Helen Donis-Keller | Academic Influence

Helen Donis-Keller's AcademicInfluence.com Rankings

Helen Donis-Keller

Biology

#10985

World Rank

#14354

Historical Rank

#2536

USA Rank

Genetics

#1640

World Rank

#1748

Historical Rank

#316

USA Rank

biology Degrees

Download Badge

Biology

Helen Donis-Keller's Degrees

Bachelors Biology University of California, Santa Cruz

Similar Degrees You Can Earn

Best Online Bachelor's in Biology 2025

Why Is Helen Donis-Keller Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Helen Donis-Keller is the Michael E. Moody Professor and Professor of Biology and Art at Olin College of Engineering in Needham, Massachusetts. Education and career Donis-Keller has a B.Sc. and an H.B.Sc. from Lakehead University. She earned her Ph.D. at Harvard University under the direction of Walter Gilbert in 1979. After employment at the biotechnology companies Biogen and Collaborative Research, she joined the faculty at Washington University School of Medicine. In 2001, she earn an MFA in studio art from the School of the Museum of Fine Arts in Boston and Tufts University and she joined the faculty at the Olin College of Engineering. In 2012, she was named the Michael. E. Moody Faculty Chair.

(See a Problem?)

Helen Donis-Keller's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. (1993) (1243)
Mapping adenines, guanines, and pyrimidines in RNA. (1977) (921)
A genetic linkage map of the human genome (1987) (882)
A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome) (1998) (737)
Identification of Sonic hedgehog as a candidate gene responsible for holoprosencephaly (1996) (656)
Single missense mutation in the tyrosine kinase catalytic domain of the RET protooncogene is associated with multiple endocrine neoplasia type 2B. (1994) (588)
Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14q1. (1989) (507)
Predictive DNA Testing and Prophylactic Thyroidectomy in Patients at Risk for Multiple Endocrine Neoplasia Type 2A (1994) (423)
Site specific enzymatic cleavage of RNA (1979) (319)
A polymorphic DNA marker linked to cystic fibrosis is located on chromosome 7 (1985) (317)
Mapping the gene for hereditary cutaneous malignant melanoma-dysplastic nevus to chromosome 1p. (1989) (316)
A comprehensive genetic linkage map of the human genome. NIH/CEPH Collaborative Mapping Group. (1992) (314)
Comparative genomic analysis of 60 Mycobacteriophage genomes: genome clustering, gene acquisition, and gene size. (2010) (281)
Phy M: an RNase activity specific for U and A residues useful in RNA sequence analysis. (1980) (207)
Identification of a human achaete-scute homolog highly expressed in neuroendocrine tumors. (1993) (180)
Identification of a second pseudoautosomal region near the Xq and Yq telomeres. (1992) (180)
Allelotyping of ductal carcinoma in situ of the breast: deletion of loci on 8p, 13q, 16q, 17p and 17q. (1995) (177)
Rh-related antigen CD47 is the signal-transducer integrin-associated protein. (1994) (166)
Mixed hematopoietic chimerism following bone marrow transplantation for hematologic malignancies. (1987) (166)
7q11.23 deletions in Williams syndrome arise as a consequence of unequal meiotic crossover. (1996) (142)
USE OF DNA RESTRICTION FRAGMENT LENGTH POLYMORPHISMS TO DOCUMENT MARROW ENGRAFTMENT AND MIXED HEMATOPOIETIC CHIMERISM FOLLOWING BONE MARROW TRANSPLANTATION (1987) (135)
Familial hyperinsulinism maps to chromosome 11p14–15.1, 30 cM centromeric to the insulin gene (1994) (123)
Allelic deletion on chromosome 17p13.3 in early ovarian cancer. (1996) (121)
End labeling of enzymatically decapped mRNA. (1977) (119)
Fluorescence in situ hybridization mapping of translocations and deletions involving the short arm of human chromosome 12 in malignant hematologic diseases. (1994) (108)
Nucleotide sequence of the gene encoding the RNA subunit (M1 RNA) of ribonuclease P from Escherichia coli (1982) (105)
Genomic organization of human surfactant protein D (SP-D). SP-D is encoded on chromosome 10q22.2-23.1. (1993) (104)
Familial medullary thyroid carcinoma and multiple endocrine neoplasia type 2B map to the same region of chromosome 10 as multiple endocrine neoplasia type 2A. (1991) (98)
Allelic loss and the progression of breast cancer. (1995) (89)
Allelic loss on a chromosome 17 in ductal carcinoma in situ of the breast. (1993) (78)
RNA sequencing provides evidence for allelism of determinants of the N-, B- or NB-tropism of murine leukemia viruses (1979) (66)
Use of Highly Polymorphic DNA Probes for Genotypic Analysis Following Bone Marrow Transplantation (1986) (66)
cDNA sequence and chromosomal localization of human enterokinase, the proteolytic activator of trypsinogen. (1995) (65)
The Olin curriculum: thinking toward the future (2005) (63)
The CEPH consortium primary linkage map of human chromosome 10. (1990) (63)
A minisatellite and a microsatellite polymorphism within 1.5 kb at the human muscle glycogen phosphorylase (PYGM) locus can be amplified by PCR and have combined informativeness of PIC 0.95. (1992) (59)
Neural-specific expression, genomic structure, and chromosomal localization of the gene encoding the zinc-finger transcription factor NGFI-C. (1992) (58)
Use of highly polymorphic DNA probes for genotypic analysis following bone marrow transplantation. (1986) (57)
A polymorphic (CA)n repeat element maps the human glucokinase gene (GCK) to chromosome 7p. (1992) (55)
A 1.5-megabase yeast artificial chromosome contig from human chromosome 10q11.2 connecting three genetic loci (RET, D10S94, and D10S102) closely linked to the MEN2A locus. (1993) (54)
Supravalvular aortic stenosis: a splice site mutation within the elastin gene results in reduced expression of two aberrantly spliced transcripts (1999) (53)
Predictive testing for Wilson's disease using tightly linked and flanking DNA markers (1991) (52)
An extremely polymorphic locus on the short arm of the human X chromosome with homology to the long arm of the Y chromosome. (1989) (50)
Fetus in fetu: molecular analysis of a fetiform mass. (1993) (50)
Human cholecystokinin type A receptor gene: cytogenetic localization, physical mapping, and identification of two missense variants in patients with obesity and non-insulin-dependent diabetes mellitus (NIDDM). (1997) (47)
Characterization of a spontaneous mutation to a beta-thalassemia allele. (1986) (46)
Chromosome 7 long-arm deletions in myeloid disorders: terminal DNA sequences are commonly conserved and breakpoints vary. (1989) (45)
A microsatellite-based index map of human chromosome 11. (1993) (43)
A transmission disequilibrium and linkage analysis of D22S278 marker alleles in 574 families: further support for a susceptibility locus for schizophrenia at 22q12 (1998) (41)
Mapping human telomere regions with YAC and P1 clones: chromosome-specific markers for 27 telomeres including 149 STSs and 24 polymorphisms for 14 proterminal regions. (1996) (41)
The RET proto‐oncogene and cancer (1995) (40)
Linkage of preaxial polydactyly type 2 to 7q36. (1995) (39)
Genetic analysis of prostatic atypical adenomatous hyperplasia (adenosis). (1999) (39)
The CEPH consortium linkage map of human chromosome 16. (1994) (38)
Isolation, Characterization, and Chromosomal Mapping of the Human Insulin Promoter Factor 1 (IPF-1) Gene (1996) (38)
Identification of a human LMX1 (LMX1.1)-related gene, LMX1.2: tissue-specific expression and linkage mapping on chromosome 9. (1997) (35)
Current perspectives on the diagnosis and management of patients with multiple endocrine neoplasia type 2 syndromes. (1994) (34)
Predictive testing for multiple endocrine neoplasia type 2A (MEN 2A) based on the detection of mutations in the RET protooncogene. (1994) (34)
The Cooperative Breast Cancer Tissue Resource: archival tissue for the investigation of tumor markers. (2001) (32)
A genetic linkage map of human chromosome 5 with 60 RFLP loci. (1991) (32)
Linkage studies with chromosome 17 DNA markers in 45 neurofibromatosis 1 families. (1987) (31)
A genetic linkage map of 32 loci on human chromosome 10. (1989) (28)
CEPH consortium Map of chromosome 9. (1994) (28)
A 12 megabase restriction map at the cystic fibrosis locus. (1989) (25)
Sequence-ready contig for the 1.4-cM ductal carcinoma in situ loss of heterozygosity region on chromosome 8p22-p23. (1999) (25)
Improved predictive test for MEN2, using flanking dinucleotide repeats and RFLPs. (1992) (24)
Isolation of the Human LIM/Homeodomain Gene Islet-1 and Identification of a Simple Sequence Repeat 1 (1994) (24)
Isolation of the human LIM/homeodomain gene islet-1 and identification of a simple sequence repeat polymorphism [corrected]. (1994) (24)
Sequence heterogeneity in satellite tobacco necrosis virus RNA. (1981) (23)
The CEPH consortium linkage map of human chromosome 11. (1995) (23)
Isolation, characterization, and chromosomal mapping of the human Nkx6.1 gene (NKX6A), a new pancreatic islet homeobox gene. (1997) (22)
A FINE-STRUCTURE LINKAGE MAP FOR CHROMOSOME-13 (1989) (22)
Cloning, nucleotide sequence, and chromosome localization of the human pleiotrophin gene. (1992) (22)
High levels of loss at the 17p telomere suggest the close proximity of a tumour suppressor. (1996) (20)
Mapping Novel Pancreatic Islet Genes to Human Chromosomes (1997) (20)
Cloning, heterologous expression, and chromosomal localization of human inositol polyphosphate 1-phosphatase. (1993) (19)
A 2-cM genetic linkage map of human chromosome 7p that includes 47 loci. (1992) (18)
Mapping the human liver/islet glucose transporter (GLUT2) gene within a genetic linkage map of chromosome 3q using a (CA)n dinucleotide repeat polymorphism and characterization of the polymorphism in three racial groups. (1992) (17)
A strategy for the characterization of minute chromosome rearrangements using multiple color fluorescence in situ hybridization with chromosome-specific DNA libraries and YAC clones (2004) (17)
Report of the second international workshop on human chromosome 7 mapping 1994. (1995) (16)
Highly polymorphic RFLP probes as diagnostic tools. (1986) (16)
VNTR and microsatellite polymorphisms within the subtelomeric region of 7q. (1993) (16)
Closure of a genetic linkage map of human chromosome 7q with centromere and telomere polymorphisms. (1992) (15)
Neural-specific expression, genomic structure, and chromosomal localization of the gene encoding the zinc-finger transcription factor NGFI-C. (1992) (15)
CEPH consortium map of chromosome 14. (1995) (14)
Identification of Trinucleotide Repeat–Containing Genes in Human Pancreatic Islets (1996) (13)
Software for analysis and manipulation of genetic linkage data. (1992) (13)
Index, comprehensive microsatellite, and unified linkage maps of human chromosome 14 with cytogenetic tie points and a telomere microsatellite marker. (1995) (12)
The finding of a somatic deletion in RET exon 15 clarified the sporadic nature of a medullary thyroid carcinoma suspected to be familial (2002) (12)
Report of the committee on the genetic constitution of chromosome 8. (1990) (12)
Report and abstracts of the First International Workshop on Human Chromosome 8 Mapping. Vancouver, British Columbia, May 2-4, 1993. (1993) (11)
Studies on locus expansion, library representation, and chromosome walking using an efficient method to screen cosmid libraries. (1988) (11)
Identification and characterization of 23 RFLP loci by screening random cosmid genomic clones. (1989) (10)
Functional Characterization of an Epidermal Growth Factor Receptor/RET Chimera* (1997) (10)
Nucleotide sequences associated with differences in electrophoretic mobility of envelope glycoprotein gp70 and with GIX antigen phenotype of certain murine leukemia viruses. (1980) (10)
Presymptomatic identification of carriers of the multiple endocrine neoplasia type 2A gene using flanking DNA markers. (1992) (10)
Regular ArticleThe CEPH Consortium Linkage Map of Human Chromosome 11 (1995) (9)
Genetic fine mapping of the gene for nonsyndromic congenital retinal nonattachment. (2000) (9)
Association between prostate cancer in black Americans and an allele of the PADPRP pseudogene locus on chromosome 13. (1996) (9)
Integrated genetic map of human chromosome 2 (1995) (9)
Nonsyndromic congenital retinal nonattachment gene maps to human chromosome band 10q21. (2000) (8)
Report of the committee on the genetic constitution of chromosomes 7 and 8. (1988) (8)
Statistical methods in genetic mapping. (1994) (8)
Prenatal Diagnosis of Cystic Fibrosis by Chorionic Villus Sampling Using 12 Polymorphic Deoxyribonucleic Acid Markers (1988) (7)
Construction of a linkage map of the human genome, and its application to mapping genetic diseases. (1989) (6)
Abstracts of workshop presentations pp. 1040-1056 (1989) (6)
THE MOLECULAR BASIS OF REOVIRUS VIRULENCE (1980) (5)
Abstracts of workshop presentations pp. 948-967 (1989) (5)
Abstracts of workshop presentations pp. 1023-1039 (1989) (5)
Abstracts of workshop presentations pp. 1057-1074 (1989) (4)
Recombinant DNA methods: applications to human genetics. (1988) (4)
Summary of Human Gene Map, New Haven, HGM – 1, 1973, ‘Data 1' (1989) (4)
A Molecular Approach to Defining the Inherited Components in Epilepsy and Other Diseases of Uncertain Etiology (1984) (3)
Abstracts of workshop presentations pp. 1075-1091 (1989) (3)
Mammalian gene studies: Editorial overview (1991) (3)
Allelotyping of Ductal Carcinoma in Situ of the Breast : Deletion of Loci on 8 p , 13 q , 16 q , 17 p and ITq 1 (2006) (3)
Subregional localization of 21 chromosome 7-specific expressed sequence tags (ESTs) by FISH using newly identified YACs and P1s. (1997) (2)
Refinement of human chromosome 7 map around the pro alpha 2(I)collagen gene by long-range restriction mapping. (1991) (2)
Abstracts of workshop presentations pp. 1106-1116 (1989) (2)
First international workshop on human chromosome 8 mapping 1993 (1993) (2)
Chromosomal assignment of 14 genomic probes for highly polymorphic loci. (1989) (2)
Report of the committee on the genetic constitution of chromosomes 7 and 8. (1989) (1)
A new RFLP marker D5S348 maps to 5p14.3-15.2, between D5S60 (CRI-R535) and HPRTP2. (1992) (1)
A new RFLP marker D12S54 maps between F8VWF and KRAS2 on human chromosome 12p. (1991) (1)
Cystic fibrosis: diagnostic testing and the search for the gene. (1989) (1)
Identification of chromosomal loci for tumor suppressor loci implicated in progression of pheochromocytoma and medullary thyroid carcinoma (1994) (1)
Alexander F. Zakharov (1986) (1)
Linkage mapping of the tumor necrosis factor receptor 2 (TNFR2) gene to 1p36.2 using the single-strand conformation polymorphism technique (1994) (1)
Contents Vol. 55, 1990 (1990) (1)
Isolation of YAC clones from the pericentromeric region of chromosome 10 and development of new genetic markers linked to the multiple endocrine neoplasia type 2A gene. (1992) (1)
Nucleotide sequences associated with differences in electrophoretic mobility of envelope glycoprotein gp 7 O and with GIX antigen phenotype of certain murine leukemia viruses ( RNA nucleotide sequence determination / glycosylation ) (0)
Index by Abstract Number (1989) (0)
A Course In Communication And Creativity For Undergraduates In Engineering: Seeing And Hearing Communicating With Photographs, Video, And Sound (2009) (0)
GCTCAGCCCCGAG AGCTTCTCGlCTTCACCAACTGGTTCTGAG GGGCTcGGCCTGGTCAGGCcCTGGTGCGAATGGACTTTGGAAGCAGGGTG 1200 ATCGCACAACCTGCATCTTTAGTGCTTTCTTGTCAGTGGCGTTGGGAGG GGAAMGGAAAAGWGAAGAAGAAGAAGMAAGAGAAGAAG 1300 AAAAAAACGAAAACAGTCAACCAACCATCGCAACTAAGCGAGGC ) TG CCTGAGGGGCTTTCAGAAAACGGGAGCGCTCAGAACAGTATCTT 1400 TGCAC (0)
(RNA nucleotide sequence determination/glycosylation) (2016) (0)
Development of a sequence-tagged site for the centromere of chromosome 10: its use in cytogenetic and physical mapping (1993) (0)
Subject Index Vol. 41, 1986 (2004) (0)
A new RFLP locus D4S185 maps to human chromosome 4q. (1991) (0)
Index by Keyword (1989) (0)
Genetic linkage map of 46 DNA markers on human chromosome 16 ( restriction fragment length polymorphisms / multipoint linkage analysis / autosomal dominant polycystic kidney disease ) (2004) (0)
Fall 2010, Fall 2011 AHSE 1130: Seeing and Hearing: Information About Course: ABET Course Syllabus (2011) (0)
Tumor Suppressor Genes in Early Breast Cancer and its Progression (1997) (0)
Guidelines for interpreting abbreviations and specialized phrases in committee text and tables (1989) (0)
Contents, Vol. 50, 1989 (1989) (0)
Washington University Record, December 10, 1992 (2014) (0)
Williams syndrome is characterized by 1 megabase deletions on 7q encompassing the elastin gene (1996) (0)
A note on the use of HGML LIT literature file numbers (1989) (0)
Isolated supravalvular aortic stenosis is characterized by a spectrum of mutations within the elastin gene (1996) (0)
Mapping the human genome with genetic markers (1987) (0)
Sporadic Hirschsprung`s disease due to a novel nonsense mutation in the RET protooncogene (1994) (0)
Book Review:Exons, Introns, and Talking Genes: The Science Behind the Human Genome Project. Christopher Wills (1993) (0)
Subject Index, Vol. 69, 1995 (2004) (0)
PhyM:anRNaseactivity specific forUandAresidues useful inRNAsequence analysis (1980) (0)
New Editors, Features and Procedures (1989) (0)
Abstracts of workshop presentations pp. 1006-1022 (1989) (0)
Searching for a major locus for male pattern baldness (MPB) (1994) (0)
Subject Index Vol. 50, 1989 (1989) (0)

This paper list is powered by the following services:

Other Resources About Helen Donis-Keller

en.wikipedia.org

What Schools Are Affiliated With Helen Donis-Keller?

Helen Donis-Keller is affiliated with the following schools: