Hitoshi Niwa
#149,062
Most Influential Person Now
Researcher
Hitoshi Niwa's AcademicInfluence.com Rankings
Hitoshi Niwacomputer-science Degrees
Computer Science
#7710
World Rank
#8115
Historical Rank
Computational Linguistics
#1592
World Rank
#1609
Historical Rank
Machine Learning
#2944
World Rank
#2981
Historical Rank
Artificial Intelligence
#3238
World Rank
#3286
Historical Rank
Download Badge
Computer Science
Hitoshi Niwa's Degrees
- PhD Computer Science University of Tokyo
- Masters Computer Science Kyoto University
- Bachelors Computer Science Kyoto University
Similar Degrees You Can Earn
Why Is Hitoshi Niwa Influential?
(Suggest an Edit or Addition)Hitoshi Niwa's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Efficient selection for high-expression transfectants with a novel eukaryotic vector. (1991) (4141)
- Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells (2000) (3733)
- Formation of Pluripotent Stem Cells in the Mammalian Embryo Depends on the POU Transcription Factor Oct4 (1998) (3465)
- Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. (1998) (1604)
- Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells (2007) (1259)
- Interaction between Oct3/4 and Cdx2 Determines Trophectoderm Differentiation (2005) (1189)
- The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. (2009) (905)
- A parallel circuit of LIF signalling pathways maintains pluripotency of mouse ES cells (2009) (846)
- How is pluripotency determined and maintained? (2007) (830)
- Genome analysis of the platypus reveals unique signatures of evolution (2008) (711)
- Differential regulation of mammalian period genes and circadian rhythmicity by cryptochromes 1 and 2. (1999) (667)
- Identification and characterization of subpopulations in undifferentiated ES cell culture (2008) (558)
- Glucose intolerance caused by a defect in the entero-insular axis: a study in gastric inhibitory polypeptide receptor knockout mice. (1999) (459)
- Differentiation of embryonic stem cells is induced by GATA factors. (2002) (442)
- Oct-3/4 and Sox2 Regulate Oct-3/4 Gene in Embryonic Stem Cells* (2005) (414)
- Targeting of both mouse neuropilin-1 and neuropilin-2 genes severely impairs developmental yolk sac and embryonic angiogenesis (2002) (404)
- Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. (2010) (395)
- Altered psychomotor behaviors in mice lacking pituitary adenylate cyclase-activating polypeptide (PACAP) (2001) (351)
- A novel reporter mouse strain that expresses enhanced green fluorescent protein upon Cre‐mediated recombination (2000) (347)
- Identification of Sox-2 regulatory region which is under the control of Oct-3/4-Sox-2 complex. (2002) (339)
- Esrrb Is a Pivotal Target of the Gsk3/Tcf3 Axis Regulating Embryonic Stem Cell Self-Renewal (2012) (318)
- Molecular mechanism to maintain stem cell renewal of ES cells. (2001) (316)
- Retraction: Bidirectional developmental potential in reprogrammed cells with acquired pluripotency (2014) (311)
- Essential role for ERK2 mitogen‐activated protein kinase in placental development (2003) (301)
- Phenotypic Complementation Establishes Requirements for Specific POU Domain and Generic Transactivation Function of Oct-3/4 in Embryonic Stem Cells (2002) (287)
- Fbx15 Is a Novel Target of Oct3/4 but Is Dispensable for Embryonic Stem Cell Self-Renewal and Mouse Development (2003) (281)
- Stimulus-triggered fate conversion of somatic cells into pluripotency (2014) (271)
- Klf4 Cooperates with Oct3/4 and Sox2 To Activate the Lefty1 Core Promoter in Embryonic Stem Cells (2006) (268)
- Synergistic action of Wnt and LIF in maintaining pluripotency of mouse ES cells. (2006) (268)
- Pancreatic β Cell–specific Expression of Thioredoxin, an Antioxidative and Antiapoptotic Protein, Prevents Autoimmune and Streptozotocin-induced Diabetes (1998) (249)
- Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity. (2002) (245)
- Endoderm-specific gene expression in embryonic stem cells differentiated to embryoid bodies. (1996) (216)
- Dissecting Oct3/4-Regulated Gene Networks in Embryonic Stem Cells by Expression Profiling (2006) (208)
- Krüppel-like factor 5 is essential for blastocyst development and the normal self-renewal of mouse ESCs. (2008) (203)
- Signaling Mechanisms Regulating Self-Renewal and Differentiation of Pluripotent Embryonic Stem Cells (1999) (197)
- Activin-Nodal signaling is involved in propagation of mouse embryonic stem cells (2006) (190)
- Identification of Pou5f1, Sox2, and Nanog downstream target genes with statistical confidence by applying a novel algorithm to time course microarray and genome-wide chromatin immunoprecipitation data (2008) (174)
- Genetic Exploration of the Exit from Self-Renewal Using Haploid Embryonic Stem Cells (2014) (169)
- Oct4 is required for lineage priming in the developing inner cell mass of the mouse blastocyst (2014) (160)
- Prox1 induces lymphatic endothelial differentiation via integrin alpha9 and other signaling cascades. (2007) (153)
- Bidirectional developmental potential in reprogrammed cells with acquired pluripotency (2014) (143)
- Involvement of Oct3/4 in the enhancement of neuronal differentiation of ES cells in neurogenesis-inducing cultures (2003) (139)
- Molecular signatures of the three stem cell lineages in hydra and the emergence of stem cell function at the base of multicellularity. (2012) (138)
- Extra-embryonic endoderm cells derived from ES cells induced by GATA Factors acquire the character of XEN cells (2007) (134)
- Context-dependent wiring of Sox2 regulatory networks for self-renewal of embryonic and trophoblast stem cells. (2013) (130)
- Enhanced Genomic Instability and Defective Postreplication Repair in RAD18 Knockout Mouse Embryonic Stem Cells (2003) (126)
- Rex1/Zfp42 is dispensable for pluripotency in mouse ES cells (2008) (125)
- An efficient system to establish multiple embryonic stem cell lines carrying an inducible expression unit (2005) (122)
- Mutational analysis of the structure and function of the xeroderma pigmentosum group A complementing protein. Identification of essential domains for nuclear localization and DNA excision repair. (1992) (119)
- A novel mechanism for regulating clonal propagation of mouse ES cells (2004) (118)
- Inhibition of DNA binding of Sox2 by the SUMO conjugation. (2006) (114)
- Oct-3/4 Maintains the Proliferative Embryonic Stem Cell State via Specific Binding to a Variant Octamer Sequence in the Regulatory Region of the UTF1 Locus (2005) (108)
- Sall4 Is Essential for Stabilization, But Not for Pluripotency, of Embryonic Stem Cells by Repressing Aberrant Trophectoderm Gene Expression (2009) (103)
- DNA Methylation Is Dispensable for the Growth and Survival of the Extraembryonic Lineages (2010) (102)
- Consequence of the loss of Sox2 in the developing brain of the mouse (2008) (100)
- The Sox-2 Regulatory Regions Display Their Activities in Two Distinct Types of Multipotent Stem Cells (2004) (96)
- An efficient gene-trap method using poly A trap vectors and characterization of gene-trap events. (1993) (96)
- Open conformation chromatin and pluripotency. (2007) (93)
- Impaired fertility in female mice lacking urinary trypsin inhibitor. (2001) (91)
- Nuclear and chromatin reorganization in the MHC-Oct3/4 locus at developmental phases of embryonic stem cell differentiation. (2006) (88)
- Wnt Signaling Regulates Hemopoiesis Through Stromal Cells1 (2001) (85)
- Dax1 Binds to Oct3/4 and Inhibits Its Transcriptional Activity in Embryonic Stem Cells (2009) (82)
- Transcriptional regulatory networks in epiblast cells and during anterior neural plate development as modeled in epiblast stem cells (2012) (79)
- MEIOSIN Directs the Switch from Mitosis to Meiosis in Mammalian Germ Cells. (2020) (77)
- Platypus Pou5f1 reveals the first steps in the evolution of trophectoderm differentiation and pluripotency in mammals (2008) (67)
- Regulation of Mesodermal Differentiation of Mouse Embryonic Stem Cells by Basement Membranes* (2007) (62)
- E-Cadherin Promotes Incorporation of Mouse Epiblast Stem Cells into Normal Development (2012) (61)
- Requirement of Oct3/4 function for germ cell specification. (2008) (60)
- The principles that govern transcription factor network functions in stem cells (2018) (60)
- Mouse ES cell culture system as a model of development (2010) (53)
- Retraction: Stimulus-triggered fate conversion of somatic cells into pluripotency (2014) (53)
- Wnt: What's Needed To maintain pluripotency? (2011) (51)
- Efficient Derivation of Embryonic Stem Cells by Inhibition of Glycogen Synthase Kinase‐3 (2007) (51)
- Constructing adenoviral vectors by using the circular form of the adenoviral genome cloned in a cosmid and the Cre-loxP recombination system. (1999) (51)
- Defining Developmental Potency and Cell Lineage Trajectories by Expression Profiling of Differentiating Mouse Embryonic Stem Cells (2008) (50)
- LIF signal in mouse embryonic stem cells (2015) (48)
- Mechanisms of Stem Cell Self-renewal (2014) (42)
- HEX Acts as a Negative Regulator of Angiogenesis by Modulating the Expression of Angiogenesis-Related Gene in Endothelial Cells In Vitro (2003) (42)
- Lunatic fringe potentiates Notch signaling in the developing brain (2010) (42)
- Stem cell-specific expression of Dax1 is conferred by STAT3 and Oct3/4 in embryonic stem cells. (2008) (41)
- Identification of Zfp-57 as a downstream molecule of STAT3 and Oct-3/4 in embryonic stem cells. (2005) (39)
- Small molecule-directed specification of sclerotome-like chondroprogenitors and induction of a somitic chondrogenesis program from embryonic stem cells (2014) (38)
- Zscan4 Is Activated after Telomere Shortening in Mouse Embryonic Stem Cells (2016) (37)
- Overlapping functions of Krüppel-like factor family members: targeting multiple transcription factors to maintain the naïve pluripotency of mouse embryonic stem cells (2018) (37)
- DNA Methylation Restricts Lineage-specific Functions of Transcription Factor Gata4 during Embryonic Stem Cell Differentiation (2013) (36)
- The pluripotency transcription factor network at work in reprogramming. (2014) (33)
- Cell-cycle-dependent expression of the STK-1 gene encoding a novel murine putative protein kinase. (1996) (33)
- Nr0b1 is a negative regulator of Zscan4c in mouse embryonic stem cells (2015) (32)
- Eed/Sox2 regulatory loop controls ES cell self‐renewal through histone methylation and acetylation (2011) (32)
- The POU-er of gene nomenclature (2014) (31)
- Transcriptional regulatory networks in epiblast cells and during anterior neural plate development as modeled in epiblast stem cells (2012) (31)
- Efficient conversion of ES cells into myogenic lineage using the gene-inducible system. (2007) (30)
- Genomic organization and promoter analysis of the Dnmt3b gene. (2003) (28)
- The evolutionally-conserved function of group B1 Sox family members confers the unique role of Sox2 in mouse ES cells (2016) (28)
- Zscan4 Is Regulated by PI3-Kinase and DNA-Damaging Agents and Directly Interacts with the Transcriptional Repressors LSD1 and CtBP2 in Mouse Embryonic Stem Cells (2014) (25)
- Disruption of the mouse protein Ser/Thr phosphatase 2Cβ gene leads to early pre-implantation lethality (2007) (25)
- Kinetics of drug selection systems in mouse embryonic stem cells (2013) (23)
- Choice of random rather than imprinted X inactivation in female embryonic stem cell-derived extra-embryonic cells (2011) (23)
- Differential expression of mRNAs for PACAP and its receptors during neural differentiation of embryonic stem cells (2005) (21)
- The differential activation of intracellular signaling pathways confers the permissiveness of embryonic stem cell derivation from different mouse strains (2015) (21)
- Transcription factor network in embryonic stem cells: heterogeneity under the stringency. (2013) (18)
- Maintenance of pluripotency in mouse ES cells without Trp53 (2013) (17)
- Wnt Signaling Regulates Hemopoiesis Through Stromal Cells (2001) (17)
- Mesenchymal-epithelial transition regulates initiation of pluripotency exit before gastrulation (2019) (17)
- Drug-Inducible Gene Recombination by the Dppa3-MER Cre MER Transgene in the Developmental Cycle of the Germ Cell Lineage in Mice1 (2011) (16)
- Clonal expansion of human pluripotent stem cells on gelatin-coated surface. (2010) (16)
- Sox7 is dispensable for primitive endoderm differentiation from mouse ES cells (2015) (14)
- Klf5 suppresses ERK signaling in mouse pluripotent stem cells (2018) (13)
- [Self-renewal and differentiation of ES cells]. (2000) (11)
- Self-Renewal and Mouse Development Dispensable for Embryonic Stem Cell Fbx 15 Is a Novel Target of Oct 3 / 4 but Is (2003) (10)
- CrxOS maintains the self-renewal capacity of murine embryonic stem cells. (2009) (10)
- The C‐terminal region of Xpc is dispensable for the transcriptional activity of Oct3/4 in mouse embryonic stem cells (2014) (9)
- Molecular detection of maturation stages in the developing kidney. (2020) (9)
- Co-precipitation molecules hemopexin and transferrin may be key molecules for fibrillogenesis in TTR V30M amyloidogenesis (2017) (9)
- Distinct transcriptional programs of SOX2 in different types of small cell lung cancers (2019) (9)
- Improvement of Germ Line Transmission by Targeting β‐galactosidase to Nuclei in Transgenic Mice (1994) (9)
- Investigation of the cellular reprogramming phenomenon referred to as stimulus-triggered acquisition of pluripotency (STAP) (2015) (9)
- Essential technical tips for STAP cell conversion culture from somatic cells (2014) (8)
- Meiosis-specific ZFP541 repressor complex promotes developmental progression of meiotic prophase towards completion during mouse spermatogenesis (2021) (8)
- A liaison between intrinsic and extrinsic regulators of pluripotency (2013) (8)
- Pancreatic Cell–specific Expression of Thioredoxin, an Antioxidative and Antiapoptotic Protein, Prevents Autoimmune and Streptozotocin-induced Diabetes (1998) (6)
- Zscan10 is dispensable for maintenance of pluripotency in mouse embryonic stem cells. (2015) (6)
- [Transcription factor network governing cellular pluripotency]. (2009) (5)
- Epiblast and primitive endoderm differentiation: fragile specification ensures stable commitment. (2015) (5)
- Establishment of bone marrow-derived M-CSF receptor-dependent self-renewing macrophages (2020) (5)
- MEAF6 is essential for cell proliferation and plays a role in the assembly of KAT7 complexes. (2020) (4)
- Selective de-repression of germ cell-specific genes in mouse embryonic fibroblasts in a permissive epigenetic environment (2016) (4)
- Klf 5 suppresses ERK signaling in mouse pluripotent stem cells (2018) (3)
- Establishment of bone marrow-derived M-CSF receptor-dependent self-renewing macrophages (2020) (3)
- Report on STAP Cell Research Paper Investigation (2014) (3)
- The polyol pathway is an evolutionarily conserved system for sensing glucose uptake (2021) (3)
- [Molecular mechanism for cell-fate determination in ES cells]. (2000) (2)
- Zscan 4 Is Regulated by PI 3-Kinase and DNA-Damaging Agents and Directly Interacts with the Transcriptional Repressors LSD 1 and CtBP 2 in Mouse Embryonic Stem Cells (2014) (2)
- Stem cell systems in development of mammals (2010) (2)
- A Stepping Stone to Pluripotency (2015) (2)
- Stepwise pluripotency transitions in mouse stem cells (2022) (1)
- Chapter 8 – Mechanisms of Stem Cell Self-Renewal (2009) (1)
- Through Stromal Cells Wnt Signaling Regulates Hemopoiesis (2013) (0)
- Transcription factor network governing pluripotency. (2015) (0)
- ES cells derivation affected by the genetic background and culture context (2018) (0)
- The polyol pathway is a crucial glucose sensor in Drosophila (2020) (0)
- Jcb: Supplemental Material (0)
- Choice of random rather than imprinted X inactivation in female embryonic stem cell-derived extra-embryonic cells (2014) (0)
- Zscan10 suppress gene silencing of transposable element is mouse embryonic stem cell (2017) (0)
- Novel DNA methylation mechanism revealed by the study on epigenetic barrier that distinguishes naive and primed pluripotency (2016) (0)
- Semiconductor device from positive ceramic. (1987) (0)
- A semiconductor device for use in a light valve and the production method (1991) (0)
- Molecular basis of cellular pluripotency (2006) (0)
- Subject Index Vol. 165, 1999 (1999) (0)
- The evolutionally-conserved function of group B1 Sox family members confers the unique role of Sox2 in mouse ES cells (2016) (0)
- Dna expression in transfected cells and test procedures in transfected cells (1998) (0)
- Sox7 is dispensable for primitive endoderm differentiation from mouse ES cells (2015) (0)
- Esrrb Is a Pivotal Target of the Gsk3/Tcf3 Axis Regulating Embryonic Stem Cell Self-Renewal (2013) (0)
- Inhibition of N-myristoyltransferase Promotes Naive Pluripotency in Mouse and Human Pluripotent Stem Cells (2021) (0)
- GAGCTGGTGCTACCAAGAGG TGCAAAAGCCCATCTCTTCT Myc TCCTGTACCTCGTCCGATTC GGTTTGCCTCTTCTCCACAG Sall 4 CTCATGGGGCCAACAATAAC CGGAGATCTCGTTGGTCTTC Zic 3 TACACCCCGTTCTGGAACTC TTCGACCCCATTAGACGAAG Sox 17 GAGGGCCAGAAGCAGTGTTA AGTGATTGTGGGGACCAAGT Prdm 1 AGCATGACCTGACATTGACACC CTCAACACTCTCATGTAAGAGGC Eomes CCTGGT (2008) (0)
- Ensemble of old and new techniques escorts ESCs to bona fide embryo-like structures. (2022) (0)
- Through Stromal Cells Wnt Signaling Regulates (2001) (0)
- Application of ES cells to transplantation therapy (2000) (0)
- 13-P050 Transcriptional regulation by the FGF signaling pathway in trophoblast stem cells (2009) (0)
- Meiosis-specific ZFP541 repressor complex promotes meiotic prophase exit during spermatogenesis (2021) (0)
- 255. Embryonic Stem Cell-Mediated Regenerative Therapy for Duchenne Muscular Dystrophy (2005) (0)
- DEV112375 431..437 (2015) (0)
- [Rivalry between transcription factors to determine cell fates in mammalian pre implantation development]. (2006) (0)
- [Definitions of key words in stem cell biology]. (2006) (0)
- Reduktionswiderstandsfaehiges semiconductor porcelain with a positive temperature coefficient of resistance. (1985) (0)
- Demonstration of neuronal differentiation-related gene expression by gene trapping in embryonal carcinoma cell line P19 (1992) (0)
- [Transcriptional network maintaining pluripotency of embryonic stem cells]. (2008) (0)
- Regeneration , morphogenesis and self-organization (2014) (0)
- Approach for integration of ChIP-Seq and RNA-Seq analysis data with differentiation of Mouse ES Cell as a model. (2017) (0)
- S16-04 Transcription factor network governing pluripotency (2009) (0)
- Title Pancreatic β Cell-specific Expression of Thioredoxin , an Antioxidative and Antiapoptotic Protein , Prevents Autoimmune and Streptozotocin-induced Diabetes (0)
- Rewiring of transcription factor network (2010) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Hitoshi Niwa?
Hitoshi Niwa is affiliated with the following schools:
