmonary arterial hypertension (2018) (0)
- Abstract 15717: PDGFRalpha Drives Pulmonary Vascular Progenitor Cells Recruitment, Vascular Remodeling and Pulmonary Hypertension Development (2019) (0)
- PL-3: GENETIC POLYMORPHISM OF THE HUMAN RENIN ANGIOTENSIN SYSTEM: PATHOLOGICAL IMPLICATIONS (1994) (0)
- Do we know all there is to know about Familial Adenomatous Polyposis? (2007) (0)
- Le polymorphisme d'insertion/délétion du gène de l'enzyme de conversion de l'angiotensine I semble être un facteur de risque de l'infarctus du myocarde (1992) (0)
- Abstract 18517: GCN2 Dysfunction at the Heart of Pulmonary Veno-Occlusive Disease Development (2016) (0)
- Genetic counselling and testing in pulmonary arterial hypertension: a consensus statement on behalf of the International Consortium for Genetic Studies in PAH (2022) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Florent Soubrier?
Florent Soubrier is affiliated with the following schools: