Joseph Avruch
#111,083
Most Influential Person Now
Researcher
Joseph Avruch's AcademicInfluence.com Rankings
Joseph Avruchcomputer-science Degrees
Computer Science
#4195
World Rank
#4415
Historical Rank
Machine Learning
#748
World Rank
#758
Historical Rank
Artificial Intelligence
#956
World Rank
#973
Historical Rank
Database
#1426
World Rank
#1499
Historical Rank

Download Badge
Computer Science
Joseph Avruch's Degrees
- PhD Computer Science Stanford University
- Masters Artificial Intelligence Carnegie Mellon University
Similar Degrees You Can Earn
Why Is Joseph Avruch Influential?
(Suggest an Edit or Addition)Joseph Avruch's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. (2001) (3328)
- The stress-activated protein kinase subfamily of c-Jun kinases (1994) (2727)
- Raptor, a Binding Partner of Target of Rapamycin (TOR), Mediates TOR Action (2002) (1758)
- Phosphorylation of c-jun mediated by MAP kinases (1991) (1426)
- Amino Acid Sufficiency and mTOR Regulate p70 S6 Kinase and eIF-4E BP1 through a Common Effector Mechanism* (1998) (1405)
- Raf-1 activates MAP kinase-kinase (1992) (1210)
- Sounding the Alarm: Protein Kinase Cascades Activated by Stress and Inflammation* (1996) (1169)
- Mammalian MAPK signal transduction pathways activated by stress and inflammation: a 10-year update. (2012) (1101)
- Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun (1994) (1016)
- Rheb Binds and Regulates the mTOR Kinase (2005) (948)
- Yap1 Acts Downstream of α-Catenin to Control Epidermal Proliferation (2011) (894)
- Mst1 and Mst2 maintain hepatocyte quiescence and suppress hepatocellular carcinoma development through inactivation of the Yap1 oncogene. (2009) (854)
- Normal and oncogenic p21ras proteins bind to the amino-terminal regulatory domain of c-Raf-1 (1993) (823)
- Protein kinase cascades activated by stress and inflammatory cytokines (1996) (759)
- Preparation and properties of plasma membrane and endoplasmic reticulum fragments from isolated rat fat cells. (1971) (659)
- The Mammalian Target of Rapamycin (mTOR) Partner, Raptor, Binds the mTOR Substrates p70 S6 Kinase and 4E-BP1 through Their TOR Signaling (TOS) Motif* (2003) (652)
- Rapamycin-induced inhibition of the 70-kilodalton S6 protein kinase. (1992) (646)
- Raf meets Ras: completing the framework of a signal transduction pathway. (1994) (595)
- 3-Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates and activates the p70 S6 kinase in vivo and in vitro (1998) (569)
- Regulation of eIF-4E BP1 Phosphorylation by mTOR* (1997) (514)
- 14-3-3 Proteins: Active Cofactors in Cellular Regulation by Serine/Threonine Phosphorylation* (2002) (506)
- Serine phosphorylation and maximal activation of STAT3 during CNTF signaling is mediated by the rapamycin target mTOR (2000) (478)
- A dimeric 14-3-3 protein is an essential cofactor for Raf kinase activity (1998) (467)
- Mst1 and Mst2 protein kinases restrain intestinal stem cell proliferation and colonic tumorigenesis by inhibition of Yes-associated protein (Yap) overabundance (2011) (421)
- Regulation of the p70 S6 Kinase by Phosphorylation in Vivo (1998) (400)
- Ras activation of the Raf kinase: tyrosine kinase recruitment of the MAP kinase cascade. (2001) (385)
- Amino acid regulation of TOR complex 1. (2009) (385)
- Identification of Regulatory Phosphorylation Sites in Mitogen-activated Protein Kinase (MAPK)-activated Protein Kinase-1a/p90 rsk That Are Inducible by MAPK* (1998) (381)
- Identification of a Novel Ras-Regulated Proapoptotic Pathway (2002) (380)
- MOBKL1A/MOBKL1B Phosphorylation by MST1 and MST2 Inhibits Cell Proliferation (2008) (380)
- Rheb Binding to Mammalian Target of Rapamycin (mTOR) Is Regulated by Amino Acid Sufficiency* (2005) (367)
- Regulation of the MST1 kinase by autophosphorylation, by the growth inhibitory proteins, RASSF1 and NORE1, and by Ras. (2004) (343)
- The Proline-rich Akt Substrate of 40 kDa (PRAS40) Is a Physiological Substrate of Mammalian Target of Rapamycin Complex 1* (2007) (335)
- Immunopurified Mammalian Target of Rapamycin Phosphorylates and Activates p70 S6 Kinase α in Vitro * (1999) (330)
- Insulin and amino-acid regulation of mTOR signaling and kinase activity through the Rheb GTPase (2006) (321)
- Amino Acid-Induced Translation of TOP mRNAs Is Fully Dependent on Phosphatidylinositol 3-Kinase-Mediated Signaling, Is Partially Inhibited by Rapamycin, and Is Independent of S6K1 and rpS6 Phosphorylation (2001) (316)
- Insulin signal transduction through protein kinase cascades (1998) (314)
- Dissociation of raptor from mTOR is a mechanism of rapamycin‐induced inhibition of mTOR function (2004) (313)
- TOR Deficiency in C. elegans Causes Developmental Arrest and Intestinal Atrophy by Inhibition of mRNA Translation (2002) (281)
- The stress-activated protein kinases are major c-Jun amino-terminal kinases activated by ischemia and reperfusion. (1994) (277)
- MAP kinase pathways: the first twenty years. (2007) (266)
- Multiple independent inputs are required for activation of the p70 S6 kinase (1995) (241)
- pp54 microtubule-associated protein 2 kinase. A novel serine/threonine protein kinase regulated by phosphorylation and stimulated by poly-L-lysine. (1990) (241)
- An array of insulin-activated, proline-directed serine/threonine protein kinases phosphorylate the p70 S6 kinase. (1992) (238)
- Mitogen-activated protein kinase/extracellular signal-regulated protein kinase activation by oncogenes, serum, and 12-O-tetradecanoylphorbol-13-acetate requires Raf and is necessary for transformation. (1994) (237)
- Oligomerization activates c-Raf-1 through a Ras-dependent mechanism (1996) (230)
- Activation of the SAPK pathway by the human STE20 homologue germinal centre kinase (1995) (226)
- The Mixed Lineage Kinase SPRK Phosphorylates and Activates the Stress-activated Protein Kinase Activator, SEK-1* (1996) (225)
- Stress-activated protein kinases in cardiovascular disease. (1996) (223)
- The putative tumor suppressor RASSF1A homodimerizes and heterodimerizes with the Ras-GTP binding protein Nore1 (2002) (216)
- Regulation of Translational Effectors by Amino Acid and Mammalian Target of Rapamycin Signaling Pathways (1999) (215)
- Human mitogen-activated protein kinase kinase 4 as a candidate tumor suppressor. (1997) (209)
- Phosphatidylinositol 3-kinase signals activation of p70 S6 kinase in situ through site-specific p70 phosphorylation. (1995) (208)
- Intracellular signalling: PDK1 – a kinase at the hub of things (1999) (204)
- Identification of Nore1 as a Potential Ras Effector* (1998) (203)
- Protein kinases of the Hippo pathway: regulation and substrates. (2012) (201)
- YAP Inhibition Restores Hepatocyte Differentiation in Advanced HCC, Leading to Tumor Regression. (2015) (187)
- The p70 S6 kinase integrates nutrient and growth signals to control translational capacity. (2001) (180)
- MST/MLK2, a Member of the Mixed Lineage Kinase Family, Directly Phosphorylates and Activates SEK1, an Activator of c-Jun N-terminal Kinase/Stress-activated Protein Kinase* (1997) (178)
- Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini (1991) (174)
- Critical binding and regulatory interactions between Ras and Raf occur through a small, stable N-terminal domain of Raf and specific Ras effector residues (1994) (168)
- Endothelin, vasopressin, and angiotensin II enhance tyrosine phosphorylation by protein kinase C-dependent and -independent pathways in glomerular mesangial cells. (1991) (165)
- Molecular structure of a major insulin/mitogen-activated 70-kDa S6 protein kinase. (1990) (163)
- Insulin-stimulated tyrosine phosphorylation of the insulin receptor in detergent extracts of human placental membranes. Comparison to epidermal growth factor-stimulated phosphorylation. (1982) (155)
- mTOR phosphorylates IMP2 to promote IGF2 mRNA translation by internal ribosomal entry. (2011) (155)
- Calyculin A-induced Vimentin Phosphorylation Sequesters 14-3-3 and Displaces Other 14-3-3 Partners in Vivo * (2000) (154)
- The Nore1B/Mst1 complex restrains antigen receptor-induced proliferation of naïve T cells (2008) (153)
- The Mst1 and Mst2 kinases control activation of rho family GTPases and thymic egress of mature thymocytes (2012) (152)
- Nercc1, a mammalian NIMA-family kinase, binds the Ran GTPase and regulates mitotic progression. (2002) (149)
- Nek9 is a Plk1‐activated kinase that controls early centrosome separation through Nek6/7 and Eg5 (2011) (144)
- Identification of insulin receptor tyrosine residues autophosphorylated in vitro. (1987) (136)
- Rassf Family of Tumor Suppressor Polypeptides* (2009) (136)
- A Mitotic Cascade of NIMA Family Kinases (2003) (135)
- Glutamatergic Regulation of the p70S6 Kinase in Primary Mouse Neurons* (2005) (134)
- The stress activated protein kinase pathway. (1996) (133)
- Proof-of-Concept, Randomized, Controlled Clinical Trial of Bacillus-Calmette-Guerin for Treatment of Long-Term Type 1 Diabetes (2012) (130)
- Hippo signaling regulates differentiation and maintenance in the exocrine pancreas. (2013) (126)
- The NIMA-family kinase Nek6 phosphorylates the kinesin Eg5 at a novel site necessary for mitotic spindle formation (2008) (126)
- Phosphorylation of endogenous substrates by erythrocyte membrane protein kinases. I. A monovalent cation-stimulated reaction. (1974) (126)
- Kinases Mst1 and Mst2 positively regulate phagocytic induction of reactive oxygen species and bactericidal activity (2015) (123)
- An intact Raf zinc finger is required for optimal binding to processed Ras and for ras-dependent Raf activation in situ (1997) (123)
- RASSF3 and NORE1: identification and cloning of two human homologues of the putative tumor suppressor gene RASSF1 (2002) (121)
- YAP oncogene overexpression supercharges colon cancer proliferation (2012) (120)
- Significance of 14-3-3 self-dimerization for phosphorylation-dependent target binding. (2003) (118)
- IGF2BP2/IMP2-Deficient mice resist obesity through enhanced translation of Ucp1 mRNA and Other mRNAs encoding mitochondrial proteins. (2015) (115)
- pp54 microtubule-associated protein-2 kinase requires both tyrosine and serine/threonine phosphorylation for activity. (1991) (114)
- Stress-activated protein kinases bind directly to the delta domain of c-Jun in resting cells: implications for repression of c-Jun function. (1995) (113)
- The Ets transcription factor GABP is a component of the hippo pathway essential for growth and antioxidant defense. (2013) (113)
- Mst1/2 signalling to Yap: gatekeeper for liver size and tumour development (2010) (109)
- Purification of a hepatic S6 kinase from cycloheximide-treated Rats. (1989) (107)
- The TSC-mTOR Pathway Mediates Translational Activation of TOP mRNAs by Insulin Largely in a Raptor- or Rictor-Independent Manner (2008) (107)
- Identification of the 14.3.3 ζ Domains Important for Self-association and Raf Binding (*) (1995) (105)
- Identification of the insulin receptor tyrosine residues undergoing insulin-stimulated phosphorylation in intact rat hepatoma cells. (1988) (104)
- P2Y purinoceptor subtypes recruit different Mek activators in astrocytes (2000) (101)
- Nore1 inhibits tumor cell growth independent of Ras or the MST1/2 kinases (2004) (99)
- Mitogen regulation of c-Raf-1 protein kinase activity toward mitogen-activated protein kinase-kinase. (1993) (98)
- Recombinant fragment of protein kinase inhibitor blocks cyclic AMP-dependent gene transcription. (1987) (97)
- The Scaffold Protein CNK1 Interacts with the Tumor Suppressor RASSF1A and Augments RASSF1A-induced Cell Death* (2004) (96)
- Phosphorylation of endogenous substrates by erythrocyte membrane protein kinases. II. Cyclic adenosine monophosphate-stimulated reactions. (1974) (94)
- Recent advances in the regulation of the TOR pathway by insulin and nutrients (2005) (92)
- Activating transcription factor-2 DNA-binding activity is stimulated by phosphorylation catalyzed by p42 and p54 microtubule-associated protein kinases. (1992) (91)
- Identification of the NIMA family kinases NEK6/7 as regulators of the p70 ribosomal S6 kinase (2001) (90)
- Death-associated Protein 4 Binds MST1 and Augments MST1-induced Apoptosis* (2002) (89)
- Effects of epinephrine and insulin on phosphopeptide metabolism in adipocytes. (1976) (89)
- Insulin regulation of protein biosynthesis in differentiated 3T3 adipocytes. Regulation of glyceraldehyde-3-phosphate dehydrogenase. (1985) (88)
- Mst 1 and Mst 2 Maintain Hepatocyte Quiescence and Suppress Hepatocellular Carcinoma Development through Inactivation of the Yap 1 Oncogene (2011) (88)
- Tumor Suppressor Ras Association Domain Family 5 (RASSF5/NORE1) Mediates Death Receptor Ligand-induced Apoptosis* (2010) (84)
- Insulin regulation of hepatic glycogen synthase and phosphorylase. (1978) (83)
- Four gel systems for electrophoretic fractionation of membrane proteins using ionic detergents. (1972) (83)
- Enzymatic characteristics of the c-Raf-1 protein kinase. (1994) (83)
- Demonstration of a phosphopeptide intermediate in the Mg ++ -dependent, Na + - and K + -stimulated adenosine triphosphatase reaction of the erythrocyte membrane. (1972) (80)
- Nore1 and RASSF1 regulation of cell proliferation and of the MST1/2 kinases. (2006) (80)
- Activation of mTORC1 in two steps: Rheb-GTP activation of catalytic function and increased binding of substrates to raptor. (2009) (80)
- Purification and characterisation of the insulin-stimulated protein kinase from rabbit skeletal muscle; close similarity to S6 kinase II. (1991) (78)
- Atypical protein kinase Clambda binds and regulates p70 S6 kinase. (1998) (77)
- Ionizing Radiation Stimulates a Grb2-mediated Association of the Stress-activated Protein Kinase with Phosphatidylinositol 3-Kinase (*) (1995) (76)
- mTOR complex 2 phosphorylates IMP1 cotranslationally to promote IGF2 production and the proliferation of mouse embryonic fibroblasts. (2013) (75)
- Purification of a hepatic 123,000-dalton hormone-stimulated 32P-peptide and its identification as ATP-citrate lyase. (1979) (73)
- Active Nercc1 protein kinase concentrates at centrosomes early in mitosis and is necessary for proper spindle assembly. (2005) (73)
- Faculty Opinions recommendation of mTOR kinase structure, mechanism and regulation. (2018) (72)
- Relationship of site-specific beta subunit tyrosine autophosphorylation to insulin activation of the insulin receptor (tyrosine) protein kinase activity. (1988) (72)
- The kinases Mst1 and Mst2 positively regulate phagocyte ROS induction and bactericidal activity (2015) (70)
- TOR action in mammalian cells and in Caenorhabditis elegans. (2004) (70)
- Glucagon regulation of protein phosphorylation. Identification of acetyl coenzyme A carboxylase as a substrate. (1979) (69)
- The lytic effect of polyene antifungal antibiotics on mammalian erythrocytes. (1962) (68)
- A Rictor-Myo1c Complex Participates in Dynamic Cortical Actin Events in 3T3-L1 Adipocytes (2008) (68)
- Characteristics of insulin and epidermal growth factor stimulation of receptor autophosphorylation in detergent extracts of rat liver and transplantable rat hepatomas. (1984) (67)
- IGF2 mRNA binding protein-2 is a tumor promoter that drives cancer proliferation through its client mRNAs IGF2 and HMGA1 (2017) (67)
- Characterization of ubiquilin 1, an mTOR-interacting protein. (2002) (66)
- Regulation of an epitope-tagged recombinant Rsk-1 S6 kinase by phorbol ester and erk/MAP kinase. (1993) (66)
- Pancreatic islet chromatin accessibility and conformation reveals distal enhancer networks of type 2 diabetes risk (2018) (64)
- Intensive conventional and insulin pump therapies in adult type I diabetes. A crossover study. (1982) (62)
- Expression and phosphorylation of insulin receptor substrate 1 during rat liver regeneration. (1993) (60)
- ATP-citrate lyase. Structure of a tryptic peptide containing the phosphorylation site directed by glucagon and the cAMP-dependent protein kinase. (1981) (59)
- Identification of the sites of interaction between c-Raf-1 and Ras-GTP. (1995) (57)
- Insulin-stimulated tyrosine protein kinase. Characterization and relation to the insulin receptor. (1984) (57)
- MST1/MST2 Protein Kinases: Regulation and Physiologic Roles. (2016) (55)
- Amino Acids Activate Mammalian Target of Rapamycin (mTOR) Complex 1 without Changing Rag GTPase Guanyl Nucleotide Charging* (2013) (55)
- Effects of glucagon and insulin on cytoplasmic protein phosphorylation in hepatocytes. (1978) (52)
- Reconstitution of novel signalling cascades responding to cellular stresses. (1996) (51)
- Insulin-activated protein kinases phosphorylate a pseudosubstrate synthetic peptide inhibitor of the p70 S6 kinase. (1991) (51)
- Insulin activates a 70-kDa S6 kinase through serine/threonine-specific phosphorylation of the enzyme polypeptide. (1990) (50)
- Insulin and growth factors stimulate the phosphorylation of a Mr-22000 protein in 3T3-L1 adipocytes. (1983) (48)
- Glucose transport in plasma membrane vesicles from rat adipose tissue. (1972) (47)
- Phosphorylation and dephosphorylation of spectrin. (1978) (47)
- Regulation of the MST 1 kinase by autophosphorylation , by the growth inhibitory proteins , RASSF 1 and NORE 1 , and by Ras (2004) (43)
- The Rheb Switch 2 Segment Is Critical for Signaling to Target of Rapamycin Complex 1* (2007) (43)
- A Mitotic Cascade of NIMA Family Kinases Nercc1/Nek9 ACTIVATES THE Nek6 AND Nek7 KINASES* (2003) (42)
- The Mechanism of Insulin-stimulated 4E-BP Protein Binding to Mammalian Target of Rapamycin (mTOR) Complex 1 and Its Contribution to mTOR Complex 1 Signaling* (2011) (41)
- Identification and subcellular distribution of adipocyte peptides and phosphopeptides. (1976) (40)
- The insulin-directed phosphorylation site on ATP-citrate lyase is identical with the site phosphorylated by the cAMP-dependent protein kinase in vitro. (1982) (40)
- Identification of Raf-1 S471 as a novel phosphorylation site critical for Raf-1 and B-Raf kinase activities and for MEK binding. (2005) (40)
- The putative tumor suppressor RASSF1A homodimerizes and heterodimerizes with the Ras-GTP binding protein Nore1 (2002) (38)
- An S6 kinase activated during liver regeneration is related to the insulin-stimulated S6 kinase in H4 hepatoma cells. (1988) (38)
- Phosphoprotein phosphatase of the human erythrocyte. (1976) (38)
- REGULATION OF NUCLEAR TRANSCRIPTION FACTORS BY STRESS SIGNALS (1995) (37)
- Kinetic properties of the insulin receptor tyrosine protein kinase: activation through an insulin-stimulated tyrosine-specific, intramolecular autophosphorylation. (1986) (37)
- Hormonal regulation of protein dephosphorylation. Identification and hormonal regulation of protein phosphatase inhibitor-1 in rat adipose tissue. (1983) (36)
- An insulin-stimulated (ribosomal S6) protein kinase from soluble extracts of H4 hepatoma cells. (1986) (35)
- Insulin regulation of glycogen synthase in the isolated rat hepatocyte. (1976) (35)
- Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells. (1989) (34)
- Mammalian STE20-like kinase 2, not kinase 1, mediates photoreceptor cell death during retinal detachment (2014) (34)
- A MicroRNA Linking Human Positive Selection and Metabolic Disorders (2020) (34)
- Extracellular ATP stimulates an inhibitory pathway towards growth factor‐induced cRaf‐1 and MEKK activation in astrocyte cultures (2001) (34)
- The TSC-mTOR Pathway Mediates Translational Activation of TOP mRNAs by Insulin Largely in a Raptor- or Rictor-Independent Manner (2009) (34)
- Insulin promoted decrease in the phosphorylation of protein synthesis initiation factor eIF-2. (1984) (30)
- The stress-activated protein kinases. A novel ERK subfamily responsive to cellular stress and inflammatory cytokines. (1995) (30)
- Regulation of plasma membrane protein phosphorylation in two mammalian cell types (1976) (29)
- Hippo pathway in intestinal homeostasis and tumorigenesis (2012) (27)
- Liver-specific deletion of IGF2 mRNA binding protein-2/IMP2 reduces hepatic fatty acid oxidation and increases hepatic triglyceride accumulation (2019) (27)
- Preliminary characterization of a heat-stable protein from rat adipose tissue whose phosphorylation is stimulated by insulin. (1982) (26)
- The Stress‐activated Protein Kinases (1995) (26)
- Role of insulin-stimulated protein phosphorylation in insulin action. (1982) (26)
- Glucose transport by trypsin-treated red blood cell ghosts. (1973) (24)
- Effect of low levels of trypsin on erythrocyte membranes. (1973) (24)
- A rapid and convenient method for preparing salt-free [γ-32P]ATP (1981) (23)
- A rapid and convenient method for preparing salt-free [γ-32P]ATP (1981) (23)
- Insulin-stimulated phosphorylation of ATP-citrate lyase in isolated hepatocytes. Stoichiometry and relation to the phosphoenzyme intermediate. (1982) (20)
- Nek 9 is a Plk 1-activated kinase that controls early centrosome separation through Nek 6 / 7 and Eg 5 (2011) (20)
- G protein‐coupled receptors engage the mammalian Hippo pathway through F‐actin (2013) (20)
- Cryo-EM insight into the structure of MTOR complex 1 and its interactions with Rheb and substrates (2019) (18)
- Perturbation of proton and detergent binding sites in bovine serum albumin by acetimidation. (1969) (17)
- Faculty Opinions recommendation of 4.4 Å Resolution Cryo-EM structure of human mTOR Complex 1. (2018) (15)
- Insulin-stimulated plasma membranes from rat adipocytes: their physiological and physicochemical properties. (1972) (14)
- Protein Phosphorylations As a Mode of Insulin Action (1985) (13)
- The role of the cyclic AMP-dependent protein kinase in the glucagon-stimulated phosphorylation of ATP-citrate lyase. (1981) (13)
- RNA m6A reader IMP2/IGF2BP2 promotes pancreatic β-cell proliferation and insulin secretion by enhancing PDX1 expression (2021) (13)
- Water intoxication caused by smoking in a compulsive water drinker (1976) (12)
- Developmental changes in expression of myotonic dystrophy protein kinase in the rat central nervous system (1998) (12)
- IMP2 Increases Mouse Skeletal Muscle Mass and Voluntary Activity by Enhancing Autocrine Insulin-Like Growth Factor 2 Production and Optimizing Muscle Metabolism (2019) (12)
- Spectroscopic evidence for β structure in rat adipocyte plasma membrane protein (1971) (11)
- Nore1B regulates TCR signaling via Ras and Carma1. (2006) (11)
- A Genome-Wide siRNA Screen in Mammalian Cells for Regulators of S6 Phosphorylation (2015) (10)
- Hormonal regulation of protein phosphorylation in isolated rat heart cells. (1984) (10)
- Evolution of TOR and Translation Control (2016) (10)
- Insulin Regulation of Protein Phosphorylation (1990) (9)
- Activation of mTORC 1 in two steps : Rheb-GTP activation of catalytic function and increased binding of substrates to raptor 1 (2009) (9)
- Role of mitogen‐activated protein kinase cascades in P2Y receptor‐mediated trophic activation of astroglial cells (2001) (9)
- The Mst1 Kinase Is Required for Follicular B Cell Homing and B-1 B Cell Development (2018) (8)
- Growth factor-activated kinases phosphorylate IRE-ABP. (1992) (8)
- Studies on the mechanism of insulin-stimulated protein phosphorylation in adipocytes. (1980) (7)
- Diabetes: A signal for β-cell failure (1998) (6)
- Ras-Raf complexes in vitro. (1995) (6)
- Control by insulin and insulin-related growth factor 1 of protein synthesis in a cell-free translational system from chick-embryo fibroblasts. (1987) (6)
- The role of tyrosine-and serine-threonine-protein phosphorylation in insulin action. (1990) (6)
- Insulin, epidermal growth factor and fibroblast growth factor elicit distinct patterns of protein tyrosine phosphorylation in BC3H1 cells. (1990) (5)
- Characterization of two Mst1‐deficient mouse models (2008) (5)
- Atypical protein kinase C k binds and regulates p70 S6 kinase (1998) (5)
- A genome-wide RNAi screen for polypeptides that alter rpS6 phosphorylation. (2012) (4)
- amino termini. kinase polypeptides differing only at their Cloning and expression of two human p70 S6 (2013) (3)
- CHAPTER 9 - Probing cAMP-regulated gene expression with a recombinant protein kinase inhibitor (1991) (2)
- Faculty Opinions recommendation of Structure of the human mTOR complex I and its implications for rapamycin inhibition. (2018) (2)
- MAP Kinase Pathways (2016) (1)
- Insulin and Growth Factor Signaling Pathways (2010) (1)
- Human T2D Associated Gene IMP2/IGF2BP2 Promotes the Commitment of Mesenchymal Stem Cells into Adipogenic Lineage. (2022) (1)
- The Molecular Basis of Insulin Action and Insulin Resistance (2001) (1)
- Faculty Opinions recommendation of Architecture of human mTOR complex 1. (2018) (1)
- mTOR phosphorylates IMP 2 to promote IGF 2 mRNA translation by internal ribosomal entry Citation (2011) (1)
- Rassf Family of Tumor (2009) (1)
- A Rictor-Myo 1 c Complex Participates in Dynamic Cortical Actin Events in 3 T 3L 1 Adipocytes ‡ (2017) (1)
- Hepatocytes AND RELATION TO THE PHOSPHOENZYME INTERMEDIATE (2011) (0)
- Pancreatic islet chromatin accessibility and conformation reveals distal enhancer networks of type 2 diabetes risk (2019) (0)
- IMP2 increases mouse skeletal muscle mass and voluntary activity by enhancing autocrine IGF2 production and optimizing muscle metabolism. (2019) (0)
- 4-23-2008 A Rictor-Myo 1 c complex participates in dynamic cortical actin events in 3 T 3-L 1 adipocytes (2017) (0)
- Cloning andExpression ofTwoHumanp70S6KinasePolypeptides Differing OnlyatTheirAminoTermini (1991) (0)
- Purification and characterisation of the insulin-stimulated protein kinase from rabbit skeletal muscle; close similarity to S6 kinase I1 (2004) (0)
- CHAPTER 87 – Regulation of Cell Growth and Proliferation in Metazoans by mTOR and the p70 S6 Kinase (2003) (0)
- RASSF1A may serve as novel tumor suppressor gene in gastrointestinal malignancies regulating apoptosis (2003) (0)
- Faculty Opinions recommendation of Architecture of the human mTORC2 core complex. (2018) (0)
- Faculty Opinions recommendation of mTOR in aging, metabolism, and cancer. (2018) (0)
- Faculty Opinions recommendation of Cryo-EM structure of human mTOR complex 2. (2018) (0)
- Faculty Opinions recommendation of Cryo-EM structure of Saccharomyces cerevisiae target of rapamycin complex 2. (2018) (0)
- Faculty Opinions recommendation of mTORC2 promotes type I insulin-like growth factor receptor and insulin receptor activation through the tyrosine kinase activity of mTOR. (2018) (0)
- Faculty Opinions recommendation of mTOR Signaling in Growth, Metabolism, and Disease. (2018) (0)
- pTOM, a vector for expressing two proteins in mammalian cells. (2009) (0)
- Spectroscopic evidence for beta structure in rat adipocyte plasma membrane protein. (1971) (0)
- BASIC AND TRANSLATIONAL-PANCREAS (2013) (0)
- Faculty Opinions recommendation of Rheb localized on the Golgi membrane activates lysosome-localized mTORC1 at the Golgi-lysosome contact site. (2018) (0)
- Erratum: Fixed hotspots gone with the wind (1998) (0)
- Faculty Opinions recommendation of Tor forms a dimer through an N-terminal helical solenoid with a complex topology. (2018) (0)
- Faculty Opinions recommendation of Architecture and activation of phosphatidylinositol 3-kinase related kinases. (2018) (0)
- MST1/2 and Other Upstream Signaling that Affect Hippo Pathway Function (2013) (0)
- Abstract 292: Identification of new components of the mTOR signaling pathway in pancreatic cancer cells by a genome-wide RNAi screen (2010) (0)
- Erratum to: Evolution of TOR and Translation Control (2016) (0)
- Faculty Opinions recommendation of Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. (2018) (0)
- Faculty Opinions recommendation of mTORC1 senses lysosomal amino acids through an inside-out mechanism that requires the vacuolar H(+)-ATPase. (2012) (0)
- Insulin and the phosphorylation of intracellular proteins. (1979) (0)
- A rapid and convenient method for preparing salt-free [gamma-32P]ATP. (1981) (0)
- Reviewers of Manuscripts and Books (1975) (0)
- GTGTGAGGATCCTGCAGATAAAATGAAAAAITGGCAGTCTCAAAGAGTCAGTGTCATTACCTGGAAT 1725 GCTTTCGAGGAGGAAAA AAT AAA ACAAI CAAIGGI CAAAAAAAACCC 1794 ACAAAAAACTCAAACAAAATAGTATTGTGGAACCCACAGACACATCAACTGACTGGTTCCTACCCTAGC 1863 AACATCTCAGCGTTCGTAAGGATTCTCATGCTGATGGCCGTAAACTGACAGTATTAAGGGTAGGATGTT 1932 GCTTCTGAATCACTGGTAA (0)
- SAPKs A MAP kinase subfamily that transduces stress and TNF-alpha signals to c-Jun (1994) (0)
- Interactions of inhibierungsproteinen (1994) (0)
- Control of Blood Sugar in Insulin-Requiring Diabetes (1981) (0)
- Insulin activates a 70-kDa S 6 kinase through serine / threonine-specific phosphorylation of the enzyme polypeptide ( growth factor / signal transduction / protein kinase cascade ) (0)
- The Rap-1 Antioncogene in Breast Cancer. (1995) (0)
- Mst 1 and Mst 2 maintain hepatocyte quiescence and suppress the development of hepatocellular carcinoma through inactivation of the Yap 1 oncogene (2011) (0)
- Faculty Opinions recommendation of Structural basis for the unique biological function of small GTPase RHEB. (2018) (0)
- Faculty Opinions recommendation of The Dawn of the Age of Amino Acid Sensors for the mTORC1 Pathway. (2018) (0)
- Faculty Opinions recommendation of PIKKs--the solenoid nest where partners and kinases meet. (2018) (0)
- Hippo pathway in intestinal homeostasis and tumorigenesis (2012) (0)
- Regulation of TOR Complex 1 by Amino Acids Through Small GTPases (2010) (0)
- Erratum: Galileo at Jupiter — meetings with remarkable moons (1998) (0)
- Faculty Opinions recommendation of TORC1 organized in inhibited domains (TOROIDs) regulate TORC1 activity. (2018) (0)
- mTOR complex 2 phosphorylates IGF2 mRNA binding protein1 cotranslationally to promote IGF2 production and the proliferation of mouse embryonic fibroblasts (2013) (0)
- Mst1 and Mst2 control liver size and suppress the development of hepatocellular carcinoma (2009) (0)
- Faculty Opinions recommendation of HEAT repeats - versatile arrays of amphiphilic helices working in crowded environments? (2018) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Joseph Avruch?
Joseph Avruch is affiliated with the following schools: