Jeffrey I. Gordon

Jeffrey I. Gordon's AcademicInfluence.com Rankings

Jeffrey I. Gordon

Biology

#389

World Rank

#699

Historical Rank

#232

USA Rank

Microbiology

#30

World Rank

#45

Historical Rank

#21

USA Rank

biology Degrees

Download Badge

Biology

Jeffrey I. Gordon's Degrees

Masters Medicine Harvard University

Why Is Jeffrey I. Gordon Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Jeffrey Ivan Gordon is a biologist and the Dr. Robert J. Glaser Distinguished University Professor and Director of the Center for Genome Sciences and Systems Biology at Washington University in St. Louis. He is internationally known for his research on gastrointestinal development and how gut microbial communities affect normal intestinal function, shape various aspects of human physiology including our nutritional status, and affect predisposition to diseases. He is a member of the National Academy of Sciences, the American Academy of Arts and Sciences, the Institute of Medicine of the National Academies, and the American Philosophical Society.

(See a Problem?)

Jeffrey I. Gordon's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

QIIME allows analysis of high-throughput community sequencing data (2010) (28011)
An obesity-associated gut microbiome with increased capacity for energy harvest (2006) (9978)
Microbial ecology: Human gut microbes associated with obesity (2006) (7376)
A core gut microbiome in obese and lean twins (2008) (6962)
Human gut microbiome viewed across age and geography (2012) (5947)
Obesity alters gut microbial ecology. (2005) (5355)
The gut microbiota as an environmental factor that regulates fat storage. (2004) (5248)
The Human Microbiome Project (2007) (4601)
Host-Bacterial Mutualism in the Human Intestine (2005) (4508)
Metagenomic Analysis of the Human Distal Gut Microbiome (2006) (4088)
Diversity, stability and resilience of the human gut microbiota (2012) (3779)
Evolution of Mammals and Their Gut Microbes (2008) (3056)
Ecological and Evolutionary Forces Shaping Microbial Diversity in the Human Intestine (2006) (2935)
Gut Microbiota from Twins Discordant for Obesity Modulate Metabolism in Mice (2013) (2874)
Bacterial Community Variation in Human Body Habitats Across Space and Time (2009) (2803)
Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing (2012) (2779)
The Effect of Diet on the Human Gut Microbiome: A Metagenomic Analysis in Humanized Gnotobiotic Mice (2009) (2691)
Diet-induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome. (2008) (2548)
Mechanisms underlying the resistance to diet-induced obesity in germ-free mice (2007) (2337)
Commensal Host-Bacterial Relationships in the Gut (2001) (2242)
Molecular analysis of commensal host-microbial relationships in the intestine. (2001) (2175)
Human nutrition, the gut microbiome and the immune system (2011) (2137)
Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity (2012) (2001)
Innate immunity and intestinal microbiota in the development of Type 1 diabetes (2008) (1827)
NLRP6 Inflammasome Regulates Colonic Microbial Ecology and Risk for Colitis (2011) (1702)
How host-microbial interactions shape the nutrient environment of the mammalian intestine. (2002) (1574)
The Long-Term Stability of the Human Gut Microbiota (2013) (1559)
Diet Drives Convergence in Gut Microbiome Functions Across Mammalian Phylogeny and Within Humans (2011) (1538)
Worlds within worlds: evolution of the vertebrate gut microbiota (2008) (1396)
Effects of the gut microbiota on host adiposity are modulated by the short-chain fatty-acid binding G protein-coupled receptor, Gpr41 (2008) (1368)
Radiation-induced cell cycle arrest compromised by p21 deficiency (1995) (1356)
A Genomic View of the Human-Bacteroides thetaiotaomicron Symbiosis (2003) (1280)
Developmental regulation of intestinal angiogenesis by indigenous microbes via Paneth cells (2002) (1077)
The abundance and variety of carbohydrate-active enzymes in the human gut microbiota (2013) (1039)
Glycan Foraging in Vivo by an Intestine-Adapted Bacterial Symbiont (2005) (1013)
Moving pictures of the human microbiome (2011) (1001)
Energy-balance studies reveal associations between gut microbes, caloric load, and nutrient absorption in humans. (2011) (986)
Gut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor (2013) (967)
Angiogenins: a new class of microbicidal proteins involved in innate immunity (2003) (915)
The core gut microbiome, energy balance and obesity (2009) (904)
Persistent Gut Microbiota Immaturity in Malnourished Bangladeshi Children (2014) (897)
Gnotobiotic zebrafish reveal evolutionarily conserved responses to the gut microbiota. (2004) (846)
Reciprocal Gut Microbiota Transplants from Zebrafish and Mice to Germ-free Recipients Reveal Host Habitat Selection (2006) (835)
Honor thy symbionts (2003) (811)
Cohabiting family members share microbiota with one another and with their dogs (2013) (806)
Olfactory receptor responding to gut microbiota-derived signals plays a role in renin secretion and blood pressure regulation (2013) (798)
Phenotype of mice lacking functional Deleted in colorectal cancer (Dec) gene (1997) (787)
IgA response to symbiotic bacteria as a mediator of gut homeostasis. (2007) (704)
Enterobacteriaceae act in concert with the gut microbiota to induce spontaneous and maternally transmitted colitis. (2010) (701)
Mucosal glycan foraging enhances fitness and transmission of a saccharolytic human gut bacterial symbiont. (2008) (701)
Inflammatory Bowel Disease and Adenomas in Mice Expressing a Dominant Negative N-Cadherin (1995) (689)
Homeostasis and Inflammation in the Intestine (2010) (686)
Creating and Maintaining the Gastrointestinal Ecosystem: What We Know and Need To Know from Gnotobiology (1998) (678)
The biology and enzymology of eukaryotic protein acylation. (1988) (672)
Extensive personal human gut microbiota culture collections characterized and manipulated in gnotobiotic mice (2011) (642)
Recognition and Degradation of Plant Cell Wall Polysaccharides by Two Human Gut Symbionts (2011) (641)
Characterizing a model human gut microbiota composed of members of its two dominant bacterial phyla (2009) (640)
Viruses in the fecal microbiota of monozygotic twins and their mothers (2010) (622)
A Model of Host-Microbial Interactions in an Open Mammalian Ecosystem (1996) (621)
Microbiome Metagenomic Analysis of the Human Distal Gut (2009) (616)
Activated macrophages are an adaptive element of the colonic epithelial progenitor niche necessary for regenerative responses to injury. (2005) (588)
Minimum information about a marker gene sequence (MIMARKS) and minimum information about any (x) sequence (MIxS) specifications (2011) (588)
Identifying genetic determinants needed to establish a human gut symbiont in its habitat. (2009) (586)
A humanized gnotobiotic mouse model of host-archaeal-bacterial mutualism. (2006) (570)
Identification of genes subject to positive selection in uropathogenic strains of Escherichia coli: a comparative genomics approach. (2006) (566)
Evolution of Symbiotic Bacteria in the Distal Human Intestine (2007) (562)
Complex Glycan Catabolism by the Human Gut Microbiota: The Bacteroidetes Sus-like Paradigm* (2009) (544)
Tissue-specific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding protein. (1989) (529)
The Impact of a Consortium of Fermented Milk Strains on the Gut Microbiome of Gnotobiotic Mice and Monozygotic Twins (2011) (512)
Gut bacteria that prevent growth impairments transmitted by microbiota from malnourished children (2016) (498)
Predicting a Human Gut Microbiota’s Response to Diet in Gnotobiotic Mice (2011) (496)
Metagenomic approaches for defining the pathogenesis of inflammatory bowel diseases. (2008) (494)
A molecular sensor that allows a gut commensal to control its nutrient foundation in a competitive ecosystem. (1999) (486)
Organismal, genetic, and transcriptional variation in the deeply sequenced gut microbiomes of identical twins (2010) (480)
Molecular mechanics of calcium–myristoyl switches (1997) (449)
Genomic and metabolic adaptations of Methanobrevibacter smithii to the human gut (2007) (446)
Sialylated Milk Oligosaccharides Promote Microbiota-Dependent Growth in Models of Infant Undernutrition (2016) (440)
Interactions between Gut Microbiota, Host Genetics and Diet Modulate the Predisposition to Obesity and Metabolic Syndrome. (2015) (425)
Lactobacillus reuteri induces gut intraepithelial CD4+CD8αα+ T cells (2017) (422)
In vivo analysis of cadherin function in the mouse intestinal epithelium: essential roles in adhesion, maintenance of differentiation, and regulation of programmed cell death (1995) (419)
Genomic and Metabolic Studies of the Impact of Probiotics on a Model Gut Symbiont and Host (2006) (417)
Getting a grip on things: how do communities of bacterial symbionts become established in our intestine? (2004) (411)
Genetic and biochemical studies of protein N-myristoylation. (1994) (402)
Going viral: next-generation sequencing applied to phage populations in the human gut (2012) (365)
Meta-analyses of studies of the human microbiota (2013) (364)
The human microbiome project: exploring the microbial part of ourselves in a changing world (361)
Effect of storage conditions on the assessment of bacterial community structure in soil and human-associated samples. (2010) (344)
The Min (multiple intestinal neoplasia) mutation: its effect on gut epithelial cell differentiation and interaction with a modifier system (1992) (329)
Identifying Gut Microbe–Host Phenotype Relationships Using Combinatorial Communities in Gnotobiotic Mice (2014) (319)
The biology and enzymology of protein N-myristoylation. (2001) (310)
Epithelial attachment alters the outcome of Helicobacter pylori infection. (1998) (308)
Members of the human gut microbiota involved in recovery from Vibrio cholerae infection (2014) (307)
Simultaneous Amplicon Sequencing to Explore Co-Occurrence Patterns of Bacterial, Archaeal and Eukaryotic Microorganisms in Rumen Microbial Communities (2013) (302)
Starch catabolism by a prominent human gut symbiont is directed by the recognition of amylose helices. (2008) (295)
Metabolic niche of a prominent sulfate-reducing human gut bacterium (2013) (293)
Bacteria from Diverse Habitats Colonize and Compete in the Mouse Gut (2014) (282)
An in vitro adherence assay reveals that Helicobacter pylori exhibits cell lineage-specific tropism in the human gastric epithelium. (1993) (281)
Dissecting the in Vivo Metabolic Potential of Two Human Gut Acetogens* (2010) (279)
Functional Genomic and Metabolic Studies of the Adaptations of a Prominent Adult Human Gut Symbiont, Bacteroides thetaiotaomicron, to the Suckling Period* (2006) (277)
Gnotobiotic mouse model of phage–bacterial host dynamics in the human gut (2013) (277)
The Biology and Enzymology of ProteinN-Myristoylation* 210 (2001) (273)
Differentiation and self-renewal in the mouse gastrointestinal epithelium. (1994) (270)
Paneth cell differentiation in the developing intestine of normal and transgenic mice. (1994) (264)
Functional characterization of IgA-targeted bacterial taxa from undernourished Malawian children that produce diet-dependent enteropathy (2015) (264)
Examining the Role of Paneth Cells in the Small Intestine by Lineage Ablation in Transgenic Mice* (1997) (261)
The complete genome sequence of a chronic atrophic gastritis Helicobacter pylori strain: evolution during disease progression. (2006) (260)
Unlocking the potential of metagenomics through replicated experimental design (2012) (259)
The human and rodent intestinal fatty acid binding protein genes. A comparative analysis of their structure, expression, and linkage relationships. (1987) (258)
Glycans as legislators of host-microbial interactions: spanning the spectrum from symbiosis to pathogenicity. (2001) (258)
Crystal structure of rat intestinal fatty-acid-binding protein. Refinement and analysis of the Escherichia coli-derived protein with bound palmitate. (1989) (256)
Genome-wide association study of Arabidopsis thaliana's leaf microbial community (2014) (253)
A molecular marker for evaluating the pathogenic potential of foodborne Listeria monocytogenes. (2004) (251)
Forced expression of E-cadherin in the mouse intestinal epithelium slows cell migration and provides evidence for nonautonomous regulation of cell fate in a self-renewing system. (1996) (250)
An Invitation to the Marriage of Metagenomics and Metabolomics (2008) (243)
Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin. (2004) (240)
Gut DNA viromes of Malawian twins discordant for severe acute malnutrition (2015) (239)
Primary activation of the vitellogenin gene in the rooster. (1977) (238)
Regulation of myocardial ketone body metabolism by the gut microbiota during nutrient deprivation (2009) (238)
Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome (2013) (237)
Development of the gut microbiota and mucosal IgA responses in twins and gnotobiotic mice (2016) (233)
Protein N-myristoylation. (1991) (227)
Manipulation of a Nuclear NAD+ Salvage Pathway Delays Aging without Altering Steady-state NAD+ Levels* (2002) (226)
Genetically dictated change in host mucus carbohydrate landscape exerts a diet-dependent effect on the gut microbiota (2013) (225)
Postprandial remodeling of the gut microbiota in Burmese pythons (2010) (225)
Intestinal epithelial differentiation: new insights from chimeric and transgenic mice (1989) (224)
Effects of microbiota-directed foods in gnotobiotic animals and undernourished children (2019) (220)
The metabolic significance of mammalian fatty-acid-binding proteins: abundant proteins in search of a function. (1987) (219)
Distinct contributions of Aire and antigen-presenting-cell subsets to the generation of self-tolerance in the thymus. (2014) (217)
Pan-genome of the dominant human gut-associated archaeon, Methanobrevibacter smithii, studied in twins (2011) (217)
Molecular Regulation of Urothelial Renewal and Host Defenses during Infection with Uropathogenic Escherichia coli * 210 (2002) (216)
Diphtheria Toxin-mediated Ablation of Parietal Cells in the Stomach of Transgenic Mice (*) (1996) (215)
Protein N-myristoylation in Escherichia coli: reconstitution of a eukaryotic protein modification in bacteria. (1990) (213)
Inducible Gene Knockouts in the Small Intestinal and Colonic Epithelium* (1999) (208)
G-protein alpha-subunit expression, myristoylation, and membrane association in COS cells. (1990) (206)
Effects of Forced Expression of an NH2-terminal Truncated β-Catenin on Mouse Intestinal Epithelial Homeostasis (1998) (205)
A microbial perspective of human developmental biology (2016) (204)
Lipid modifications of G protein subunits. Myristoylation of Go alpha increases its affinity for beta gamma. (1991) (199)
Expression of rat intestinal fatty acid-binding protein in Escherichia coli. Purification and comparison of ligand binding characteristics with that of Escherichia coli-derived rat liver fatty acid-binding protein. (1987) (197)
Enhanced Gluconeogenesis and Increased Energy Storage as Hallmarks of Aging in Saccharomyces cerevisiae * 210 (2001) (194)
Identification of MW Polyomavirus, a Novel Polyomavirus in Human Stool (2012) (194)
Matrix metalloproteinases contribute distinct roles in neuroendocrine prostate carcinogenesis, metastasis, and angiogenesis progression. (2010) (192)
Molecular Properties of Adult Mouse Gastric and Intestinal Epithelial Progenitors in Their Niches* (2006) (191)
Selective depletion of uropathogenic E. coli from the gut by a FimH antagonist (2017) (190)
Expression of rat apolipoprotein A-IV and A-I genes: mRNA induction during development and in response to glucocorticoids and insulin. (1985) (189)
Analysis of the tissue-specific expression, developmental regulation, and linkage relationships of a rodent gene encoding heart fatty acid binding protein. (1987) (188)
Host-microbial symbiosis in the mammalian intestine: exploring an internal ecosystem. (1998) (188)
Microbial regulation of intestinal radiosensitivity. (2005) (187)
Bacterial Exposure Induces and Activates Matrilysin in Mucosal Epithelial Cells (2000) (184)
Transposable elements drive widespread expression of oncogenes in human cancers (2019) (182)
Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing. (2013) (181)
Purification and characterization of yeast myristoyl CoA:protein N-myristoyltransferase. (1987) (180)
Escherichia coli from Urine of Female Patients with Urinary Tract Infections Is Competent for Intracellular Bacterial Community Formation (2006) (179)
Regulation of the biosynthesis of two distinct fatty acid-binding proteins in rat liver and intestine. Influences of sex difference and of clofibrate. (1985) (177)
Use of transgenic mice to map cis-acting elements in the intestinal fatty acid binding protein gene (Fabpi) that control its cell lineage- specific and regional patterns of expression along the duodenal-colonic and crypt-villus axes of the gut epithelium (1992) (177)
Regional differences in glycoconjugates of intestinal M cells in mice: potential targets for mucosal vaccines. (1994) (176)
Genetic determinants of in vivo fitness and diet responsiveness in multiple human gut Bacteroides (2015) (176)
Sip2p and its partner snf1p kinase affect aging in S. cerevisiae. (2000) (175)
The nucleotide sequence of rat liver fatty acid binding protein mRNA. (1983) (173)
Positive selection identifies an in vivo role for FimH during urinary tract infection in addition to mannose binding (2009) (172)
A transgenic mouse model of metastatic prostate cancer originating from neuroendocrine cells. (1998) (169)
Spatial organization of a model 15-member human gut microbiota established in gnotobiotic mice (2017) (167)
Passage through stationary phase advances replicative aging in Saccharomyces cerevisiae. (1999) (165)
Disruption of the yeast N-myristoyl transferase gene causes recessive lethality. (1989) (165)
Impaired prostate tumorigenesis in Egr1-deficient mice (2001) (164)
Direct sequencing of the human microbiome readily reveals community differences (2010) (163)
Transgenic mice containing intestinal fatty acid-binding protein-human growth hormone fusion genes exhibit correct regional and cell-specific expression of the reporter gene in their small intestine. (1988) (162)
Notes from some crypt watchers: regulation of renewal in the mouse intestinal epithelium. (1998) (160)
Forced expression of the tumor suppressor adenomatosis polyposis coli protein induces disordered cell migration in the intestinal epithelium. (1996) (160)
Coordinate Regulation of Glycan Degradation and Polysaccharide Capsule Biosynthesis by a Prominent Human Gut Symbiont* (2009) (160)
Honor Thy Gut Symbionts Redux (2012) (159)
Myristoyl CoA:protein N-myristoyltransferase activities from rat liver and yeast possess overlapping yet distinct peptide substrate specificities. (1988) (158)
Lectins are sensitive tools for defining the differentiation programs of mouse gut epithelial cell lineages. (1994) (158)
Interspecies Competition Impacts Targeted Manipulation of Human Gut Bacteria by Fiber-Derived Glycans (2019) (158)
Childhood undernutrition, the gut microbiota, and microbiota-directed therapeutics (2016) (157)
Functional Genomic Studies of Uropathogenic Escherichia coli and Host Urothelial Cells when Intracellular Bacterial Communities Are Assembled* (2007) (154)
Saccharomyces cerevisiae contains four fatty acid activation (FAA) genes: an assessment of their role in regulating protein N- myristoylation and cellular lipid metabolism (1994) (154)
Identifying microbial fitness determinants by insertion sequencing using genome-wide transposon mutant libraries (2011) (153)
Studies of intestinal stem cells using normal, chimeric, and transgenic mice 1 (1992) (152)
The Human Gut Microbiota and Undernutrition (2012) (152)
Tissue specific expression and developmental regulation of two genes coding for rat fatty acid binding proteins. (1985) (152)
Targeted gene replacement demonstrates that myristoyl-CoA: protein N-myristoyltransferase is essential for viability of Cryptococcus neoformans. (1994) (151)
Cloning of a cDNA encoding rat intestinal fatty acid binding protein. (1984) (151)
The effects of micronutrient deficiencies on bacterial species from the human gut microbiota (2017) (150)
A hybrid two-component system protein of a prominent human gut symbiont couples glycan sensing in vivo to carbohydrate metabolism. (2006) (149)
In vivo imaging and genetic analysis link bacterial motility and symbiosis in the zebrafish gut (2007) (148)
Molecular features of adult mouse small intestinal epithelial progenitors (2003) (146)
Mechanisms underlying generation of gradients in gene expression within the intestine: an analysis using transgenic mice containing fatty acid binding protein-human growth hormone fusion genes. (1988) (144)
Coordinate regulation of two estrogen-dependent genes in avian liver. (1980) (142)
Where Next for Microbiome Research? (2015) (140)
Innovations in host and microbial sialic acid biosynthesis revealed by phylogenomic prediction of nonulosonic acid structure (2009) (140)
Comparison of Genetic Divergence and Fitness between Two Subclones of Helicobacter pylori (2001) (133)
Understanding covalent modifications of proteins by lipids: where cell biology and biophysics mingle. (1997) (132)
The nucleotide and derived amino acid sequence of human apolipoprotein A-IV mRNA and the close linkage of its gene to the genes of apolipoproteins A-I and C-III. (1986) (131)
Fatty acid interactions with rat intestinal and liver fatty acid-binding proteins expressed in Escherichia coli. A comparative 13C NMR study. (1989) (131)
Identifying genomic and metabolic features that can underlie early successional and opportunistic lifestyles of human gut symbionts (2012) (130)
The fatty liver dystrophy (fld) mutation. A new mutant mouse with a developmental abnormality in triglyceride metabolism and associated tissue-specific defects in lipoprotein lipase and hepatic lipase activities. (1989) (130)
Sulfatases and a Radical S-Adenosyl-l-methionine (AdoMet) Enzyme Are Key for Mucosal Foraging and Fitness of the Prominent Human Gut Symbiont, Bacteroides thetaiotaomicron* (2011) (129)
Expression of a human alpha-1,3/4-fucosyltransferase in the pit cell lineage of FVB/N mouse stomach results in production of Leb-containing glycoconjugates: a potential transgenic mouse model for studying Helicobacter pylori infection. (1995) (128)
Cultivating Healthy Growth and Nutrition through the Gut Microbiota (2015) (128)
Use of transgenic mice to map cis-acting elements in the liver fatty acid-binding protein gene (Fabpl) that regulate its cell lineage-specific, differentiation-dependent, and spatial patterns of expression in the gut epithelium and in the liver acinus. (1993) (128)
Refinement of the structure of recombinant rat intestinal fatty acid-binding apoprotein at 1.2-A resolution. (1994) (128)
Genetic mosaic analysis based on Cre recombinase and navigated laser capture microdissection. (2000) (127)
Epithelial cell growth and differentiation. III. Promoting diversity in the intestine: conversations between the microflora, epithelium, and diffuse GALT. (1997) (125)
DNA microarrays and beyond: completing the journey from tissue to cell (2001) (125)
Fatty acid synthase modulates intestinal barrier function through palmitoylation of mucin 2. (2012) (125)
Prior Dietary Practices and Connections to a Human Gut Microbial Metacommunity Alter Responses to Diet Interventions. (2017) (124)
Proteolytic processing of human preproapolipoprotein A-I. A proposed defect in the conversion of pro A-I to A-I in Tangier's disease. (1983) (124)
The convergence of carbohydrate active gene repertoires in human gut microbes (2008) (122)
Structure of N-myristoyltransferase with bound myristoylCoA and peptide substrate analogs (1998) (121)
Genomic Diversity and Fitness of E. coli Strains Recovered from the Intestinal and Urinary Tracts of Women with Recurrent Urinary Tract Infection (2013) (121)
The mind-body-microbial continuum (2011) (121)
Helicobacter pylori evolution during progression from chronic atrophic gastritis to gastric cancer and its impact on gastric stem cells (2008) (118)
Transgenic mouse models that explore the multistep hypothesis of intestinal neoplasia (1993) (116)
Regulators of Gut Motility Revealed by a Gnotobiotic Model of Diet-Microbiome Interactions Related to Travel (2015) (116)
Kinetic and structural evidence for a sequential ordered Bi Bi mechanism of catalysis by Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase. (1991) (114)
Lifestyle of Lactobacillus plantarum in the mouse caecum. (2009) (113)
Microbial Community Dynamics and Stability during an Ammonia-Induced Shift to Syntrophic Acetate Oxidation (2014) (113)
Feeding the brain and nurturing the mind: Linking nutrition and the gut microbiota to brain development (2015) (112)
Postnatal lymphatic partitioning from the blood vasculature in the small intestine requires fasting-induced adipose factor (2007) (112)
Creating and characterizing communities of human gut microbes in gnotobiotic mice (2010) (112)
Bcl-2 inhibits ischemia-reperfusion-induced apoptosis in the intestinal epithelium of transgenic mice. (1999) (112)
Intracellular Helicobacter pylori in gastric epithelial progenitors. (2005) (111)
Host-bacterial coevolution and the search for new drug targets. (2008) (111)
Genetic studies reveal that myristoylCoA:protein N‐myristoyltransferase is an essential enzyme in Candida albicans (1995) (110)
Structure and expression of the human apolipoprotein A-IV gene. (1987) (110)
Biochemical studies of three Saccharomyces cerevisiae acyl-CoA synthetases, Faa1p, Faa2p, and Faa3p. (1994) (110)
The intestinal stem cell niche: There grows the neighborhood (2001) (108)
Comparison of myristoyl-CoA:protein N-myristoyltransferases from three pathogenic fungi: Cryptococcus neoformans, Histoplasma capsulatum, and Candida albicans. (1994) (106)
Spatial differentiation of the intestinal epithelium: analysis of enteroendocrine cells containing immunoreactive serotonin, secretin, and substance P in normal and transgenic mice. (1990) (105)
A strategy for isolation of cDNAs encoding proteins affecting human intestinal epithelial cell growth and differentiation: characterization of a novel gut-specific N-myristoylated annexin (1992) (104)
An integrated functional genomics and metabolomics approach for defining poor prognosis in human neuroendocrine cancers. (2005) (104)
Mapping enteroendocrine cell populations in transgenic mice reveals an unexpected degree of complexity in cellular differentiation within the gastrointestinal tract (1990) (104)
The structure of crystalline Escherichia coli-derived rat intestinal fatty acid-binding protein at 2.5-A resolution. (1988) (103)
Rat cellular retinol-binding protein II: use of a cloned cDNA to define its primary structure, tissue-specific expression, and developmental regulation. (1986) (103)
The cellular retinol binding protein II gene. Sequence analysis of the rat gene, chromosomal localization in mice and humans, and documentation of its close linkage to the cellular retinol binding protein gene. (1987) (103)
A sparse covarying unit that describes healthy and impaired human gut microbiota development (2019) (102)
A transgenic mouse model of metastatic carcinoma involving transdifferentiation of a gastric epithelial lineage progenitor to a neuroendocrine phenotype. (2004) (101)
Tissue-specific expression and developmental regulation of the rat apolipoprotein B gene. (1986) (100)
Long-Term Culture Captures Injury-Repair Cycles of Colonic Stem Cells (2019) (100)
Mining the human gut microbiota for effector strains that shape the immune system. (2014) (100)
Developmental and structural studies of an intracellular lipid binding protein expressed in the ileal epithelium. (1990) (100)
Characterization of sites of tyrosine sulfation in proteins and criteria for predicting their occurrence. (1986) (99)
The primary translation product of rat intestinal apolipoprotein A-I mRNA is an unusual preproprotein. (1982) (99)
Molecular characterization of mouse gastric epithelial progenitor cells (2002) (99)
Rat intestinal fatty acid binding protein. A model system for analyzing the forces that can bind fatty acids to proteins. (1993) (97)
Tissue-specific expression, developmental regulation, and chromosomal mapping of the lecithin: cholesterol acyltransferase gene. Evidence for expression in brain and testes as well as liver. (1989) (96)
Sip2, an N-Myristoylated β Subunit of Snf1 Kinase, Regulates Aging in Saccharomyces cerevisiae by Affecting Cellular Histone Kinase Activity, Recombination at rDNA Loci, and Silencing* (2003) (95)
Genetic mosaic analysis reveals that GATA-4 is required for proper differentiation of mouse gastric epithelium. (2002) (94)
Genetic and developmental regulation of the lipoprotein lipase gene: loci both distal and proximal to the lipoprotein lipase structural gene control enzyme expression. (1989) (94)
Primary structure and comparative sequence analysis of an insect apolipoprotein. Apolipophorin-III from Manduca sexta. (1987) (94)
A molecular profile of the mouse gastric parietal cell with and without exposure to Helicobacter pylori (2001) (93)
A Role for Saccharomyces cerevisiae Fatty Acid Activation Protein 4 in Regulating ProteinN-Myristoylation during Entry into Stationary Phase* (1998) (93)
Expression of thin aggregative fimbriae promotes interaction of Salmonella typhimurium SR-11 with mouse small intestinal epithelial cells (1997) (93)
Message from a human gut symbiont: sensitivity is a prerequisite for sharing. (2004) (92)
Analyzing the molecular foundations of commensalism in the mouse intestine. (2000) (91)
Refined apoprotein structure of rat intestinal fatty acid binding protein produced in Escherichia coli. (1989) (90)
Gastric epithelial morphogenesis in normal and transgenic mice. (1997) (90)
Molecular Characterization of a Metastatic Neuroendocrine Cell Cancer Arising in the Prostates of Transgenic Mice* 210 (2002) (90)
The mouse ileal lipid-binding protein gene: a model for studying axial patterning during gut morphogenesis (1994) (90)
A comparative analysis of the kinetic mechanism and peptide substrate specificity of human and Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase. (1993) (89)
Refinement of the structure of Escherichia coli-derived rat intestinal fatty acid binding protein with bound oleate to 1.75-A resolution. Correlation with the structures of the apoprotein and the protein with bound palmitate. (1992) (89)
Mutations of human myristoyl-CoA:protein N-myristoyltransferase cause temperature-sensitive myristic acid auxotrophy in Saccharomyces cerevisiae. (1992) (89)
Forced Expression of Id-1 in the Adult Mouse Small Intestinal Epithelium Is Associated with Development of Adenomas* (1998) (88)
In vitro conversion of proapoprotein A-I to apoprotein A-I. Partial characterization of an extracellular enzyme activity. (1983) (88)
Operon prediction without a training set (2005) (88)
Fluorine nuclear magnetic resonance analysis of the ligand binding properties of two homologous rat cellular retinol-binding proteins expressed in Escherichia coli. (1991) (88)
Intestinal epithelial cell differentiation: new insights from mice, flies and nematodes. (1995) (87)
Rac1 mutations produce aberrant epithelial differentiation in the developing and adult mouse small intestine. (2000) (87)
Oral Antibiotic Treatment of Mice Exacerbates the Disease Severity of Multiple Flavivirus Infections (2018) (85)
Manipulation of a nuclear NAD+ salvage pathway delays aging without altering steady-state NAD+ levels. (2013) (85)
Characterization of the peripheral neuropathy in neonatal and adult mice that are homozygous for the fatty liver dystrophy (fld) mutation. (1991) (85)
Use of fetal intestinal isografts from normal and transgenic mice to study the programming of positional information along the duodenal-to-colonic axis. (1992) (85)
A Microbiota-Directed Food Intervention for Undernourished Children (2021) (82)
The nucleotide sequence of the rat liver fatty acid-binding protein gene. Evidence that exon 1 encodes an oligopeptide domain shared by a family of proteins which bind hydrophobic ligands. (1986) (81)
Use of Normal and Transgenic Mice to Examine the Relationship between Terminal Differentiation of Intestinal Epithelial Cells and Accumulation of Their Cell Cycle Regulators* (1996) (81)
Protein phosphatase 2a (PP2A) binds within the oligomerization domain of striatin and regulates the phosphorylation and activation of the mammalian Ste20-Like kinase Mst3 (2011) (81)
The mouse intestinal fatty acid binding protein gene: nucleotide sequence, pattern of developmental and regional expression, and proposed structure of its protein product. (1992) (80)
Cellular differentiation in the emerging fetal rat small intestinal epithelium: mosaic patterns of gene expression. (1989) (80)
The Gut Microbiota, Food Science, and Human Nutrition: A Timely Marriage. (2017) (79)
Fibroblast growth factor receptor signalling is crucial for liver homeostasis and regeneration (2003) (79)
Selection of Multipotent Stem Cells during Morphogenesis of Small Intestinal Crypts of Lieberkühn Is Perturbed by Stimulation of Lef-1/β-Catenin Signaling* (2002) (79)
Stimulation of activin receptor II signaling pathways inhibits differentiation of multiple gastric epithelial lineages. (1998) (79)
Kinetics of avian vitellogenin messenger RNA induction. Comparison between primary and secondary response to estrogen. (1977) (79)
Comparison of the patterns of expression of rat intestinal fatty acid binding protein/human growth hormone fusion genes in cultured intestinal epithelial cell lines and in the gut epithelium of transgenic mice. (1993) (78)
Rat heart fatty acid-binding protein is highly homologous to the murine adipocyte 422 protein and the P2 protein of peripheral nerve myelin. (1986) (77)
Comparative analysis of the β transducin family with identification of several new members including PWP1, a nonessential gene of Saccharomyces cerevisiae that is divergently transcribed from NMT1 (1992) (77)
Cell lineage-specific and differentiation-dependent patterns of CCAAT/enhancer binding protein alpha expression in the gut epithelium of normal and transgenic mice. (1993) (77)
Cloning of a complementary deoxyribonucleic acid encoding a portion of rat intestinal preapolipoprotein AIV messenger ribonucleic acid. (1982) (77)
Functional Genomic Studies of the Intestinal Response to a Foodborne Enteropathogen in a Humanized Gnotobiotic Mouse Model* (2007) (76)
Trafficking of exogenous fatty acids within Caco-2 cells. (1992) (76)
Developmental regulation of a gene that encodes a cysteine-rich intestinal protein and maps near the murine immunoglobulin heavy chain locus. (1986) (75)
Regulators of Gut Motility Revealed by a Gnotobiotic Model of Diet-Microbiome Interactions Related to Travel (2015) (75)
Anthropology of microbes (2012) (75)
Comparative analysis of repeated sequences in rat apolipoproteins A-I, A-IV, and E. (1985) (75)
Immunocytochemical studies suggest two pathways for enteroendocrine cell differentiation in the colon. (1992) (74)
Comparison of the ligand binding properties of two homologous rat apocellular retinol-binding proteins expressed in Escherichia coli. (1988) (74)
Isolation of a Saccharomyces cerevisiae long chain fatty acyl:CoA synthetase gene (FAA1) and assessment of its role in protein N- myristoylation (1992) (73)
Reciprocal epithelial-mesenchymal FGF signaling is required for cecal development (2006) (72)
Regulation of creatine phosphokinase expression during differentiation of BC3H1 cells. (1983) (72)
Analysis of gene–environment interactions in postnatal development of the mammalian intestine (2015) (72)
Targeting of proteins into the eukaryotic secretory pathway: Signal peptide structure/function relationships (1990) (71)
Neutrophils and B cells express XCR1 receptor and chemotactically respond to lymphotactin. (2001) (71)
On computer-assisted analysis of biological sequences: proline punctuation, consensus sequences, and apolipoprotein repeats. (1986) (71)
New challenges in studying nutrition-disease interactions in the developing world. (2008) (71)
An analog of myristic acid with selective toxicity for African trypanosomes. (1991) (70)
Helicobacter pylori Attaches to NeuAcα2,3Galβ1,4 Glycoconjugates Produced in the Stomach of Transgenic Mice Lacking Parietal Cells (1999) (70)
Rat apolipoprotein A-IV contains 13 tandem repetitions of a 22-amino acid segment with amphipathic helical potential. (1984) (69)
Myristoylated and nonmyristoylated forms of a protein are phosphorylated by protein kinase C. (1989) (69)
Use of transgenic mice to study regulation of gene expression in the parietal cell lineage of gastric units. (1993) (69)
The human microbiome: eliminating the biomedical/environmental dichotomy in microbial ecology. (2007) (69)
Comparison of the tissue-specific expression and developmental regulation of two closely linked rodent genes encoding cytosolic retinol-binding proteins. (1987) (68)
Replication of human immunodeficiency virus 1 and Moloney murine leukemia virus is inhibited by different heteroatom-containing analogs of myristic acid. (1989) (68)
Our unindicted coconspirators: human metabolism from a microbial perspective. (2010) (67)
Identifying strains that contribute to complex diseases through the study of microbial inheritance (2015) (66)
Superorganisms and Holobionts (2013) (66)
The structure of myristoyl-CoA:protein N-myristoyltransferase. (1999) (65)
Understanding gastrointestinal epithelial cell biology: lessons from mice with help from worms and flies. (1993) (65)
Use of transgenic mice to infer the biological properties of small intestinal stem cells and to examine the lineage relationships of their descendants. (1991) (65)
Human liver fatty acid binding protein. Isolation of a full length cDNA and comparative sequence analyses of orthologous and paralogous proteins. (1985) (65)
Primary structure of apolipophorin-III from the migratory locust, Locusta migratoria. Potential amphipathic structures and molecular evolution of an insect apolipoprotein. (1988) (65)
Sequence of lamprey vitellogenin. Implications for the lipovitellin crystal structure. (1992) (64)
Substrate specificity of eukaryotic signal peptidase. Site-saturation mutagenesis at position -1 regulates cleavage between multiple sites in human pre (delta pro) apolipoprotein A-II. (1988) (63)
Bacterial Community in the Crop of the Hoatzin, a Neotropical Folivorous Flying Bird (2008) (63)
Redistribution of protein kinase C during mitogenesis of human B lymphocytes. (1986) (62)
Biosynthesis of human preproapolipoprotein A-II. (1983) (62)
Improved magnetic resonance imaging detection of prostate cancer in a transgenic mouse model. (2002) (62)
Chimeric-transgenic mice represent a powerful tool for studying how the proliferation and differentiation programs of intestinal epithelial cell lineages are regulated. (1993) (61)
Folding of a predominantly beta-structure protein: rat intestinal fatty acid binding protein. (1990) (61)
Biosynthesis of human insulin-like growth factor I (IGF-I). The primary translation product of IGF-I mRNA contains an unusual 48-amino acid signal peptide. (1987) (61)
Silica-induced pulmonary inflammation in rats: activation of NF-kappa B and its suppression by dexamethasone. (1998) (61)
Simian Virus 40 T Antigen-induced Amplification of Pre-parietal Cells in Transgenic Mice. (1995) (60)
The impact of parietal cells on Helicobacter pylori tropism and host pathology: An analysis using gnotobiotic normal and transgenic mice (2003) (59)
Laser capture microdissection of mouse intestine: characterizing mRNA and protein expression, and profiling intermediary metabolism in specified cell populations. (2002) (59)
Characterization of an Enhancer Element in the Human Apolipoprotein C-III Gene That Regulates Human Apolipoprotein A-I Gene Expression in the Intestinal Epithelium (*) (1995) (58)
Computer-assisted predictions of signal peptidase processing sites. (1987) (58)
Design and synthesis of novel imidazole-substituted dipeptide amides as potent and selective inhibitors of Candida albicans myristoylCoA:protein N-myristoyltransferase and identification of related tripeptide inhibitors with mechanism-based antifungal activity. (1997) (58)
RNA interference of achaete-scute homolog 1 in mouse prostate neuroendocrine cells reveals its gene targets and DNA binding sites. (2004) (57)
Colonization of Germ-free Transgenic Mice with Genotyped Helicobacter pylori Strains from a Case-Control Study of Gastric Cancer Reveals a Correlation between Host Responses and HsdS Components of Type I Restriction-Modification Systems* 210 (2002) (56)
A Tetraspan Membrane Glycoprotein Produced in the Human Intestinal Epithelium and Liver That Can Regulate Cell Density-dependent Proliferation (*) (1995) (56)
Comparison of the acyl chain specificities of human myristoyl-CoA synthetase and human myristoyl-CoA:protein N-myristoyltransferase. (1993) (56)
Complementation of Saccharomycescerevisiae Strains Containing Fatty Acid Activation Gene (FAA) Deletions with a Mammalian Acyl-CoA Synthetase (*) (1995) (55)
Evolution of the apolipoproteins. Structure of the rat apo-A-IV gene and its relationship to the human genes for apo-A-I, C-III, and E. (1986) (55)
Heteroatom-substituted fatty acid analogs as substrates for N-myristoyltransferase: an approach for studying both the enzymology and function of protein acylation. (1988) (55)
Gastrotropin: not an enterooxyntin but a member of a family of cytoplasmic hydrophobic ligand binding proteins. (1989) (54)
11-(Ethylthio)undecanoic acid. A myristic acid analogue of altered hydrophobicity which is functional for peptide N-myristoylation with wheat germ and yeast acyltransferase. (1988) (54)
The Candida albicans myristoyl-CoA:protein N-myristoyltransferase gene. Isolation and expression in Saccharomyces cerevisiae and Escherichia coli. (1992) (53)
Organization of the crypt-villus axis and evolution of its stem cell hierarchy during intestinal development. (1995) (53)
Incorporation of 12-methoxydodecanoate into the human immunodeficiency virus 1 gag polyprotein precursor inhibits its proteolytic processing and virus production in a chronically infected human lymphoid cell line. (1991) (52)
An evolving perspective about the origins of childhood undernutrition and nutritional interventions that includes the gut microbiome (2014) (51)
Expression of wild-type and mutant simian virus 40 large tumor antigens in villus-associated enterocytes of transgenic mice. (1994) (51)
Structure of a SusD homologue, BT1043, involved in mucin O-glycan utilization in a prominent human gut symbiont. (2009) (51)
Myristic acid auxotrophy caused by mutation of S. cerevisiae myristoyl- CoA:protein N-myristoyltransferase (1991) (51)
Biosynthesis of human preapolipoprotein A-IV. (1984) (50)
Cloning of a double-stranded cDNA that codes for a portion of chicken preproalbumin. A general method for isolating a specific DNA sequence from partially purified mRNA. (1978) (50)
Escherichia coli-derived rat intestinal fatty acid binding protein with bound myristate at 1.5 A resolution and I-FABPArg106-->Gln with bound oleate at 1.74 A resolution. (1994) (50)
Selective peptidic and peptidomimetic inhibitors of Candida albicans myristoylCoA: protein N-myristoyltransferase: a new approach to antifungal therapy. (1997) (49)
Design and syntheses of potent and selective dipeptide inhibitors of Candida albicans myristoyl-CoA:protein N-myristoyltransferase. (1995) (49)
Rat intestinal apolipoprotein B gene expression. Evidence for integrated regulation by bile salt, fatty acid, and phospholipid flux. (1988) (48)
Suppressor and Activator Functions Mediated by a Repeated Heptad Sequence in the Liver Fatty Acid-binding Protein Gene (Fabpl) (1997) (48)
Temporal and spatial patterns of transgene expression in aging adult mice provide insights about the origins, organization, and differentiation of the intestinal epithelium. (1991) (48)
Theoretical and experimental approaches for studying factors defining the Helicobacter pylori-host relationship. (2000) (48)
Educating Future Scientists (2003) (47)
Novel biologically active nonpeptidic inhibitors of myristoylCoA:protein N-myristoyltransferase. (1998) (47)
Bangladesh Environmental Enteric Dysfunction (BEED) study: protocol for a community-based intervention study to validate non-invasive biomarkers of environmental enteric dysfunction (2017) (46)
Understanding the mother-breastmilk-infant “triad” (2020) (46)
Genetic mosaic analysis indicates that the bulb region of coat hair follicles contains a resident population of several active multipotent epithelial lineage progenitors. (2002) (46)
Globin gene expression in erythroid human fetal liver cells. (1989) (45)
Genetic analysis of the role of Saccharomyces cerevisiae acyl-CoA synthetase genes in regulating protein N-myristoylation. (1994) (45)
Characterizing the Interactions between a Naturally Primed Immunoglobulin A and Its Conserved Bacteroides thetaiotaomicron Species-specific Epitope in Gnotobiotic Mice* (2015) (45)
Protein N-Myristoylation (2004) (45)
Analyzing the structures, functions and evolution of two abundant gastrointestinal fatty acid binding proteins with recombinant DNA and computational techniques. (1985) (45)
A rendezvous with our microbes (2011) (44)
Use of transgenic mice to study the routing of secretory proteins in intestinal epithelial cells: analysis of human growth hormone compartmentalization as a function of cell type and differentiation [published erratum appears in J Cell Biol 1990 Jan;110(1):following 227] (1989) (44)
Mechanisms by which sialylated milk oligosaccharides impact bone biology in a gnotobiotic mouse model of infant undernutrition (2019) (44)
A 20-nucleotide element in the intestinal fatty acid binding protein gene modulates its cell lineage-specific, differentiation-dependent, and cephalocaudal patterns of expression in transgenic mice. (1995) (43)
N-myristoylation of Arf proteins in Candida albicans: an in vivo assay for evaluating antifungal inhibitors of myristoyl-CoA: protein N-myristoyltransferase. (1997) (42)
Analyzing the substrate specificity of Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase by co-expressing it with mammalian G protein alpha subunits in Escherichia coli. (1991) (42)
Quantitative assessment of the impact of the gut microbiota on lysine ε-acetylation of host proteins using gnotobiotic mice (2012) (42)
Titration calorimetric analysis of AcylCoA recognition by myristoylCoA:protein N-myristoyltransferase. (1997) (41)
A multi-amplicon 16S rRNA sequencing and analysis method for improved taxonomic profiling of bacterial communities. (2018) (41)
Structural and functional studies of Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase produced in Escherichia coli. Evidence for an acyl-enzyme intermediate. (1990) (41)
Fecal microbiota diversity in survivors of adolescent/young adult Hodgkin lymphoma: a study of twins (2012) (41)
Toxicity of myristic acid analogs toward African trypanosomes. (1994) (41)
Genetic and Biochemical Studies Establish That the Fungicidal Effect of a Fully Depeptidized Inhibitor of Cryptococcus neoformans Myristoyl-CoA:ProteinN-Myristoyltransferase (Nmt) Is Nmt-dependent* (1998) (40)
Antigenic structure of histone H2B. (1985) (39)
Living and commuting in intestinal crypts. (1999) (39)
Calixarenes as hosts in aqueous media: inclusion complexation of ferrocene derivatives by a water-soluble calix[6]arene (1993) (39)
Eukaryotic signal peptide structure/function relationships. Identification of conformational features which influence the site and efficiency of co-translational proteolytic processing by site-directed mutagenesis of human pre(delta pro)apolipoprotein A-II. (1989) (39)
Alteration of the binding specificity of cellular retinol-binding protein II by site-directed mutagenesis. (1991) (39)
Structural features in the NH2-terminal region of a model eukaryotic signal peptide influence the site of its cleavage by signal peptidase. (1990) (39)
Effects of a gut pathobiont in a gnotobiotic mouse model of childhood undernutrition (2016) (38)
Characterization of rat cellular retinol-binding protein II expressed in Escherichia coli. (1987) (38)
Epithelial cell differentiation in normal and transgenic mouse intestinal isografts (1991) (38)
Evaluating microbiome-directed fibre snacks in gnotobiotic mice and humans (2021) (37)
Duodenal Microbiota in Stunted Undernourished Children with Enteropathy. (2020) (37)
Isothermal titration calorimetric studies of Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase. Determinants of binding energy and catalytic discrimination among acyl-CoA and peptide ligands. (1994) (37)
Studies of the catalytic activities and substrate specificities of Saccharomyces cerevisiae myristoyl-coenzyme A: protein N-myristoyltransferase deletion mutants and human/yeast Nmt chimeras in Escherichia coli and S. cerevisiae. (1992) (37)
Host-dependent Lewis (Le) antigen expression in Helicobacter pylori cells recovered from Leb-transgenic mice (2009) (37)
Conformationally constrained [p-(omega-aminoalkyl)phenacetyl]-L-seryl-L-lysyl dipeptide amides as potent peptidomimetic inhibitors of Candida albicans and human myristoyl-CoA:protein N-myristoyl transferase. (1997) (37)
Comparison of the Reactivity of Tetradecenoic Acids, a Triacsin, and Unsaturated Oximes with Four Purified Saccharomyces cerevisiae Fatty Acid Activation Proteins (*) (1995) (36)
Molecular Characterization of Mouse Gastric Zymogenic Cells* (2003) (36)
Reconstitution of protein N-myristoylation in Escherichia coli (1990) (36)
Impact of the gut microbiota on enhancer accessibility in gut intraepithelial lymphocytes (2016) (35)
Linkage between cellular communications, energy utilization, and proliferation in metastatic neuroendocrine cancers (2006) (35)
Bioremediation of a Common Product of Food Processing by a Human Gut Bacterium. (2019) (34)
A transgenic mouse model that is useful for analyzing cellular and geographic differentiation of the intestine during fetal development. (1989) (34)
Interactions between gastric epithelial stem cells and Helicobacter pylori in the setting of chronic atrophic gastritis. (2006) (34)
In vitro translation of avian vitellogenin messenger RNA. (1977) (34)
29 Combining gnotobiotic mouse models with functional genomics to define the impact of the microflora on host physiology (2002) (33)
Expression of a mammalian fatty acid-binding protein in Escherichia coli. (1984) (33)
Expression of liver fatty acid-binding protein/human growth hormone fusion genes within the enterocyte and enteroendocrine cell populations of fetal transgenic mice. (1991) (32)
Synergism between diacylglycerols and calcium ionophore in the induction of human B cell proliferation mimics the inositol lipid polyphosphate breakdown signals induced by crosslinking surface immunoglobulin. (1985) (31)
Deletion of the propeptide from human preproapolipoprotein A-II redirects cotranslational processing by signal peptidase. (1986) (31)
Educating future scientists (2001) (31)
Bi-transgenic Mice Reveal that K-rasVal12 Augments a p53-independent Apoptosis When Small Intestinal Villus Enterocytes Reenter the Cell Cycle (1997) (31)
The absence of a microbiota enhances TSLP expression in mice with defective skin barrier but does not affect the severity of their allergic inflammation (2013) (30)
Induction of vitellogenin synthesis by estrogen in avian liver: relationship between level of vitellogenin mRNA and vitellogenin synthesis. (1976) (30)
Functional significance of myristoyl moiety in N-myristoyl proteins. (1995) (30)
Proteolytic processing of the primary translation product of rat intestinal apolipoprotein A-IV mRNA. Comparison with preproapolipoprotein A-I processing. (1982) (30)
Developmental changes in the expression of genes involved in cholesterol biosynthesis and lipid transport in human and rat fetal and neonatal livers. (1989) (29)
The fatty liver dystrophy (fld) mutation (1989) (28)
Analysis of the compartmentalization of myristoyl-CoA:protein N-myristoyltransferase in Saccharomyces cerevisiae. (1992) (28)
MyristoylCoA:protein N-myristoyltransferase. (2006) (28)
Primary induction of vitellogenin mRNA in the rooster by 17beta-estradiol. (1978) (28)
Diarrhea as a Potential Cause and Consequence of Reduced Gut Microbial Diversity Among Undernourished Children in Peru (2019) (27)
A Gnotobiotic Transgenic Mouse Model for Studying Interactions between Small Intestinal Enterocytes and Intraepithelial Lymphocytes* 210 (2002) (27)
Ets-1 activates parathyroid hormone-related protein gene expression in tumorigenic breast epithelial cells (2003) (27)
Viewing the human microbiome through three-dimensional glasses: integrating structural and functional studies to better define the properties of myriad carbohydrate-active enzymes (2010) (27)
Residues flanking the COOH-terminal C-region of a model eukaryotic signal peptide influence the site of its cleavage by signal peptidase and the extent of coupling of its co-translational translocation and proteolytic processing in vitro. (1990) (27)
Bifidobacterium infantis treatment promotes weight gain in Bangladeshi infants with severe acute malnutrition (2022) (26)
Use of Escherichia coli strains containing fad mutations plus a triple plasmid expression system to study the import of myristate, its activation by Saccharomyces cerevisiae acyl-CoA synthetase, and its utilization by S. cerevisiae myristoyl-CoA:protein N-myristoyltransferase. (1993) (26)
Training the next generation of biomedical investigators in glycosciences. (2016) (26)
Scanning Alanine Mutagenesis and De-peptidization of a Candida albicans Myristoyl-CoA:ProteinN-Myristoyltransferase Octapeptide Substrate Reveals Three Elements Critical for Molecular Recognition* (1997) (26)
Combined Prebiotic and Microbial Intervention Improves Oral Cholera Vaccination Responses in a Mouse Model of Childhood Undernutrition. (2020) (26)
Genetic and biochemical studies of a mutant Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase, nmt72pLeu99-->Pro, that produces temperature-sensitive myristic acid auxotrophy. (1993) (26)
Analogs of palmitoyl-CoA that are substrates for myristoyl-CoA:protein N-myristoyltransferase. (1992) (26)
Lipid Modifications of G Protein Subunits MYRISTOYLATION OF Go, INCREASES ITS AFFINITY FOR By* (2001) (26)
Altered membrane association of p60v-src and a murine 63-kDa N-myristoyl protein after incorporation of an oxygen-substituted analog of myristic acid. (1989) (26)
Muegge Mammalian Phylogeny and Within Humans Diet Drives Convergence in Gut Microbiome Functions Across (2011) (25)
Identifying determinants of bacterial fitness in a model of human gut microbial succession (2020) (25)
Food and microbiota in the FDA regulatory framework (2017) (25)
Linking the duodenal microbiota to stunting in a cohort of undernourished Bangladeshi children with enteropathy (2020) (25)
Functional analysis of protein N-myristoylation: metabolic labeling studies using three oxygen-substituted analogs of myristic acid and cultured mammalian cells provide evidence for protein-sequence-specific incorporation and analog-specific redistribution. (1990) (25)
Response of Gastric Epithelial Progenitors to Helicobacter pylori Isolates Obtained from Swedish Patients with Chronic Atrophic Gastritis* (2009) (24)
Regulated expression of polysaccharide utilization and capsular biosynthesis loci in biofilm and planktonic Bacteroides thetaiotaomicron during growth in chemostats (2014) (23)
Novel fatty acyl substrates for myristoyl-CoA:protein N-myristoyl-transferase. (1990) (23)
Pre-steady-state kinetic studies of Saccharomyces cerevisiae myristoylCoA:protein N-myristoyltransferase mutants identify residues involved in catalysis. (2001) (23)
Helicobacter pylori attaches to NeuAc alpha 2,3Gal beta 1,4 glycoconjugates produced in the stomach of transgenic mice lacking parietal cells. (1999) (23)
Human proapolipoprotein A-II is cleaved following secretion from Hep G2 cells by a thiol protease. (1984) (23)
Il-8((3-73))K11R is a high affinity agonist of the neutrophil CXCR1 and CXCR2. (2001) (22)
Liver fatty acid-binding protein: a marker for studying cellular differentiation in gut epithelial neoplasms. (1990) (22)
Extranuclear sequestration of phospho-Jun N-terminal kinase and distorted villi produced by activated Rac1 in the intestinal epithelium of chimeric mice. (2001) (22)
Use of photoactivatable peptide substrates of Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase (Nmt1p) to characterize a myristoyl-CoA-Nmt1p-peptide ternary complex and to provide evidence for an ordered reaction mechanism. (1993) (22)
Linking the duodenal microbiota to stunting in a cohort of undernourished Bangladeshi children with enteropathy. (2020) (21)
Extracellular processing of proapolipoprotein A-II in Hep G2 cell cultures is mediated by a 54-kDa protease immunologically related to cathepsin B. (1985) (21)
What is the value of a food and drug administration investigational new drug application for fecal microbiota transplantation to treat Clostridium difficile Infection? (2014) (21)
Expression of human preproapo AI and pre(delta pro)apoAI in a murine pituitary cell line (AtT-20). A comparison of their intracellular compartmentalization and lipid affiliation. (1988) (21)
Bringing the Human Genome and the Revolution in Bioinformatics to the Medical School Classroom: A Case Report from Washington University School of Medicine (2001) (21)
Intracellular fatty-acid-binding proteins and their genes: useful models for diverse biological questions (1991) (21)
Genomics and proteomics converge on Helicobacter pylori. (2001) (21)
Biosynthesis of apolipoprotein C-III in rat liver and small intestinal mucosa. (1984) (21)
Transient-state kinetic analysis of Saccharomyces cerevisiae myristoylCoA:protein N-myristoyltransferase reveals that a step after chemical transformation is rate limiting. (2000) (20)
Gnotobiotic transgenic mice reveal that transmission of Helicobacter pylori is facilitated by loss of acid-producing parietal cells in donors and recipients. (2004) (20)
Biochemical Studies of Saccharomyces cerevisiae Myristoyl-coenzyme A:Protein N-Myristoyltransferase Mutants* (1996) (20)
Suppressors of nmtl-181, a conditional lethal allele of the Saccharomyces cerevisiae myristoyl-CoA:protein N-myristoyltransferase gene, reveal proteins involved in regulating protein N-myristoylation. (1994) (20)
Bcl-2 inhibits ischemia-reperfusion-induced apoptosis in the intestinal epithelium of transgenic mice. (1999) (19)
Crystallization of rat intestinal fatty acid binding protein. Preliminary X-ray data obtained from protein expressed in Escherichia coli. (1987) (19)
Use of isografts to study proliferation and differentiation programs of mouse stomach epithelia. (1994) (19)
Gene discovery from a pilot study of the transcriptomes from three diverse microbial eukaryotes: Corallomyxa tenera, Chilodonella uncinata, and Subulatomonas tetraspora (2012) (19)
Expression of rat intestinal fatty acid binding protein in E. coli and its subsequent structural analysis: a model system for studying the molecular details of fatty acid-protein interaction (2004) (19)
The hypothyroid (hyt/hyt) mouse: a model system for studying the effects of thyroid hormone on developmental changes in gene expression. (1988) (18)
Proteolytic processing and compartmentalization of the primary translation products of mammalian apolipoprotein mRNAs. (1986) (18)
Fluorescence studies of rat cellular retinol binding protein II produced in Escherichia coli: an analysis of four tryptophan substitution mutants. (1992) (18)
19F nuclear magnetic resonance studies of 6-fluorotryptophan-substituted rat cellular retinol binding protein II produced in Escherichia coli. An analysis of four tryptophan substitution mutants and their interactions with all-trans-retinol. (1990) (18)
Study of Environmental Enteropathy and Malnutrition (SEEM) in Pakistan: protocols for biopsy based biomarker discovery and validation (2019) (18)
Author response: Cohabiting family members share microbiota with one another and with their dogs (2013) (18)
Gut Microbiota Features Associated With Campylobacter Burden and Postnatal Linear Growth Deficits in a Peruvian Birth Cohort (2019) (18)
Decline curve analysis in fractured low permeability gas wells in the Piceance Basin (1983) (18)
Structure-function analyses of mammalian cellular retinol-binding proteins by expression in Escherichia coli. (1990) (17)
The substrate specificity of Saccharomyces cerevisiae myristoyl-CoA: protein N-myristoyltransferase. Polar probes of the enzyme's myristoyl-CoA recognition site. (1994) (17)
Compartmentalization of mammalian proteins produced in Escherichia coli. (1990) (16)
The effects of deleting the propeptide from human preproapolipoprotein A-I on co-translational translocation and signal peptidase processing. (1987) (16)
The enzyme that cleaves apolipoprotein A-II upon in vitro incubation of human plasma high-density lipoprotein-3 with blood polymorphonuclear cells is an elastase. (1984) (16)
High resolution X-ray studies of mammalian intestinal and muscle fatty acid-binding proteins provide an opportunity for defining the chemical nature of fatty acid: protein interactions (1993) (15)
Protein phosphatase 2 a ( PP 2 A ) binds within the oligomerization domain of striatin and regulates the phosphorylation and activation of the mammalian Ste 20-Like kinase Mst 3 (14)
Attenuated Effects of Bile Acids on Glucose Metabolism and Insulin Sensitivity in a Male Mouse Model of Prenatal Undernutrition (2017) (14)
Strain-level functional variation in the human gut microbiota based on bacterial binding to artificial food particles. (2021) (14)
Regulation of gene expression in gastric epithelial cell populations of fetal, neonatal, and adult transgenic mice. (1992) (14)
Nuclear magnetic resonance studies of 6-fluorotryptophan-substituted rat cellular retinol-binding protein II produced in Escherichia coli. Analysis of the apoprotein and the holoprotein containing bound all-trans-retinol and all-trans-retinal. (1989) (14)
Characterization of crystalline rat liver fatty acid binding protein produced in Escherichia coli. (1990) (13)
Proof-of-concept study of the efficacy of a microbiota-directed complementary food formulation (MDCF) for treating moderate acute malnutrition (2020) (13)
Moluccella laevis lectin, a marker for cellular differentiation programs in mouse gut epithelium. (1995) (13)
Uncoupling of co-translational translocation from signal peptidase processing in a mutant rat preapolipoprotein-A-IV with a deletion that includes the COOH-terminal region of its signal peptide. (1989) (13)
Thermodynamic studies of myristoyl-CoA: protein N-myristoyltransferase using isothermal titration calorimetry. (1995) (12)
13C NMR studies of fatty acid-protein interactions: comparison of homologous fatty acid-binding proteins produced in the intestinal epithelium (2004) (12)
Protein N-myristoylation: simple questions, unexpected answers. (1990) (12)
A transgenic mouse model for studying the lineage relationships and differentiation program of type II pneumocytes at various stages of lung development. (1993) (12)
Transcription of INO2 and INO4 is regulated by the state of protein N-myristoylation in Saccharomyces cerevisiae. (1998) (12)
Microbial liberation of N-methylserotonin from orange fiber in gnotobiotic mice and humans (2022) (11)
The “Minimum Information about an ENvironmental Sequence” (MIENS) specification (2010) (11)
Response from Jeffrey I. Gordon et al.: Commensal bacteria make a difference. (2003) (10)
Gut microbiome contributions to altered metabolism in a pig model of undernutrition (2021) (10)
Apolipoproteins of human plasma high density lipoproteins. Biology, biochemistry and clinical significance. (1984) (9)
Identification of the RNA Binding Domain of T4 RegA Protein by Structure-based Mutagenesis* (1999) (9)
Expression of a liver fatty acid binding protein/human decay-accelerating factor/HLA-B44 chimeric gene in transgenic mice. (1991) (9)
Crystallization of rat cellular retinol binding protein II. Preliminary X-ray data obtained from the apoprotein expressed in Escherichia coli. (1987) (9)
Differential cholecystokinin gene expression in brain and gut of the fasted rat. (1990) (9)
Inflammasome-mediated dysbiosis regulatesprogressionofNAFLDandobesity (2012) (9)
Specific transcription in chicken liver chromatin by endogenous RNA polymerase II. Comparison of an estrogen-inducible gene with a constitutively expressed gene. (1979) (9)
A genomic view of our symbiosis with members of the gut microbiota. (2005) (9)
Processing of rat liver apoprotein E primary translation product. (1984) (8)
Rat apolipoprotein A-IV: application of computational methods for studying the structure, function, and evolution of a protein. (1986) (8)
Nucleophile-dependent substitution reactions of 5-halovaleric acid esters: synthesis of 6,12-dioxamyristic acid (1991) (8)
Comparative in vitro study of the pro-apolipoprotein A-I to apolipoprotein A-I converting activity between normal and Tangier plasma. (1984) (8)
Methods for the Identification of H. pylori Host Receptors. (1997) (8)
Synthesis of myristic acid analogs with anti-HIV activity that may be resistant to metabolic processing by β-oxidation (1993) (8)
Biosynthesis and compartmentalization of rat-intestinal vitamin-D-dependent calcium-binding protein. (1984) (8)
Characterization of Acyl Adenyl Anhydrides: Differences in the Hydrolytic Rates of Fatty Acyl-AMP and Aminoacyl-AMP Derivatives (1998) (8)
THE METABOLIC SIGNIFICANCE OF MAMMALIAN FATTY-ACID (1987) (7)
Human developmental biology viewed from a microbial perspective (2017) (7)
Physiological mechanisms of sustained fumagillin-induced weight loss. (2018) (7)
An approach for evaluating the effects of dietary fiber polysaccharides on the human gut microbiome and plasma proteome (2022) (6)
MyristolyCoA:protein N-myristoyltransferase as a therapeutic target for inhibiting replication of human immunodeficiency virus-1 (1993) (6)
Applying indirect open-circuit calorimetry to study energy expenditure in gnotobiotic mice harboring different human gut microbial communities (2019) (6)
MapLinker: a software tool that aids physical map-linked whole genome shotgun assembly (2005) (6)
Primary Structure and Comparative Sequence Analysis of an Insect Apolipoprotein (1987) (6)
Products of gut microbial Toll/interleukin-1 receptor domain NADase activities in gnotobiotic mice and Bangladeshi children with malnutrition (2022) (5)
The Human Intestinal Microbiota and Microbiome (2009) (5)
Effects of Forced Expression of an NH 2 -terminal Truncated (cid:98) -Catenin on Mouse Intestinal Epithelial Homeostasis (1998) (5)
Crystallographic phasing of myristoyl-CoA-protein N-myristoyltransferase using an iodinated analog of myristoyl-CoA. (2001) (5)
Microbiota functional activity biosensors for characterizing nutrient metabolism in vivo (2021) (5)
Corrigendum to "Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing" [Virology 436 (2) (2013) 295-303] (2013) (4)
Author Correction: Transposable elements drive widespread expression of oncogenes in human cancers (2019) (4)
Melding microbiome and nutritional science with early child development (2021) (3)
Small‐molecule inhibitors against type 1 pili selectively target uropathogenic E. coli in the gut and bladder (2017) (3)
MyristoylCoA:protein N‐Myristoyltransferase: Probing Host‐Guest Interactions Using Synthetic Substrates (1992) (3)
Macrocycles used as models to probe the interaction of a fatty acid derivative with its natural receptor (1993) (3)
Experimental Models of Symbiotic Host-Microbial Relationships: Understanding the Underpinnings of Beneficence and the Origins of Pathogenesis (2006) (3)
PARA-SITE: a computer algorithm for rapidly analyzing the physical- chemical properties of amino acid sequences at sites of co- and post- translational protein processing (1988) (3)
Immunoproliferative small intestinal disease associated with Campylobacter jejuni. (2004) (3)
A transgenic mouse model for studying differentiation programs and lineage relationships in the developing mouse pulmonary epithelium. (1992) (2)
Creating the future: rather than simply reacting to it. (1999) (2)
Transposable elements drive widespread expression of oncogenes in human cancers (2019) (2)
Effects of Forced Expression of an NH (1998) (2)
Human Milk Oligosaccharide Compositions Illustrate Global Variations in Early Nutrition. (2022) (2)
Bacterial Symbiont Glycan Foraging in Vivo by an Intestine-Adapted (2008) (2)
A Comparison of The Gut Microbiota of Healthy Adult Twins Living in Korea and The United States (2011) (2)
Duodenal Microbiota in Stunted Undernourished Children with Enteropathy. Reply. (2021) (1)
Expression of Human PreproapoAI and Pre ( Apro ) apoAI in a Murine Pituitary Cell Line ( AtT-20 ) (2001) (1)
47 Chronic Colitis in Bacteroides Thetaiotaomicron-Monoassociated HLA-B27 Transgenic Rats is Associated With Altered Transcription of Receptor and Metabolic Genes in Luminal Bacteria (2012) (1)
American Gastroenterological Association. Presentation of the Julius M. Friedenwald medal to David H. Alpers, M.D. (1997) (1)
Synthesis of novel tritium labeled oxamyristic acids (1991) (1)
Immunoglobulin A Targets Microbes in the Fecal Microbiota of Malawian Twins Discordant for Kwashiorkor (2013) (1)
Molecular Characterization of Mouse Gastric Zymogenic Cells* S (2003) (1)
Dining in with Trillions of Fascinating Friends: Exploring Our Human Gut Microbiome in Health and Disease (2011) (1)
429 - Combined In Vivo/In Vitro Identification of Human Resident Bacterial Strains that Selectively Induce IL-10 and Promote Mucosal Homeostasis (2018) (1)
Structure/Function Studies of Human Striatin (2006) (1)
Relative resistance to Phytophthora spp. among six rootstocks used for waxflower production (1999) (1)
Analysis of the Developmental , Cellular , and Axial Patterns of lLBP / hGH + 3 Expression Measurement of lLBP and hGH mRNA Levels in Normal and Transgenic Mice (2002) (0)
STRUCTURE OF THE RAT APO-A-IV GENE AND ITS RELATIONSHIP TO THE HUMAN GENES FOR APO-A-I, C-111, AND E* (1986) (0)
Oxygen or sulfur-substituted fettsaeureanaloga for treating retroviral infections. (1990) (0)
A Microbiota-Directed Food Intervention for Undernourished Children. Reply. (2022) (0)
Microbiota functional activity biosensors for characterizing nutrient utilization in vivo (2020) (0)
AUTHORS’ RESPONSES TO REVIEW Nature Genetics submission NG-LE49200 Widespread transposable element-driven oncogene expression in cancers (2018) (0)
Nucleophile‐Dependent Substitution Reactions of 5‐Halovaleric Acid Esters: Synthesis of 6,12‐Dioxamyristic Acid. (1991) (0)
GATGAGC C CCAGTC CCAA TGGGA CAGGGTGAAGGA TTTCGCCA CTGTGTATGTGGA TGCAGTCAAGGACAGCGGCAGAGA CTATGTGTC CCAGTTTGA ATC CTCCA CTTTGGGCA AspG luProG lnSerG lnTrpAspArgVa lLysAspPheA laThrVa lTyrVa lAspA laVa lLysAspSerG lyA rgAspTyrVa lSerG lnPheG luSerSerThrLeuG lyL Amature amino (2003) (0)
Inhibition of parasitic activity (1992) (0)
Nuclear Magnetic Resonance Studies of 6-Fluorotryptophan-substituted Rat Cellular Retinol-binding Protein I 1 Produced in Escherichia coli (2001) (0)
Tissue-Specific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/ennancer binding protein (2007) (0)
Dramatic Type of Reprogramming Is Suggested Mammalian Neural Stem Cells (0)
Barrow-Agee Laboratories (2010) (0)
Conquering disease in waxflower (1999) (0)
Innate immunity to tuberculosis in zebrafish: roles of MMPs (2006) (0)
Metabolism in Mice Gut Microbiota from Twins Discordant for Obesity Modulate (2013) (0)
typhimurium SR-11 with mouse small intestinal promotes interaction of Salmonella Expression of thin aggregative fimbriae (2013) (0)
Defining hierarchical protein interaction networks from spectral analysis of bacterial proteomes (2021) (0)
B. thetaiotaomicron SusD with alpha-cyclodextrin (2008) (0)
0 n co m p u te r-assisted analysis sequences : proline punctuation , consensus of biological sequences , and apolipoprotein repeats (2002) (0)
Substrate specificity of eukaryotic signal peptidase site saturation mutagenesis at position 1 modulates between two sites of signal peptidase cleavage in human pre delta piro apolipoprotein a ii (1987) (0)
Author response: Microbiota functional activity biosensors for characterizing nutrient metabolism in vivo (2021) (0)
CONCEALMENT DESIGN BY ENGINEERING METHODS (1961) (0)
A MYRISTIC ACID ANALOGUE OF ALTERED HYDROPHOBICITY WHICH IS FUNCTIONAL FOR PEPTIDE N-MYRISTOYLATION (2001) (0)
Gut microbiota regulates neuroinflammation and progression of neurodegeneration in a mouse model of tauopathy (2022) (0)
Regions and Fewer MicroRNA Target Sites Proliferating Cells Express mRNAs with Shortened 3 ' Untranslated (2012) (0)
Cloning of a cDNA encoding rat intestinal-fatty acid binding protein ( cDNA cloning / primary and secondary protein structure analyses ) (0)
Analogs oxy- or thio-fatty acids substituted for use in the treatment of retroviral infections. (1990) (0)
Oxygen or sulfur-substituted fatty acid analogues for the treatment of retroviral infections. (1990) (0)
Faculty Opinions recommendation of Sonic hedgehog regulates gastric gland morphogenesis in man and mouse. (2001) (0)
Commentary: The global relevance of 'biological Freudianism' (2005) (0)
The human intestinal microbiota and its relationship to energy balance (2006) (0)
Cellular glucose sensing, energy metabolism, and aging in Saccharomyces cerevisiae (2003) (0)
STOPPED-FLOW CIRCULAR DICHROISM AND 19F NMR AS PROBES FOR THE FOLDING OF RAT INTESTINAL FATTY-ACID BINDING PROTEIN (IFABP) (1992) (0)
Where Next for Microbiome Research? The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters (2015) (0)
Coordinate regulation oftwoestrogen-dependent (1980) (0)
Pharmaceutical composition for inhibiting virus (1990) (0)
Changes in the taxonomic / phylogenetic composition of fecal communities as a function of age and population (2016) (0)
EFFECT OF ESTROGEN ON GENE EXPRESSION: VITELLOGENIN SYNTHESIS MAY BE REGULATED AT THE LEVEL OF BOTH TRANSCRIPTION AND TRANSLATION (1976) (0)
Response from Falk, Guruge and Gordon (1998) (0)
Faith The Long-Term Stability of the Human Gut Microbiota (2013) (0)
Animal model for helicobacter pylori infection (1998) (0)
azido substituted fedtsyreanalogenzymsubstrater (1991) (0)
Thehypothyroid (hyt/hyt) mouse: A modelsystem forstudying the effects ofthyroid hormone ondevelopmental changes (1988) (0)
Adventurism in biomedical science: Washington University-Monsanto program in biotechnology. (1992) (0)
McNulty Microbiome of Gnotobiotic Mice and Monozygotic Twins The Impact of a Consortium of Fermented Milk Strains on the Gut (2011) (0)
Faculty Opinions recommendation of Bacteriophage therapy rescues mice bacteremic from a clinical isolate of vancomycin-resistant Enterococcus faecium. (2002) (0)
n structure/gene family structure and evolution) (2017) (0)
B. thetaiotaomicron SusD with maltotriose (2008) (0)
Science Translational Medicine Podcast: 26 October 2011 (2011) (0)
Nearly Twenty Years after Barry Marshall's Big Gulp (2001) (0)
THE KING FAISAL MEMORIAL ARTICLES IN MEDICINE AND SCIENCE XIIV THE 2015 KING FAISAL INTERNATIONAL PRIZE THE KING FAISAL MEMORIAL ARTICLES IN MEDICINE AND SCIENCE XIIV THE 2015 KING FAISAL INTERNATIONAL PRIZE (2015) (0)
Ablation of parietal cells is associated with ECL-cell hyperplasia in transgenic mice with a genetically engineered ablation of their parietal cell lineage (2001) (0)
MYRISTOYLATED RECOVERIN WITH TWO CALCIUMS BOUND, NMR, 24 STRUCTURES (1997) (0)
THE KING FAISAL MEMORIAL ARTICLES IN MEDICINE AND SCIENCE XIIV THE 2015 KING FAISAL INTERNATIONAL PRIZE THE KING FAISAL MEMORIAL ARTICLES IN MEDICINE AND SCIENCE XIIV THE 2015 KING FAISAL INTERNATIONAL PRIZE (2015) (0)
New enzyme substrates based on fatty acid analogues. (1991) (0)
A process for the N-myristoylation of the protein (1991) (0)
Urinary Tract Infections , their Frequency and Most Common Provocative Thing in the Region of Tetovo in the Period between 2012-2013 Healthcare (2014) (0)
Tissue-specific expression and developmental regulation of the rat apolipoprotein (1999) (0)
Chamelaucium leaves as a bait for isolating Phytophthora from soil (1999) (0)
Protein Modifications | Protein N-Myristoylation (2021) (0)
Evidence that the gut microbiota regulates progression of neurodegeneration in a mouse model of tauopathy, in a sex‐ and ApoE isoform‐dependent manner (2021) (0)
Peptide substrates and inhibitors of N-myristoyl transferase (1988) (0)
Signaling through the keratinocyte growth factor receptor is essential for liver regeneration but not liver development (2002) (0)
2 WASHINGTON UNIVERSITY RECORD Atkinson and Gordon elected fellows of science association (2014) (0)
Title : Widespread transposable element-driven oncogene expression in cancers (2018) (0)

This paper list is powered by the following services:

Other Resources About Jeffrey I. Gordon

en.wikipedia.org

What Schools Are Affiliated With Jeffrey I. Gordon?

Jeffrey I. Gordon is affiliated with the following schools:

Jeffrey I. Gordon's Academic­Influence.com Rankings