Kang-sen Mai
#122,387
Most Influential Person Now
Kang-sen Mai's AcademicInfluence.com Rankings
Kang-sen Maibiology Degrees
Biology
#7483
World Rank
#10415
Historical Rank
Agriculture
#24
World Rank
#40
Historical Rank
Botany
#202
World Rank
#831
Historical Rank
Download Badge
Biology
Kang-sen Mai's Degrees
- PhD Animal Science University of California, Davis
- Masters Animal Science University of California, Davis
- Bachelors Animal Science University of California, Davis
Why Is Kang-sen Mai Influential?
(Suggest an Edit or Addition)Kang-sen Mai's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- New developments in fish amino acid nutrition: towards functional and environmentally oriented aquafeeds (2009) (697)
- Effect of dietary lipid level on growth performance, lipid deposition, hepatic lipogenesis in juvenile cobia (Rachycentron canadum) (2005) (294)
- Apparent digestibility of selected feed ingredients for juvenile cobia Rachycentron canadum (2004) (283)
- Dietary probiotic Bacillus OJ and isomaltooligosaccharides influence the intestine microbial populations, immune responses and resistance to white spot syndrome virus in shrimp (Litopenaeus vannamei) (2009) (274)
- Effects of dietary supplementation of Bacillus subtilis and fructooligosaccharide on growth performance, survival, non-specific immune response and disease resistance of juvenile large yellow croaker, Larimichthys crocea (2011) (259)
- Effects of replacing fish meal with soy protein concentrate on feed intake and growth of juvenile Japanese flounder, Paralichthys olivaceus (2006) (244)
- Effects of dietary beta-1, 3 glucan on innate immune response of large yellow croaker, Pseudosciaena crocea. (2007) (242)
- Interaction of dietary Bacillus subtilis and fructooligosaccharide on the growth performance, non-specific immunity of sea cucumber, Apostichopus japonicus. (2010) (187)
- Effects of dietary vitamin C on survival, growth, and immunity of large yellow croaker, Pseudosciaena crocea (2006) (185)
- Effects of dietary n-3 highly unsaturated fatty acids on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans). (2012) (185)
- Comparative studies on the nutrition of two species of abalone, Haliotis tuberculata L. and Haliotis discus hannai Ino. III. response of abalone to various levels of dietary lipid (1995) (183)
- Comparative studies on the nutrition of two species of abalone, Haliotis tuberculata L. and Haliotis discus hannai Ino. IV. Optimum dietary protein level for growth (1995) (175)
- Effects of dietary protein to energy ratios on growth and body composition of juvenile Japanese seabass, Lateolabrax japonicus (2004) (169)
- Effects of dietary vitamin C on growth and immune response of Japanese seabass, Lateolabrax japonicus (2004) (169)
- Dietary methionine requirement of large yellow croaker, Pseudosciaena crocea R (2006) (168)
- Substituting fish meal with soybean meal in diets for Japanese seabass (Lateolabrax japonicus): Effects on growth, digestive enzymes activity, gut histology, and expression of gut inflammatory and transporter genes (2018) (166)
- Effects of potential probiotic Bacillus subtilis T13 on growth, immunity and disease resistance against Vibrio splendidus infection in juvenile sea cucumber Apostichopus japonicus. (2012) (161)
- Partial replacement of fishmeal by soybean meal in diets for juvenile cobia (Rachycentron canadum) (2005) (153)
- Growth performance, lipid deposition and hepatic lipid metabolism related gene expression in juvenile turbot (Scophthalmus maximus L.) fed diets with various fish oil substitution levels by soybean oil (2014) (150)
- Comparative studies on the nutrition of two species of abalone, Haliotis tuberculata Linnaeus and Haliotis discus hannai Ino I. Effects of algal diets on growth and biochemical composition (1993) (148)
- Dietary lysine requirement of juvenile Japanese seabass, Lateolabrax japonicus (2006) (144)
- Dietary l-methionine requirement of juvenile grouper Epinephelus coioides at a constant dietary cystine level (2005) (141)
- Effects of dietary canola meal on growth performance, digestion and metabolism of Japanese seabass, Lateolabrax japonicus (2010) (139)
- Dietary Lipid Levels Influence Lipid Deposition in the Liver of Large Yellow Croaker (Larimichthys crocea) by Regulating Lipoprotein Receptors, Fatty Acid Uptake and Triacylglycerol Synthesis and Catabolism at the Transcriptional Level (2015) (138)
- Dietary administration of Bacillus (B. licheniformis and B. subtilis) and isomaltooligosaccharide influences the intestinal microflora, immunological parameters and resistance against Vibrio alginolyticus in shrimp, Penaeus japonicus (Decapoda: Penaeidae) (2011) (136)
- Effects of exogenous enzyme supplementation in diets on growth and feed utilization in tilapia, Oreochromis niloticus x O. aureus (2007) (135)
- Optimal dietary protein requirement of grouper Epinephelus coioides juveniles fed isoenergetic diets in floating net cages (2004) (134)
- Activities of selected digestive enzymes during larval development of large yellow croaker (Pseudosciaena crocea) (2005) (132)
- Effects of exogenous enzymes (phytase, non-starch polysaccharide enzyme) in diets on growth, feed utilization, nitrogen and phosphorus excretion of Japanese seabass, Lateolabrax japonicus. (2007) (131)
- Replacement of fish meal by meat and bone meal in diets for large yellow croaker, Pseudosciaena crocea (2006) (127)
- Effects of nucleotide supplementation on growth, immune responses and intestinal morphology in juvenile turbot fed diets with graded levels of soybean meal (Scophthalmus maximus L.) (2013) (125)
- Comparative studies on the nutrition of two species of abalone, Haliotis tuberculata L. and Haliotis discus hannai Ino. V. The role of polyunsaturated fatty acids of macroalgae in abalone nutrition (1996) (121)
- Effects of dietary arachidonic acid on growth performance, survival, immune response and tissue fatty acid composition of juvenile Japanese seabass, Lateolabrax japonicus (2010) (117)
- Effect of dietary lipid level on growth performance, feed utilization and body composition of grouper Epinephelus coioides juveniles fed isonitrogenous diets in floating netcages (2005) (114)
- Effect of dietary carbohydrate‐to‐lipid ratios on growth performance, body composition, nutrient utilization and hepatic enzymes activities of herbivorous grass carp (Ctenopharyngodon idella) (2009) (113)
- Comparative studies on the nutrition of two species of abalone, Haliotis tuberculata L. and Haliotis discus hannai Ino. II : Amino acid composition of abalone and six species of macroalgae with an assessment of their nutritional value (1994) (112)
- Comparison effect of dietary astaxanthin and Haematococcus pluvialis on growth performance, antioxidant status and immune response of large yellow croaker Pseudosciaena crocea (2014) (108)
- Effect of dietary calcium and phosphorus on growth, feed efficiency, mineral content and body composition of juvenile grouper, Epinephelus coioides (2006) (108)
- Effect of dietary carbohydrate level on growth performance, body composition, apparent digestibility coefficient and digestive enzyme activities of juvenile cobia, Rachycentron canadum L (2011) (104)
- Dietary phosphorus requirement of juvenile Japanese seabass, Lateolabrax japonicus (2006) (102)
- Effects of dietary soybean saponins on feed intake, growth performance, digestibility and intestinal structure in juvenile Japanese flounder (Paralichthys olivaceus) (2011) (101)
- Zinc methionine and zinc sulfate as sources of dietary zinc for juvenile abalone, Haliotis discus hannai Ino (2001) (101)
- Dietary phosphorus requirement of large yellow croaker, Pseudosciaena crocea R☆ (2006) (99)
- Growth and body composition of juvenile white shrimp, Litopenaeus vannamei, fed different ratios of dietary protein to energy (2008) (99)
- Effects of dietary cholesterol on growth performance, feed intake and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed high plant protein diets (2011) (95)
- Comparative studies on the nutrition of two species of abalone, Haliotis tuberculata L. and Haliotis discus hannai Ino. VII. Effects of dietary vitamin C on survival, growth and tissue concentration of ascorbic acid (1998) (95)
- Synergistic effects of dietary cholesterol and taurine on growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed high plant protein diets (2012) (95)
- Sodium butyrate supplementation in high‐soybean meal diets for turbot (Scophthalmus maximus L.): Effects on inflammatory status, mucosal barriers and microbiota in the intestine (2019) (93)
- Comparative study between probiotic bacterium Arthrobacter XE-7 and chloramphenicol on protection of Penaeus chinensis post-larvae from pathogenic vibrios (2006) (92)
- Effects of dietary taurine supplementation to a casein-based diet on growth performance and taurine distribution in two sizes of juvenile turbot (Scophthalmus maximus L.) (2012) (92)
- Effects of soybean meal fermentation by Lactobacillus plantarum P8 on growth, immune responses, and intestinal morphology in juvenile turbot (Scophthalmus maximus L.) (2016) (92)
- A revisit to fishmeal usage and associated consequences in Chinese aquaculture (2018) (91)
- Effects of dietary docosahexaenoic to eicosapentaenoic acid ratio (DHA/EPA) on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans) (2012) (90)
- Growth, immune response and resistance to Aeromonas hydrophila of juvenile yellow catfish, Pelteobagrus fulvidraco, fed diets with different arginine levels (2015) (90)
- A histological study on the development of the digestive system of Pseudosciaena crocea larvae and juveniles (2005) (89)
- Quantitative l-lysine requirement of juvenile grouper Epinephelus coioides (2006) (89)
- Effects of temperature on non-specific immune parameters in two scallop species: Argopecten irradians (Lamarck 1819) and Chlamys farreri (Jones & Preston 1904) (2004) (86)
- The optimal feeding frequency of large yellow croaker (Pseudosciaena crocea, Richardson) larvae (2011) (86)
- Effect of dietary astaxanthin on growth, survival, and stress tolerance of postlarval shrimp, Litopenaeus vannamei. (2009) (85)
- Postprandial nutrient-sensing and metabolic responses after partial dietary fishmeal replacement by soyabean meal in turbot (Scophthalmus maximus L.) (2015) (83)
- Effects of dietary β-glucan, mannan oligosaccharide and their combinations on growth performance, immunity and resistance against Vibrio splendidus of sea cucumber, Apostichopus japonicus. (2011) (83)
- Effects of dietary pyridoxine on immune responses in abalone, Haliotis discus hannai Ino. (2005) (82)
- Regulation of Tissue LC-PUFA Contents, Δ6 Fatty Acyl Desaturase (FADS2) Gene Expression and the Methylation of the Putative FADS2 Gene Promoter by Different Dietary Fatty Acid Profiles in Japanese Seabass (Lateolabrax japonicus) (2014) (79)
- Effects of different levels of fish protein hydrolysate in the diet on the nonspecific immunity of Japanese sea bass, Lateolabrax japonicus (Cuvieret Valenciennes, 1828) (2006) (79)
- Dietary selenium requirement for juvenile cobia, Rachycentron canadum L. (2010) (78)
- Effects of dietary astaxanthin and xanthophylls on the growth and skin pigmentation of large yellow croaker Larimichthys croceus (2014) (78)
- Effects of replacing soybean meal with rubber seed meal on growth, antioxidant capacity, non-specific immune response, and resistance to Aeromonas hydrophila in tilapia (Oreochromis niloticus × O. aureus). (2015) (77)
- Regulation of FADS2 transcription by SREBP-1 and PPAR-α influences LC-PUFA biosynthesis in fish (2017) (76)
- Effects of dietary rapeseed meal on growth performance, digestion and protein metabolism in relation to gene expression of juvenile cobia (Rachycentron canadum) (2012) (75)
- Effects of discontinuous administration of β-glucan and glycyrrhizin on the growth and immunity of white shrimp Litopenaeus vannamei (2010) (73)
- Studies on the nutrition of the large yellow croaker, Pseudosciaena crocea R. I: growth response to graded levels of dietary protein and lipid (2001) (72)
- Effects of conjugated linoleic acid on growth, non-specific immunity, antioxidant capacity, lipid deposition and related gene expression in juvenile large yellow croaker (Larmichthys crocea) fed soyabean oil-based diets. (2013) (72)
- Optimal dietary lipid level for large yellow croaker (Pseudosciaena crocea) larvae (2008) (71)
- Functional characterization and differential nutritional regulation of putative Elovl5 and Elovl4 elongases in large yellow croaker (Larimichthys crocea) (2017) (69)
- Effects of dietary zinc on gene expression of antioxidant enzymes and heat shock proteins in hepatopancreas of abalone Haliotis discus hannai. (2011) (68)
- Immune response of sea cucumber Apostichopus japonicus coelomocytes to several immunostimulants in vitro (2010) (67)
- High level of dietary soybean oil depresses the growth and anti‐oxidative capacity and induces inflammatory response in large yellow croaker Larimichthys crocea (2018) (66)
- Effects of dietary glutamine on survival, growth performance, activities of digestive enzyme, antioxidant status and hypoxia stress resistance of half-smooth tongue sole (Cynoglossus semilaevis Günther) post larvae (2015) (65)
- Replacement of fish meal by meat and bone meal in practical diets for the white shrimp Litopenaeus vannamai (Boone) (2005) (65)
- A comparative study: In vitro effects of EPA and DHA on immune functions of head-kidney macrophages isolated from large yellow croaker (Larmichthys crocea). (2013) (64)
- Effects of dietary glycinin on the growth performance, digestion, intestinal morphology and bacterial community of juvenile turbot, Scophthalmus maximus L. (2017) (64)
- Effect of dietary bile acid (BA) on the growth performance, body composition, antioxidant responses and expression of lipid metabolism-related genes of juvenile large yellow croaker (Larimichthys crocea) fed high-lipid diets (2020) (62)
- Profiling of differentially expressed genes in hepatopancreas of white shrimp (Litopenaeus vannamei) exposed to long-term low salinity stress (2012) (62)
- Effects of dietary size-fractionated fish hydrolysates on growth, activities of digestive enzymes and aminotransferases and expression of some protein metabolism related genes in large yellow croaker (Larimichthys crocea) larvae (2015) (61)
- Fishmeal replacement by mixed plant proteins and maggot meal on growth performance, target of rapamycin signalling and metabolism in juvenile turbot (Scophthalmus maximus L.) (2016) (61)
- Protein‐sparing capability of dietary lipid in herbivorous and omnivorous freshwater finfish: a comparative case study on grass carp (Ctenopharyngodon idella) and tilapia (Oreochromis niloticus × O. aureus) (2011) (60)
- Interactive effects of dietary cholesterol and protein sources on growth performance and cholesterol metabolism of Japanese flounder (Paralichthys olivaceus) (2009) (59)
- Vegetable oil induced inflammatory response by altering TLR-NF-κB signalling, macrophages infiltration and polarization in adipose tissue of large yellow croaker (Larimichthys crocea). (2016) (59)
- Effects of dietary phospholipids on survival, growth, digestive enzymes and stress resistance of large yellow croaker, Larmichthys crocea larvae (2013) (59)
- Effects of dietary β-glucan on the growth, immune responses and resistance of sea cucumber, Apostichopus japonicus against Vibrio splendidus infection (2011) (59)
- Comparison of high‐protein soybean meal and commercial soybean meal partly replacing fish meal on the activities of digestive enzymes and aminotransferases in juvenile Japanese seabass, Lateolabrax japonicus (Cuvier, 1828) (2014) (59)
- Dietary methionine level influences growth and lipid metabolism via GCN2 pathway in cobia (Rachycentron canadum) (2016) (58)
- Effects of dissolved oxygen on survival and immune responses of scallop (Chlamys farreri Jones et Preston). (2007) (57)
- Effects of fish meal replacement by soybean meal with supplementation of functional compound additives on intestinal morphology and microbiome of Japanese seabass (Lateolabrax japonicus) (2017) (56)
- Hydroxyproline supplementation on the performances of high plant protein source based diets in turbot (Scophthalmus maximus L.) (2014) (56)
- Dietary stachyose altered the intestinal microbiota profile and improved the intestinal mucosal barrier function of juvenile turbot, Scophthalmus maximus L. (2018) (55)
- Alternative protein sources in diets for Japanese flounder Paralichthys olivaceus (Temminck and Schlegel): II. Effects on nutrient digestibility and digestive enzyme activity (2009) (55)
- Dietary hydroxyproline improves the growth and muscle quality of large yellow croaker Larimichthys crocea (2016) (54)
- Effects of dietary copper on survival, growth and immune response of juvenile abalone, Haliotis discus hannai Ino (2009) (53)
- High percentage of dietary palm oil suppressed growth and antioxidant capacity and induced the inflammation by activation of TLR‐NF‐&kgr;B signaling pathway in large yellow croaker (Larimichthys crocea) (2019) (52)
- Effects of dietary chenodeoxycholic acid on growth performance, body composition and related gene expression in large yellow croaker (Larimichthys crocea) fed diets with high replacement of fish oil with soybean oil (2017) (52)
- Effects of dietary α‐lipoic acid on the growth and antioxidative responses of juvenile abalone Haliotis discus hannai Ino (2010) (51)
- Effects of nucleotides on growth performance, immune response, disease resistance and intestinal morphology in shrimp Litopenaeus vannamei fed with a low fish meal diet (2016) (51)
- Dietary ALA, But not LNA, Increase Growth, Reduce Inflammatory Processes, and Increase Anti-Oxidant Capacity in the Marine Finfish Larimichthys crocea (2015) (51)
- The effect of dietary methionine on growth, antioxidant capacity, innate immune response and disease resistance of juvenile yellow catfish (Pelteobagrus fulvidraco) (2016) (51)
- Effects of dietary phospholipid on lipase activity, antioxidant capacity and lipid metabolism-related gene expression in large yellow croaker larvae (Larimichthys crocea). (2016) (50)
- Effects of dietary administration of probiotic Halomonas sp. B12 on the intestinal microflora, immunological parameters, and midgut histological structure of shrimp, Fenneropenaeus chinensis. (2009) (49)
- Effect of high dietary intakes of vitamin E and n-3 HUFA on immune responses and resistance to Edwardsiella tarda challenge in Japanese flounder (Paralichthys olivaceus, Temminck and Schlegel) (2006) (48)
- Dietary soya allergen β‐conglycinin induces intestinal inflammatory reactions, serum‐specific antibody response and growth reduction in a carnivorous fish species, turbot Scophthalmus maximus L. (2017) (48)
- Effects of dietary corn gluten meal on growth, digestion and protein metabolism in relation to IGF-I gene expression of Japanese seabass, Lateolabrax japonicus (2014) (47)
- Cloning and characterization of SREBP-1 and PPAR-α in Japanese seabass Lateolabrax japonicus, and their gene expressions in response to different dietary fatty acid profiles. (2015) (46)
- Effects of dietary lipid level on growth, fatty acid composition, digestive enzymes and expression of some lipid metabolism related genes of orange‐spotted grouper larvae (Epinephelus coioides H.) (2016) (46)
- Dietary sulfur amino acid modulations of taurine biosynthesis in juvenile turbot (Psetta maxima) (2014) (46)
- Synergistic effects of dietary carbohydrate and taurine on growth performance, digestive enzyme activities and glucose metabolism in juvenile turbot Scophthalmus maximus L. (2019) (45)
- Immune Responses and Resistance against Vibrio parahaemolyticus Induced by Probiotic Bacterium Arthrobacter XE‐7 in Pacific White Shrimp, Litopenaeus vannamei (2008) (45)
- Effects of dietary phospholipid level in cobia (Rachycentron canadum) larvae: growth, survival, plasma lipids and enzymes of lipid metabolism (2008) (45)
- Effects of dietary protein and lipid levels on growth, feed utilization and body composition of juvenile swimming crab, Portunus trituberculatus (2014) (45)
- Effects of dietary citric acid on growth performance, mineral status and intestinal digestive enzyme activities of large yellow croaker Larimichthys crocea (Richardson, 1846) fed high plant protein diets (2016) (44)
- Chronic stress of high dietary carbohydrate level causes inflammation and influences glucose transport through SOCS3 in Japanese flounder Paralichthys olivaceus (2018) (44)
- Effects of postprandial starvation on mRNA expression of endocrine-, amino acid and peptide transporter-, and metabolic enzyme-related genes in zebrafish (Danio rerio) (2015) (44)
- Dietary selenium requirement and its toxicity in juvenile abalone Haliotis discus hannai Ino (2012) (44)
- Effects of β-glucan derivatives on the immunity of white shrimp Litopenaeus vannamei and its resistance against white spot syndrome virus infection (2014) (44)
- Effects of dietary phospholipids on growth performance and expression of key genes involved in phosphatidylcholine metabolism in larval and juvenile large yellow croaker, Larimichthys crocea (2017) (43)
- Effects of dietary lipid content on growth, body composition and pigmentation of large yellow croaker Larimichthys croceus (2014) (43)
- Effects of dietary squid viscera meal on growth and cadmium accumulation in tissues of Japanese seabass, Lateolabrax japonicus (Cuvier 1828) (2006) (43)
- Dietary vegetable oil suppressed non‐specific immunity and liver antioxidant capacity but induced inflammatory response in Japanese sea bass (Lateolabrax japonicus) (2017) (43)
- Effects of replacing fishmeal with different cottonseed meals on growth, feed utilization, haematological indexes, intestinal and liver morphology of juvenile turbot (Scophthalmus maximus L.) (2017) (43)
- Effect of dietary methionine levels on growth performance, amino acid metabolism and intestinal homeostasis in turbot (Scophthalmus maximus L.) (2019) (42)
- Dietary lysine requirement of juvenile swimming crab, Portunus trituberculatus (2015) (42)
- Replacement of fish meal with Bacillus pumillus SE5 and Pseudozyma aphidis ZR1 fermented soybean meal in diets for Japanese seabass (Lateolabrax japonicus). (2019) (42)
- Resveratrol attenuates oxidative stress and inflammatory response in turbot fed with soybean meal based diet. (2019) (41)
- Comparison of flavor components in shrimp Litopenaeus vannamei cultured in sea water and low salinity water (2008) (41)
- Effects of dietary arginine levels on growth performance and body composition of juvenile grouper Epinephelus coioides (2007) (41)
- Effect of dietary fatty acid composition on growth, fatty acids composition and hepatic lipid metabolism in juvenile turbot (Scophthalmus maximus L.) fed diets with required n3 LC-PUFAs (2017) (41)
- Effect of temperature and salinity on virulence of Edwardsiella tarda to Japanese flounder, Paralichthys olivaceus (Temminck et Schlegel) (2004) (40)
- Effects of dietary chitosan on growth, survival and stress tolerance of postlarval shrimp, Litopenaeus vannamei (2011) (40)
- Characterization of Cyclooxygenase-2 and its induction pathways in response to high lipid diet-induced inflammation in Larmichthys crocea (2016) (40)
- Effects of dietary amino acid patterns on growth and protein metabolism of large yellow croaker (Larimichthys crocea) larvae (2013) (40)
- Abalone, Haliotis discus hannai Ino, can synthesize myo-inositol de novo to meet physiological needs. (2001) (40)
- Replacement of dietary fishmeal by Antarctic krill meal on growth performance, intestinal morphology, body composition and organoleptic quality of large yellow croaker Larimichthys crocea (2019) (40)
- The protective role of glutamine on enteropathy induced by high dose of soybean meal in turbot, Scophthalmus maximus L. (2018) (39)
- Effects of dietary Astragalus polysaccharides (APS) on survival, growth performance, activities of digestive enzyme, antioxidant responses and intestinal development of large yellow croaker (Larimichthys crocea) larvae (2020) (39)
- Comparative study on the effects of L-methionine or 2-hydroxy-4-(methylthio) butanoic acid as dietary methionine source on growth performance and anti-oxidative responses of turbot (Psetta maxima) (2013) (39)
- ω-6 Polyunsaturated fatty acids (linoleic acid) activate both autophagy and antioxidation in a synergistic feedback loop via TOR-dependent and TOR-independent signaling pathways (2020) (39)
- Response of juvenile Japanese seabass (Lateolabrax japonicus) to different dietary fatty acid profiles: Growth performance, tissue lipid accumulation, liver histology and flesh texture (2016) (39)
- Apparent Digestibility Coefficients of Selected Feed Ingredients for Yellowfin Seabream, Sparus latus (2006) (39)
- Dietary arginine requirement of juvenile cobia ( Rachycentron canadum) (2014) (38)
- Dietary lysine requirement of large yellow croaker (Pseudosciaena crocea, Richardson 1846) larvae (2012) (38)
- Effects of the partial substitution of dietary fish meal by two types of soybean meals on the growth performance of juvenile Japanese seabass, Lateolabrax japonicus (Cuvier 1828) (2012) (37)
- Comparative Study on the Cellular and Systemic Nutrient Sensing and Intermediary Metabolism after Partial Replacement of Fishmeal by Meat and Bone Meal in the Diet of Turbot (Scophthalmus maximus L.) (2016) (37)
- Dietary lipid concentration affects liver mitochondrial DNA copy number, gene expression and DNA methylation in large yellow croaker (Larimichthys crocea). (2016) (37)
- Effects of dietary hydroxyproline on growth performance, body composition, hydroxyproline and collagen concentrations in tissues in relation to prolyl 4-hydroxylase α(I) gene expression of juvenile turbot, Scophthalmus maximus L. fed high plant protein diets (2013) (37)
- Dietary docosahexaenoic acid to eicosapentaenoic acid (DHA/EPA) ratio influenced growth performance, immune response, stress resistance and tissue fatty acid composition of juvenile Japanese seabass, Lateolabrax japonicus (Cuvier) (2016) (37)
- Effects of dietary raw or Enterococcus faecium fermented soybean meal on growth, antioxidant status, intestinal microbiota, morphology, and inflammatory responses in turbot (Scophthalmus maximus L.). (2020) (36)
- Molecular cloning and functional characterization of a putative Elovl4 gene and its expression in response to dietary fatty acid profiles in orange-spotted grouper Epinephelus coioides (2017) (36)
- In vitro effects of arachidonic acid on immune functions of head kidney macrophages isolated from large yellow croaker (Larmichthys crocea) (2012) (36)
- Effects of dietary menhaden oil, soybean oil and soybean lecithin oil at different ratios on growth, body composition and blood chemistry of juvenile Litopenaeus vannamei (2011) (36)
- Nutrient sensing and metabolic changes after methionine deprivation in primary muscle cells of turbot (Scophthalmus maximus L.). (2017) (36)
- Replacement of fish oil with a DHA‐rich Schizochytrium meal on growth performance, activities of digestive enzyme and fatty acid profile of Pacific white shrimp (Litopenaeus vannamei) larvae (2017) (35)
- Citric acid mitigates soybean meal induced inflammatory response and tight junction disruption by altering TLR signal transduction in the intestine of turbot, Scophthalmus maximus L. (2019) (35)
- Replacement of Fish Oil with Linseed Oil or Soybean Oil in Feeds for Japanese Seabass, Lateolabrax japonicus: Effects on Growth Performance, Immune Response, and Tissue Fatty Acid Composition (2015) (35)
- High level of dietary olive oil decreased growth, increased liver lipid deposition and induced inflammation by activating the p38 MAPK and JNK pathways in large yellow croaker (Larimichthys crocea). (2019) (35)
- Differences in growth, total lipid content and fatty acid composition among 60 clones of Cylindrotheca fusiformis (2005) (35)
- Effects of dietary tea polyphenols on growth, biochemical and antioxidant responses, fatty acid composition and expression of lipid metabolism related genes of large yellow croaker (Larimichthys crocea) (2018) (34)
- Effects of dietary lysine on regulating GH-IGF system, intermediate metabolism and immune response in largemouth bass (Micropterus salmoides) (2020) (34)
- Characterization of two Δ5 fatty acyl desaturases in abalone (Haliotis discus hannai Ino) (2013) (34)
- Dietary manganese requirement for juvenile cobia, Rachycentron canadum L (2013) (34)
- Dietary Astragalus polysaccharides ameliorates the growth performance, antioxidant capacity and immune responses in turbot (Scophthalmus maximus L.). (2020) (33)
- Response of juvenile abalone, Haliotis discus hannai, to dietary calcium, phosphorus and calcium/phosphorus ratio (2001) (33)
- Regulation of hepatic lipid deposition by phospholipid in large yellow croaker (2017) (33)
- Effects of dietary arginine and glutamine on growth performance, nonspecific immunity, and disease resistance in relation to arginine catabolism in juvenile turbot (Scophthalmus maximus L.) (2017) (33)
- Thiamin requirement of juvenile abalone, Haliotis discus hannai Ino (2002) (33)
- Dietary copper requirements of juvenile large yellow croaker Larimichthys croceus (2014) (33)
- Effects of dietary crystalline methionine or oligo-methionine on growth performance and feed utilization of white shrimp (Litopenaeus vannamei) fed plant protein-enriched diets (2013) (32)
- Omega‐3 polyunsaturated fatty acids alleviate hepatic steatosis‐induced inflammation through Sirt1‐mediated nuclear translocation of NF‐&kgr;B p65 subunit in hepatocytes of large yellow croaker (Larmichthys crocea) (2017) (32)
- Dietary citric acid supplementation alleviates soybean meal-induced intestinal oxidative damage and micro-ecological imbalance in juvenile turbot, Scophthalmus maximus L (2018) (32)
- Characterization, mRNA expression and regulation of Δ6 fatty acyl desaturase (FADS2) by dietary n − 3 long chain polyunsaturated fatty acid (LC-PUFA) levels in grouper larvae (Epinephelus coioides) (2014) (32)
- Effect of fish meal replacement by plant protein blend on amino acid concentration, transportation and metabolism in juvenile turbot (Scophthalmus maximus L.) (2017) (32)
- Differential regulation of taurine biosynthesis in rainbow trout and Japanese flounder (2016) (32)
- Effects of a yeast‐based additive on growth and immune responses of white shrimp, Litopenaeus vannamei (Boone, 1931), and aquaculture environment (2013) (31)
- Interactive effects of dietary magnesium and vitamin E on growth performance, body composition, blood parameters and antioxidant status in Japanese seabass (Lateolabrax japonicus) fed oxidized oil (2016) (31)
- Comparative study on the bioavailability of chelated or inorganic zinc in diets containing tricalcium phosphate and phytate to turbot (Scophthalmus maximus) (2014) (31)
- Identification, organ expression and ligand-dependent expression levels of peroxisome proliferator activated receptors in grass carp (Ctenopharyngodon idella). (2012) (31)
- Effect of dietary iron supplement on growth, haematology and microelements of juvenile grouper, Epinephelus coioides (2007) (31)
- Molecular Cloning, Functional Characterization and Nutritional Regulation of the Putative Elongase Elovl5 in the Orange-Spotted Grouper (Epinephelus coioides) (2016) (30)
- Effects of dietary protein levels on the growth, survival, amylase and trypsin activities in large yellow croaker, Pseudosciaena Crocea R., larvae (2012) (30)
- Dietary chromium polynicotinate enhanced growth performance, feed utilization, and resistance to Cryptocaryon irritans in juvenile large yellow croaker (Larmichthys crocea) (2014) (30)
- The effect of dietary arachidonic acid (ARA) on growth performance, fatty acid composition and expression of ARA metabolism-related genes in larval half-smooth tongue sole (Cynoglossus semilaevis). (2015) (30)
- Dietary ascorbic acid requirement of cobia, Rachycentron canadum Linneaus (2010) (30)
- Replacement of dietary fish oil with vegetable oils improves the growth and flesh quality of large yellow croaker (Larmichthys crocea) (2014) (30)
- Effects of dietary corn gluten meal on growth performance and protein metabolism in relation to IGF-I and TOR gene expression of juvenile cobia (Rachycentron canadum) (2013) (30)
- Transcriptional up-regulation of a novel ferritin homolog in abalone Haliotis discus hannai Ino by dietary iron. (2010) (29)
- Dietary gossypol suppressed postprandial TOR signaling and elevated ER stress pathways in turbot (Scophthalmus maximus L.). (2017) (29)
- Evaluation of Schizochytrium meal in microdiets of Pacific white shrimp (Litopenaeus vannamei) larvae (2017) (29)
- Molecular cloning, characterization and expression analysis of heat shock protein 90 from Pacific abalone, Haliotis discus hannai Ino in response to dietary selenium. (2011) (29)
- Shrimp shell meal in diets for large yellow croaker Larimichthys croceus: Effects on growth, body composition, skin coloration and anti-oxidative capacity (2015) (29)
- Effects of dietary nucleotides on growth, non-specific immune response and disease resistance of sea cucumber Apostichopus japonicas. (2015) (29)
- Effects of dietary chitosan oligosaccharide complex with rare earth on growth performance and innate immune response of turbot, Scophthalmus maximus L. (2013) (28)
- Effects of Feeding Levels on Growth Performance, Feed Utilization, Body Composition, and Apparent Digestibility Coefficients of Nutrients for Grouper Epinephelus coioides Juveniles (2006) (28)
- Feed intake, growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed defatted fish meal diets with graded levels of cholesterol (2014) (28)
- Dietary nucleotides improve the growth performance, antioxidative capacity and intestinal morphology of turbot (Scophthalmus maximus) (2017) (28)
- Effects of Four Vegetable Protein Supplementation on Growth, Digestive Enzyme Activities, and Liver Functions of Juvenile Tilapia, Oreochromis niloticus×Oreochromis aureus (2010) (28)
- Dietary daidzein improved intestinal health of juvenile turbot in terms of intestinal mucosal barrier function and intestinal microbiota. (2019) (27)
- Establishment and characterization of two head kidney macrophage cell lines from large yellow croaker (Larimichthys crocea). (2019) (27)
- Roles of dietary taurine in fish nutrition (2020) (27)
- Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in Large Yellow Croakers. (2015) (27)
- Estimation of dietary biotin requirement of Japanese seabass, Lateolabrax japonicus C. (2009) (27)
- Dietary polystyrene nanoplastics exposure alters liver lipid metabolism and muscle nutritional quality in carnivorous marine fish large yellow croaker (Larimichthys crocea). (2021) (27)
- Molecular cloning, characterization and mRNA expression of selenium-dependent glutathione peroxidase from abalone Haliotis discus hannai Ino in response to dietary selenium, zinc and iron. (2010) (26)
- Molecular Cloning, Characterization, and Nutritional Regulation of Elovl6 in Large Yellow Croaker (Larimichthys crocea) (2019) (26)
- Molecular cloning of alpha2- macroglobulin in sea scallop Chlamys farreri (Bivalvia, Mollusca). (2005) (25)
- Soybean saponin modulates nutrient sensing pathways and metabolism in zebrafish. (2017) (25)
- Effects of dietary ethoxyquin on growth performance and body composition of large yellow croaker Pseudosciaena crocea (2010) (25)
- Comparative study on the organoleptic quality of wild and farmed large yellow croaker Larimichthys crocea (2019) (25)
- Evaluation of Enteromorpha prolifera as a feed component in large yellow croaker (Pseudosciaena crocea, Richardson, 1846) diets (2011) (25)
- Effect of Dietary Phosphorus Levels on Growth, Body Composition, Muscle and Bone Mineral Concentrations for Orange‐Spotted Grouper Epinephelus coioides Reared in Floating Cages (2004) (25)
- Effects of replacing plant proteins with rubber seed meal on growth, nutrient utilization and blood biochemical parameters of tilapia (Oreochromis niloticus × O. aureus) (2017) (25)
- Effects of dietary protein and lipid levels on growth and energy productive value of pacific white shrimp, Litopenaeus vannamei, at different salinities (2009) (24)
- Early Life Intervention Using Probiotic Clostridium butyricum Improves Intestinal Development, Immune Response, and Gut Microbiota in Large Yellow Croaker (Larimichthys crocea) Larvae (2021) (24)
- Nutrient values of dietary ascorbic acid (L-ascorbyl-2-polyphosphate) on growth, survival and stress tolerance of larval shrimp, Litopenaeus vannamei. (2009) (24)
- Dietary manganese requirement of juvenile large yellow croaker Larimichthys crocea (Richardson, 1846) (2016) (24)
- Activation of the Farnesoid X Receptor (FXR) Suppresses Linoleic Acid-Induced Inflammation in the Large Yellow Croaker (Larimichthys crocea). (2020) (24)
- Effects of dietary stachyose on growth performance, digestive enzyme activities and intestinal morphology of juvenile turbot (Scophthalmus maximus L) (2015) (24)
- Intestinal homeostasis of juvenile tiger puffer Takifugu rubripes was sensitive to dietary arachidonic acid in terms of mucosal barrier and microbiota (2019) (24)
- Effects of dietary vitamin E and astaxanthin on growth, skin colour and antioxidative capacity of large yellow croaker Larimichthys crocea (2018) (23)
- Comparative evaluation of nutritional value and flavor quality of muscle in triploid and diploid common carp: Application of genetic improvement in fish quality (2021) (23)
- Dietary arginine supplementation mitigates the soybean meal induced enteropathy in juvenile turbot, Scophthalmus maximus L. (2018) (23)
- 1H NMR‐based metabolomics studies on the effect of size‐fractionated fish protein hydrolysate, fish meal and plant protein in diet for juvenile turbot (Scophthalmus maximus L.) (2017) (23)
- Utilization of different raw and pre‐gelatinized starch sources by juvenile yellowfin seabream Sparus latus (2007) (23)
- Effects of dietary vitamin K on survival, growth, and tissue concentrations of phylloquinone (PK) and menaquinone-4 (MK-4) for juvenile abalone, Haliotis discus hannai Ino. (2001) (22)
- Effects of dietary methionine on growth performance and metabolism through modulating nutrient-related pathways in largemouth bass (Micropterus salmoides) (2021) (22)
- Effects of dietary β-conglycinin and glycinin on digestive enzymes activities, intestinal histology and immune responses of juvenile turbot Scophthalmus maximus (2016) (22)
- Total replacement of fish meal with soybean meal in diets for bullfrog (Lithobates catesbeianus): Effects on growth performance and gut microbial composition (2020) (22)
- Effects of supplementation of crystalline or coated methionine on growth performance and feed utilization of the pacific white shrimp, Litopenaeus vannamei (2011) (21)
- Citric acid as a functional supplement in diets for juvenile turbot, Scophthalmus maximus L.: Effects on phosphorus discharge, growth performance, and intestinal health (2018) (21)
- Lipid deposition in abalone Haliotis discus hannai affected by dietary lipid levels through AMPKα2/PPARα and JNK/mTOR/SREBP-1c pathway (2021) (21)
- Glucose and lipid metabolic adaptations during postprandial starvation of Japanese flounder Paralichthys olivaceus previously fed different levels of dietary carbohydrates (2019) (21)
- Improved utilization of soybean meal through fermentation with commensal Shewanella sp. MR-7 in turbot (Scophthalmus maximus L.) (2019) (21)
- Dietary taurine modulates hepatic oxidative status, ER stress and inflammation in juvenile turbot (Scophthalmus maximus L.) fed high carbohydrate diets. (2020) (20)
- Beneficial influences of dietary Aspergillus awamori fermented soybean meal on oxidative homoeostasis and inflammatory response in turbot (Scophthalmus maximus L.). (2019) (20)
- Molecular cloning, tissue distribution and nutritional regulation of a Δ6-fatty acyl desaturase-like enzyme in large yellow croaker (Larimichthys crocea) (2016) (20)
- Effects of dietary glycyrrhizin on growth and nonspecific immunity of white shrimp, Litopenaeus vannamei. (2010) (20)
- Chronic rapamycin treatment on the nutrient utilization and metabolism of juvenile turbot (Psetta maxima) (2016) (20)
- Effect of dietary methionine on growth performance, lipid metabolism and antioxidant capacity of large yellow croaker (Larimichthys crocea) fed with high lipid diets (2021) (19)
- Dietary folic acid requirement of juvenile abalone Haliotis discus hannai Ino (2013) (19)
- High Fat Activates O-GlcNAcylation and Affects AMPK/ACC Pathway to Regulate Lipid Metabolism (2021) (19)
- Dietary methionine requirement of the pre‐adult gibel carp (Carassius auratus gibeilo) at a constant dietary cystine level (2016) (19)
- The tolerance and safety assessment of taurine as additive in a marine carnivorous fish, Scophthalmus maximus L. (2018) (19)
- The differences in postprandial free amino acid concentrations and the gene expression of PepT1 and amino acid transporters after fishmeal partial replacement by meat and bone meal in juvenile turbot (Scophthalmus maximus L.) (2017) (19)
- Ontogenetic taurine biosynthesis ability in rainbow trout (Oncorhynchus mykiss). (2015) (19)
- Effects of oxidised dietary fish oil and high-dose vitamin E supplementation on growth performance, feed utilisation and antioxidant defence enzyme activities of juvenile large yellow croaker (Larmichthys crocea) (2016) (19)
- Effects of dietary soy isoflavones on feed intake, growth performance and digestibility in juvenile Japanese flounder (Paralichthys olivaceus) (2012) (18)
- Impacts of replacement of dietary fish oil by vegetable oils on growth performance, anti-oxidative capacity, and inflammatory response in large yellow croaker Larimichthys crocea (2019) (18)
- Effects of dietary curcumin on growth, antioxidant capacity, fatty acid composition and expression of lipid metabolism-related genes of large yellow croaker fed a high-fat diet (2020) (18)
- Safety level evaluation of dietary 2-hydroxy-4-(methylthio) butanoic acid (HMTBa) for turbot Scophthalmus maximus based on growth performances, anti-oxidative responses, and liver and intestine conditions (2015) (18)
- Dietary lipid levels affect lipoprotein clearance, fatty acid transport, lipogenesis and lipolysis at the transcriptional level in muscle and adipose tissue of large yellow croaker (Larimichthys crocea) (2017) (18)
- Effects of dietary ethoxyquin on growth, feed utilization and residue in the muscle of juvenile Japanese seabass, Lateolabrax japonicus (2015) (18)
- Proline with or without hydroxyproline influences collagen concentration and regulates prolyl 4-hydroxylase α (I) gene expression in juvenile turbo (Scophthalmus maximus L.) (2015) (18)
- The effect of dietary cecropin AD on intestinal health, immune response and disease resistance of juvenile turbot (Scophthalmus maximus L.). (2020) (18)
- Comparative study on the effects of chelated or inorganic manganese in diets containing tricalcium phosphate and phytate on the growth performance and physiological responses of turbot Scophthalmus maximus (2015) (18)
- Effects of dietary carbohydrate-to-lipid ratio on the growth performance and feed utilization of juvenile turbot (Scophthalmus maximus) (2016) (18)
- Molecular cloning and characterization of farnesoid X receptor from large yellow croaker (Larimichthys crocea) and the effect of dietary CDCA on the expression of inflammatory genes in intestine and spleen. (2018) (18)
- Metabolic responses to dietary cholecalciferol and phosphorus in abalone Haliotis discus hannai ino. (2003) (18)
- Effects of Dietary Protein and Lipid Levels on Growth, Nutrient Utilization, and the Whole‐body Composition of Turbot, Scophthalmus maximus, Linnaeus 1758, at Different Growth Stages (2014) (17)
- Regulation of adiponectin on lipid metabolism in large yellow croaker (Larimichthys crocea). (2020) (17)
- Dietary taurine improves muscle growth and texture characteristics in juvenile turbot (Scophthalmus maximus) (2020) (17)
- Taurine supplements in high-fat diets improve survival of juvenile Monopterus albus by reducing lipid deposition and intestinal damage (2022) (17)
- Dietary ascorbic acid modulates the expression profile of stress protein genes in hepatopancreas of adult Pacific abalone Haliotis discus hannai Ino. (2014) (17)
- The effect of ultrafiltered fish protein hydrolysate levels on the liver and muscle metabolic profile of juvenile turbot (Scophthalmus maximus L.) by 1H NMR‐based metabolomics studies (2017) (17)
- Dietary carbohydrates influence muscle texture of olive flounder Paralichthys olivaceus through impacting mitochondria function and metabolism of glycogen and protein (2020) (17)
- Effects of raw corn starch levels on growth, feed utilization, plasma chemical indices and enzyme activities in juvenile yellowfin seabream Sparus latus Houttuyn (2007) (17)
- Dietary fishmeal levels affect the volatile compounds in cooked muscle of farmed large yellow croaker Larimichthys crocea (2017) (17)
- Dietary arginine requirement of juvenile swimming crab, Portunus trituberculatus. (2016) (17)
- Integrative analysis of transcriptomics and metabolomics profiling on flesh quality of large yellow croaker Larimichthys crocea fed a diet with hydroxyproline supplementation (2018) (16)
- Effects of dietary zinc on the shell biomineralization in abalone Haliotis discus hannai Ino (2003) (16)
- Dietary leucine requirement for juvenile large yellow croaker Pseudosciaena crocea (Richardson, 1846) (2010) (16)
- Dietary Allicin Improved the Survival and Growth of Large Yellow Croaker (Larimichthys crocea) Larvae via Promoting Intestinal Development, Alleviating Inflammation and Enhancing Appetite (2020) (16)
- Evaluation of iron methionine and iron sulphate as dietary iron sources for juvenile cobia (Rachycentron canadum) (2013) (16)
- Dietary magnesium did not affect calcium and phosphorus content in juvenile grouper, Epinephelus coioides (2009) (16)
- TIR Domain-Containing Adaptor-Inducing Interferon-β (TRIF) Participates in Antiviral Immune Responses and Hepatic Lipogenesis of Large Yellow Croaker (Larimichthys Crocea) (2019) (16)
- Studies on the nutrition of two species of catfish, Silurus meridionalis Chen and S. asotus Linnaeus. I. Effects of dietary protein and lipid on growth performance and feed utilization (2013) (16)
- Adipose tissue contributes to hepatic pro-inflammatory response when dietary fish oil is replaced by vegetable oil in large yellow croaker (Larimichthys crocea): An ex vivo study. (2019) (16)
- Lipid and fatty acid compositions of cod (Gadus morhua), haddock (Melanogrammus aeglefinus) and halibut (Hippoglossus hippoglossus) (2010) (16)
- The effect of different levels of dietary phospholipid on growth, survival and nutrient composition of early juvenile cobia (Rachycentron canadum) (2008) (16)
- Myostatin-1 Inhibits Cell Proliferation by Inhibiting the mTOR Signal Pathway and MRFs, and Activating the Ubiquitin-Proteasomal System in Skeletal Muscle Cells of Japanese Flounder Paralichthys olivaceus (2020) (16)
- Dietary Lysine Regulates Body Growth Performance via the Nutrient-Sensing Signaling Pathways in Largemouth Bass (Micropterus salmoides) (2020) (16)
- Molecular cloning and characterization of taurine transporter from turbot (Psetta maxima) and its expression analysis regulated by taurine in vitro (2017) (16)
- Effect of dietary phosphorus sources and varying levels of supplemental phosphorus on survival, growth and body composition of postlarval shrimp (Litopenaeus vannamei) (2008) (15)
- Modulation of lipid metabolism, immune parameters, and hepatic transferrin expression in juvenile turbot (Scophthalmus maximus L.) by increasing dietary linseed oil levels (2016) (15)
- High level of dietary soybean oil affects the glucose and lipid metabolism in large yellow croaker Larimichthys crocea through the insulin-mediated PI3K/AKT signaling pathway. (2019) (15)
- Effects of replacement of dietary fish oil by rapeseed oil on growth performance, anti-oxidative capacity and inflammatory response in large yellow croaker Larimichthys crocea (2020) (15)
- Lipid deposition patterns among different sizes of three commercial fish species (2018) (15)
- Effects of Protein and Lipid Levels in Practical Diets on Growth and Body Composition of Tongue Sole, Cynoglossus semilaevis Gunther (2013) (15)
- Effect of dietary xylan on immune response, tight junction protein expression and bacterial community in the intestine of juvenile turbot (Scophthalmus maximus L.) (2019) (15)
- Rearing in intermediate salinity enhances immunity and disease-resistance of turbot (Scophthalmus maximus L.) (2011) (15)
- Effects of dietary silymarin (SM) supplementation on growth performance, digestive enzyme activities, antioxidant capacity and lipid metabolism gene expression in large yellow croaker ( Larimichthys crocea ) larvae (2020) (15)
- Expansion of sweet taste receptor genes in grass carp (Ctenopharyngodon idellus) coincided with vegetarian adaptation (2019) (14)
- The Assessment of Diet Contaminated with Aflatoxin B1 in Juvenile Turbot (Scophthalmus maximus) and the Evaluation of the Efficacy of Mitigation of a Yeast Cell Wall Extract (2020) (14)
- Molecular cloning, characterization and mRNA expression of selenium-binding protein in abalone (Haliotis discus hannai Ino): Response to dietary selenium, iron and zinc. (2010) (14)
- Influence of dietary probiotic Bacillus TC22 and Prebiotic fructooligosaccharide on growth, immune responses and disease resistance against Vibrio splendidus infection in sea cucumber Apostichopus japonicus (2011) (14)
- Effects of dietary Antarctic krill Euphausia superba meal on growth performance and muscle quality of triploid rainbow trout Oncorhynchus mykiss farmed in sea water (2019) (14)
- Molecular cloning and genetic ontogeny of some key lipolytic enzymes in large yellow croaker larvae (Larimichthys crocea R.) (2017) (14)
- Palatability of water-soluble extracts of protein sources and replacement of fishmeal by a selected mixture of protein sources for juvenile turbot (Scophthalmus maximus) (2016) (14)
- Effects of High Levels of Dietary Linseed Oil on the Growth Performance, Antioxidant Capacity, Hepatic Lipid Metabolism, and Expression of Inflammatory Genes in Large Yellow Croaker (Larimichthys crocea) (2021) (14)
- Effect of replacement of dietary fish oil with four vegetable oils on prostaglandin E2 synthetic pathway and expression of inflammatory genes in marine fish Larimichthys crocea. (2020) (14)
- Dietary protein requirement of juvenile turbot (Scophthalmus maximus Linnaeus) (2015) (14)
- The effects of dietary Eucommia ulmoides Oliver on growth, feed utilization, antioxidant activity and immune responses of turbot (Scophthalmus maximus L.) (2018) (14)
- Use of a Compound Protein Source as a Replacement for Fish Meal in Diets of Large Yellow Croaker, Pseudosciaena crocea R. (2008) (14)
- Lipid overload impairs hepatic VLDL secretion via oxidative stress-mediated PKCδ-HNF4α-MTP pathway in large yellow croaker (Larimichthys crocea). (2021) (14)
- Dietary supplements of guanosine improve the growth, non-specific immunity of sea cucumber, Apostichopus japonicus Selenka, and its resistance against Vibrio splendidus (2018) (14)
- Effects of melamine on growth performance and skin color of darkbarbel catfish (Pelteobagrus vachelli) (2011) (13)
- Effects of silymarin on growth performance, antioxidant capacity and immune response in turbot ( Scophthalmus maximus L.) (2019) (13)
- Ca2+ concentration–dependent premature death of igfbp5a−/− fish reveals a critical role of IGF signaling in adaptive epithelial growth (2018) (13)
- Effects of dietary arginine levels on growth, immune function of physical barriers and serum parameters of spotted seabass (Lateolabrax maculatus) reared at different water temperatures (2021) (13)
- Effects of dietary β‐glucan and glycyrrhizin on non‐specific immunity and disease resistance of white shrimp, Litopenaeus vannamei (Boone) challenged with Vibrio alginolyticus (2011) (13)
- Expression pattern of peptide and amino acid genes in digestive tract of transporter juvenile turbot (Scophthalmus maximus L.) (2016) (13)
- Potential of Several Protein Sources as Fish Meal Substitutes in Diets for Large Yellow Croaker, Pseudosciaena crocea R (2010) (13)
- Effects of dietary tributyrin on growth performance, body composition, serum biochemical indexes and lipid metabolism‐related genes expression of juvenile large yellow croaker ( Larimichthys crocea ) fed with high level soybean oil diets (2020) (13)
- Effect of dietary cholesterol and phospholipids on feed intake, growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) (2018) (13)
- Effects of dietary glucose and dextrin on activity and gene expression of glucokinase and fructose-1,6-bisphosphatase in liver of turbot Scophthalmus maximus (2015) (13)
- Over high or low dietary protein levels depressed the growth, TOR signaling, apoptosis, immune and anti-stress of abalone Haliotis discus hannai. (2020) (13)
- Advances in the study on nutrient requirements of grouper (Epinephelus sp.): a review (2005) (13)
- INTERACTION BETWEEN VITAMINS A AND D ON GROWTH AND METABOLIC RESPONSES OF ABALONE HALIOTIS DISCUS HANNAI, INO (2007) (13)
- Molecular cloning, functional characterization and nutritional regulation of two elovl4b elongases from rainbow trout (Oncorhynchus mykiss) (2019) (13)
- Effect of waterborne copper on lipid metabolism in hepatopancreas and muscle of grass carp Ctenopharyngodon idella (2017) (13)
- Molecular adaptations of glucose and lipid metabolism to different levels of dietary carbohydrates in juvenile Japanese flounderParalichthys olivaceus (2020) (12)
- EFFECTS OF VITAMIN E ON ANTIOXIDANT ENZYME ACTIVITIES AND FATTY ACID COMPOSITIONS IN JUVENILE ABALONE HALIOTIS DISCUS HANNAI INO (2007) (12)
- Molecular cloning, tissue distribution and nutritional regulation of a fatty acyl elovl5-like elongase in large yellow croaker, Larimichthys crocea (2016) (12)
- Growth and feed efficiency of juvenile shrimp Litopenaeus vannamei fed formulated diets containing different levels of poultry by-product meal (2009) (12)
- Dietary leucine requirement of juvenile Japanese seabass (Lateolabrax japonicus) (2015) (12)
- Effects of antinutritional factors on plasma lipoprotein levels in Japanese flounder Paralichthys olivaceus. (2012) (12)
- Effects of dietary lysolecithin on growth performance, feed utilization, intestinal morphology and metabolic responses of channel catfish (Ictalurus punctatus) (2020) (12)
- Effects of dietary xylan on growth performance , digestive enzyme activity and intestinal morphology of juvenile turbot ( Scophthalmus maximus L . ) (2014) (12)
- Effects of replacing soybean meal with rubber seed meal on digestive enzyme activity, nutrient digestibility and retention in tilapia (Oreochromis niloticus × Oreochromis aureus) (2016) (12)
- Establishment and characterization of a fibroblast-like cell line from the muscle of turbot (Scophthalmus maximus L.) (2019) (11)
- Effects of continuous and alternate administration of β‐glucan and mannan‐oligosaccharide on the growth, immunity and resistance against Vibrio splendidus of sea cucumber Apostichopus japonicus (Selenka) (2013) (11)
- Wnt/β-catenin signaling participates in the regulation of lipogenesis in the liver of juvenile turbot (Scophthalmus maximus L.). (2016) (11)
- The protective role of daidzein in intestinal health of turbot (Scophthalmus maximus L.) fed soybean meal-based diets (2021) (11)
- Ascorbic Acid Regulates the Immunity, Anti-Oxidation and Apoptosis in Abalone Haliotis discus hannai Ino (2021) (11)
- Molecular cloning and the involvement of IRE1α-XBP1s signaling pathway in palmitic acid induced - Inflammation in primary hepatocytes from large yellow croaker (Larimichthys crocea). (2020) (11)
- Effects of dietary grape seed oil and linseed oil on growth, muscle fatty acid composition and expression of putative Δ5 fatty acyl desaturase in abalone Haliotis discus hannai Ino (2013) (11)
- Dietary arachidonic acid supplementation improves the growth performance and alleviates plant protein‐based diet‐induced inflammation in juvenile turbot ( Scophthalmus maximus L.) (2020) (11)
- Influence of a Dietary Vegetable Oil Blend on Serum Lipid Profiles in Large Yellow Croaker ( Larimichthys crocea). (2018) (11)
- Reduced glutathione supplementation in practical diet improves the growth, anti‐oxidative capacity, disease resistance and gut morphology of shrimp Litopenaeus vannamei (2018) (11)
- Effects of dietary supplementation of glycyrrhizic acid on growth performance, survival, innate immune response and parasite resistance in juvenile large yellow croaker, Larimichthys crocea (Richardson) (2015) (11)
- The Mitotic and Metabolic Effects of Phosphatidic Acid in the Primary Muscle Cells of Turbot (Scophthalmus maximus) (2018) (11)
- A tolerance and safety assessment of daidzein in a female fish (Carassius auratus gibelio) (2016) (11)
- Polyunsaturated Fatty Acids Influence LPS-Induced Inflammation of Fish Macrophages Through Differential Modulation of Pathogen Recognition and p38 MAPK/NF-κB Signaling (2020) (11)
- Interactions of dietary vitamin C and proline on growth performance, anti-oxidative capacity and muscle quality of large yellow croaker Larimichthys crocea (2020) (11)
- Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber (Apostichopus japonicus Selenka) challenged with Vibrio splendidus (2010) (11)
- GSK-3β participates in the regulation of hepatic lipid deposition in large yellow croaker (Larmichthys crocea) (2016) (11)
- The effects of dietary astaxanthin on intestinal health of juvenile tiger puffer Takifugu rubripes in terms of antioxidative status, inflammatory response and microbiota (2018) (11)
- Effects of Dietary Binders on Survival and Growth Performance of Postlarval Tongue Sole, Cynoglossus semilaevis (Günther) (2008) (11)
- Effects of dietary n‐3 long‐chain unsaturated fatty acid on growth performance, lipid deposition, hepatic fatty acid composition and health‐related serum enzyme activity of juvenile Japanese seabass Lateolabrax japonicus (2017) (11)
- Suppressor of cytokine signaling 3 (SOCS3) is related to pro‐inflammatory cytokine production and triglyceride deposition in turbot (Scophthalmus maximus) (2017) (10)
- Comparative analysis of glucose metabolism responses of large yellow croaker Larimichthys crocea fed diet with fish oil and palm oil (2019) (10)
- Replacement of dietary fish meal with Clostridium autoethanogenum protein on growth performance, digestion, mTOR pathways and muscle quality of abalone Haliotis discus hannai (2022) (10)
- Short-Chain Fatty Acids Promote Intracellular Bactericidal Activity in Head Kidney Macrophages From Turbot (Scophthalmus maximus L.) via Hypoxia Inducible Factor-1α (2020) (10)
- Effect of dietary chitosan oligosaccharide complex with Ce (IV) on growth, immunity and disease resistance against Vibrio splendidus of sea cucumber, Apostichopus japonicas (2017) (10)
- Influence of 18:2n‐6/20:5n‐3 ratio in diets on growth and fatty acid composition of juvenile abalone, Haliotis discus hannai Ino (2011) (10)
- Influence of dietary amino acid profiles on growth performance and body composition of juvenile grouper Epinephelus coioides (2008) (10)
- Effects of dietary monocalcium phosphate supplementation on the anti-oxidative capacity, anti-bacteria function in immune organs of obscure puffer (Takifugu obscurus) after infection with Aeromonas hydrophila. (2019) (10)
- Effects of low dietary fish meal on the volatile compounds in muscle of large yellow croaker Larimichthys crocea (2017) (10)
- Forkhead box O1 in turbot Scophthalmus maximus: Molecular characterization, gene structure, tissue distribution and the role in glucose metabolism. (2019) (10)
- Effects of DL-methionyl-DL-methionine supplementation on growth performance, immune and antioxidative responses of white leg shrimp (Litopenaeus vannamei) fed low fishmeal diet (2021) (10)
- Development of a Whole Organism Platform for Phenotype-Based Analysis of IGF1R-PI3K-Akt-Tor Action (2017) (10)
- Differential Apoptotic and Mitogenic Effects of Lectins in Zebrafish (2019) (10)
- EFFECTS OF DIETARY GLYCYRRHIZIN ON GROWTH, IMMUNITY OF SEA CUCUMBER AND ITS RESISTANCE AGAINST VIBRIO SPLENDIDUS : EFFECTS OF DIETARY GLYCYRRHIZIN ON GROWTH, IMMUNITY OF SEA CUCUMBER AND ITS RESISTANCE AGAINST VIBRIO SPLENDIDUS (2010) (9)
- Comparatively study on the insulin-regulated glucose homeostasis through brain-gut peptides in Japanese flounder Paralichthys olivaceus after intraperitoneal and oral administration of glucose. (2018) (9)
- Responses of glucosensing system to glucose in Japanese flounder Paralichthys olivaceus fed diets with different carbohydrate content. (2019) (9)
- Administration of commensal Shewanella sp. MR-7 ameliorates lipopolysaccharide-induced intestine dysfunction in turbot (Scophthalmus maximus L.). (2020) (9)
- Tumor necrosis factor alpha is a potent regulator in fish adipose tissue (2015) (9)
- Effects of dietary squid viscera meal on growth and cadmium accumulation in tissues of large yellow croaker, Pseudosciaena crocea R. (2009) (9)
- Dietary Histidine Requirement for Juvenile Large Yellow Croaker, Pseudosciaena crocea R. (2014) (9)
- Effects of dietary lutein/canthaxanthin ratio on the growth and pigmentation of large yellow croaker Larimichthys croceus (2016) (9)
- Effects of replacing fish meal with rubber seed meal on growth, nutrient utilization, and cholesterol metabolism of tilapia (Oreochromis niloticus × O. aureus) (2017) (9)
- Effects of dietary vitamin K on growth performances, blood coagulation time and menaquinone‐4 (MK‐4) concentration in tissues of juvenile large yellow croaker Pseudosciaena crocea (2015) (9)
- Cloning and characterization of an actin gene of Chlamys farreri and the phylogenetic analysis of mollusk actins (2007) (9)
- Acetyl-CoA derived from hepatic mitochondrial fatty acid β-oxidation aggravates inflammation by enhancing p65 acetylation (2021) (9)
- Dietary administration of soybean isoflavones enhances the immunity of white shrimp Litopenaeus vannamei and its resistance against Vibrio alginolyticus (2011) (9)
- PYRIDOXINE REQUIREMENT OF JUVENILE ABALONE, HALIOTIS DISCUS HANNAI INO (2007) (9)
- Effects of waterborne Cu and Cd on anti-oxidative response, lipid peroxidation and heavy metals accumulation in abalone Haliotis discus hannai ino (2015) (9)
- Effects of brown fish meal replacement with fermented soybean meal on growth performance, feed efficiency and enzyme activities of Chinese soft-shelled turtle, Pelodiscus sinensis (2012) (9)
- Effects of dietary arginine on growth, anti-oxidative enzymes, biomarkers of immunity, amino acid metabolism and resistance to Vibrio parahaemolyticus challenge in abalone Haliotis discus hannai (2021) (8)
- Alterations in fatty acid composition and volatile compounds in muscle of large yellow croaker Larimichthys crocea fed different dietary lipid sources (2021) (8)
- Recent progress in the understanding of the gut microbiota of marine fishes (2021) (8)
- Recent advances in amino acid sensing and new challenges for protein nutrition in aquaculture (2019) (8)
- FXR, a Key Regulator of Lipid Metabolism, Is Inhibited by ER Stress-Mediated Activation of JNK and p38 MAPK in Large Yellow Croakers (Larimichthys crocea) Fed High Fat Diets (2021) (8)
- Amnesic shellfish poisoning toxin stimulates the transcription of CYP1A possibly through AHR and ARNT in the liver of red sea bream Pagrus major. (2009) (8)
- Effects of dietary cholesterol on growth, survival and body composition of juvenile abalone Haliotis discus hannai Ino (2009) (8)
- Effects of dietary Shewanella sp. MR-7 on the growth performance, immunity, and intestinal microbiota of Pacific white shrimp (2021) (8)
- Endoplasmic reticulum stress induces hepatic steatosis by transcriptional upregulating lipid droplet protein perilipin2 (2021) (8)
- Replacement of dietary fish meal by soybean meal on growth performance, immunity, anti-oxidative capacity and mTOR pathways in juvenile abalone Haliotis discus hannai Ino (2022) (8)
- Characterization of antiviral immune response induced by poly(I:C) in macrophages of farmed large yellow croaker (Larimichthys crocea). (2020) (8)
- Regulation of Free Fatty Acid Receptor 4 on Inflammatory Gene Induced by LPS in Large Yellow Croaker (Larimichthys crocea) (2021) (8)
- Effect of growth phase on the fatty acid compositions of four species of marine diatoms (2005) (8)
- Effects of supplemental phytosterol on growth performance, body composition, serum biochemical indexes and lipid metabolism of juvenile large yellow croaker (Larimichthys crocea) fed with high lipid diet (2022) (8)
- Effects of different dietary lipid levels on intestinal mucosal barrier and microbial community of juvenile tiger puffer Takifugu rubripes (2021) (8)
- Apparent Digestibility of Selected Feed Ingredients in Juvenile Turbot (Scophthalmus maxima L.) (2015) (8)
- Effects of dietary terrestrial oils supplemented with l-carnitine on growth, antioxidant capacity, lipid metabolism and inflammation in large yellow croaker (Larimichthys crocea) (2020) (8)
- Effects of Soya Saponins on Feed Intake, Growth Performance, and Cholesterol Metabolism in Juvenile Turbot (Scophthalmus maximus L) (2015) (8)
- Docosahexaenoic Acid Alleviates Palmitic Acid-Induced Inflammation of Macrophages via TLR22-MAPK-PPARγ/Nrf2 Pathway in Large Yellow Croaker (Larimichthys crocea) (2022) (7)
- Vitamin D3 protects turbot (Scophthalmus maximus L.) from bacterial infection. (2021) (7)
- Effects of vitamin C deficiency or excess on growth performance, anti-oxidative response and fatty acid composition of juvenile abalone Haliotis discus hannai Ino (2020) (7)
- The effects of different lipid sources on the growth, intestinal health, and lipid metabolism of the pacific white shrimp (Litopenaeus vannamei) (2021) (7)
- A study on the meat and bone meal and poultry by-product meal as protein substitutes of fish meal in practical diets for Litopenaeus vannamei juveniles (2004) (7)
- The effect and mechanism of dietary monocalcium phosphate restriction on hepatic lipid deposition and immune status in obscure puffer, Takifugu obscurus (2020) (7)
- Effects of dietary Senecio scandens buch-ham extracts on growth performance, plasma biochemical, histology and the expression of immune-related genes in hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀). (2019) (7)
- Fatty acid translocase (FAT/CD36) in large yellow croaker (Larimichthys crocea): Molecular cloning, characterization and the response to dietary fatty acids (2020) (7)
- Dietary lipid levels affected antioxidative status, inflammation response, apoptosis and microbial community in the intestine of juvenile turbot (Scophthalmus maximus L.). (2021) (7)
- Interactive effects of dietary biotin and carbohydrate on growth performance and glucose metabolism in juvenile turbot Scophthalmus maximus L. (2021) (7)
- Endoplasmic Reticulum Stress Disturbs Lipid Homeostasis and Augments Inflammation in the Intestine and Isolated Intestinal Cells of Large Yellow Croaker (Larimichthys crocea) (2021) (7)
- Influence of dietary lipid on growth performance and some lipogenesis-related gene expression of tongue sole (Cynoglossus semilaevis) larvae (2017) (7)
- Effects of dietary xanthophylls/astaxanthin ratios on the growth and skin pigmentation of large yellow croaker Larimichthys crocea (Richardson, 1846) (2015) (7)
- Tumour necrosis factor-α inhibits hepatic lipid deposition through GSK-3β/β-catenin signaling in juvenile turbot (Scophthalmus maximus L.). (2016) (7)
- A successful microbound diet for the larval culture of Chinese shrimp Fenneropenaeus chinensis (2005) (7)
- Effect of different dietary raw to pre-gelatinized starch ratios on growth performance, feed utilization and body composition of juvenile yellowfin seabream (Sparus latus) (2007) (7)
- Effects of antimicrobial peptide APSH‐07 on the growth performance, anti‐oxidation responses, stress resistance and intestine microbiota in large yellow croakerLarimichthys crocea (2020) (6)
- Dietary Ala-Gln ameliorated growth suppression and intestinal injury induced by soya saponin in zebrafish (2020) (6)
- Effects of dietary levels of protein on growth, feed utilization and physiological parameters for juvenile Dabry's sturgeon, Acipenser dabryanus (2018) (6)
- Effects of Dietary Pregelatinized Corn Starch on Growth, Apparent Digestibility, and Digestive Enzyme Activity of Large Yellow Croaker Fingerlings (Pseudosciaena crocea) (2013) (6)
- Effects of dietary vitamin E supplementation on growth, feed utilization and flesh quality of large yellow croaker Larimichthys crocea fed with different levels of dietary yellow mealworm Tenebrio molitor meal (2022) (6)
- Functional analysis and regulation mechanism of interferon gamma in macrophages of large yellow croaker (Larimichthys crocea) (2021) (6)
- Maize Oil Can Replace Fish Oil in The Diet of Grouper Postlarvae (Epinephelus Coioides) Without Adversely Affecting Growth or Fatty Acid Composition (2007) (6)
- Molecular Characterization, Nutritional and Insulin Regulation of Elovl6 in Rainbow Trout (Oncorhynchus mykiss) (2020) (6)
- Effects of dietary protein sources on feed intake, growth and plasma thyroid hormones levels of Japanese flounder (Paralichthys olivaceus) (2011) (6)
- Influence of dietary phospholipids level on growth performance, body composition and lipid class of early postlarval Litopenaeus vannamei (2011) (6)
- Molecular identification of peptidoglycan recognition protein 5 and its functional characterization in innate immunity of Large yellow croaker, Larimichthys crocea. (2021) (6)
- Effects of five compound attractants in high plant‐based diets on feed intake and growth performance of juvenile turbot ( Scophthalmus maximus L . ) (2019) (6)
- Effect of dietary lipid on the growth, fatty acid composition and Δ5 Fads expression of abalone (Haliotis discus hannai Ino) hepatopancreas (2015) (6)
- High glucose induces apoptosis, glycogen accumulation and suppresses protein synthesis in muscle cells of olive flounder Paralichthys olivaceus (2021) (6)
- Using a selectively bred nongenetically modified soybean meal to replace fishmeal in practical diets for the Pacific white shrimp Litopenaeus vannamei (2018) (6)
- Dietary recombinant human lysozyme improves the growth, intestinal health, immunity and disease resistance of Pacific white shrimp Litopenaeus vannamei. (2022) (6)
- Effects of fish meal replaced by methanotroph bacteria meal (Methylococcus capsulatus) on growth, body composition, antioxidant capacity, amino acids transporters and protein metabolism of turbot juveniles (Scophthalmus maximus L.) (2022) (5)
- Environmental adaptation in fish induced changes in the regulatory region of fatty acid elongase gene, elovl5, involved in long-chain polyunsaturated fatty acid biosynthesis. (2022) (5)
- Effects of dietary protein levels on growth performance, serum indexes, PI3K/AKT/mTOR/S6K signalling and intestinal microbiota of abalone Haliotis discus hannai (2021) (5)
- Effects of yeast autolysate in practical diet on the growth performance, immune response and disease resistance of shrimp Litopenaeus vannamei. (2019) (5)
- Replacement of fish meal by enzyme‐treated soybean on the growth performance, intestine microflora, immune responses and disease resistance of Pacific white shrimp Litopenaeus vannamei (2021) (5)
- Dietary daidzein improves the development of intestine subjected to soybean meal in juvenile turbot ( Scophthalmus maximus L.) (2021) (5)
- Effects of dietary menadione on the activity of antioxidant enzymes in abalone, Haliotis discus hannai Ino (2012) (5)
- Effects of dietary chromium yeast and astaxanthin on the growth performance, anti-oxidative capacity, and resistance to heat stress of abalone Haliotis discus hannai (2021) (5)
- BAFF gets involved in response to bacterial infection and promotes IgM+ B cell survival in Nile tilapia (Oreochromis niloticus) (2020) (5)
- Increased LDL receptor by SREBP2 or SREBP2-induced lncRNA LDLR-AS promotes triglyceride accumulation in fish (2022) (5)
- Effect of dietary olaquindox on the growth of large yellow croaker (Pseudosciaena crocea R.) and the distribution of its residues in fish tissues (2014) (5)
- Dose‐dependent protective effects of dietary selenium on abalone Haliotis discus hannai Ino against the toxicity of waterborne copper (2016) (5)
- Molecular cloning and characterization of unfolded protein response genes from large yellow croaker (Larimichthys crocea) and their expression in response to dietary fatty acids. (2017) (5)
- The Antimicrobial Peptide Cecropin AD Supplement Alleviated Soybean Meal-Induced Intestinal Inflammation, Barrier Damage, and Microbial Dysbiosis in Juvenile Turbot, Scophthalmus maximus (2020) (5)
- Characteristics and phylogenetic studies of complete mitochondrial DNA based on the ricefield eel (Monopterus albus) from four different areas (2016) (5)
- Effects of dietary guaiacol on shell biomineralization of juvenile abalone Haliotis discus hannai, Ino (2008) (5)
- Nrf2 pathway in vegetable oil-induced inflammation of large yellow croaker (Larimichthys crocea). (2022) (5)
- EFFECTS OF DIETARY POTASSIUM ON GROWTH PERFORMANCE OF JUVENILE ABALONE (HALIOTIS DISCUS HANNAI INO) AND ITS PHYSIOLOGICAL RESPONSES: EFFECTS OF DIETARY POTASSIUM ON GROWTH PERFORMANCE OF JUVENILE ABALONE (HALIOTIS DISCUS HANNAI INO) AND ITS PHYSIOLOGICAL RESPONSES (2013) (5)
- Effects of Replacing Fish Meal with Soybean Meal or Fermented and Phytase-Treated Soybean Meal Respectively, on Growth Performance, Feed Utilization, and Apparent Digestibility in Juvenile Turbot (Scophthalmus maximus L.) (2016) (5)
- Dietary threonine requirement of juvenile large yellow croaker, Larmichthys crocea (2016) (5)
- Evaluation of composite mixture of protein sources in replacing fishmeal for Pacific white shrimp (Litopenaeus vannamei): Based on the changing pattern of growth performance, nutrient metabolism and health status (2021) (5)
- Vitamin D3/VDR inhibits inflammation through NF-κB pathway accompanied by resisting apoptosis and inducing autophagy in abalone Haliotis discus hannai. (2021) (5)
- Optimal amounts of coconut oil in diets improve the growth, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea) (2020) (5)
- Protective effects of dietary α-lipoic acid on abalone Haliotis discus hannai against the oxidative damage under waterborne cadmium stress (2018) (5)
- Evaluation of Six Selected Commercial Fermented Soybean Meal by Feeding Juvenile Turbot ( Scophthalmus maximus L.) (2022) (4)
- Effects of dietary fish oil replaced with rapeseed oil on the growth,fatty acid composition and skin color of large yellow croaker(Larimichthys crocea) (2013) (4)
- Effects of different dietary carbohydrates on growth performance and metabolism response of juvenile turbot(Scophthalmus maximus) (2013) (4)
- Conventional Soybean Meal as Fishmeal Alternative in Diets of Japanese Seabass (Lateolabrax japonicus): Effects of Functional Additives on Growth, Immunity, Antioxidant Capacity and Disease Resistance (2022) (4)
- Dynamics of Intestinal Inflammatory Cytokines and Tight Junction Proteins of Turbot (Scophthalmus maximus L.) During the Development and Recovery of Enteritis Induced by Dietary β-Conglycinin (2020) (4)
- In vitro assay for evaluating the effects of three anti‐nutritional factors on the primary‐cultured intestinal epithelial cells isolated from Japanese flounder, Paralichthys olivaceus (2015) (4)
- Replacement of dietary fish meal with Clostridium autoethanogenum meal on growth performance, intestinal amino acids transporters, protein metabolism and hepatic lipid metabolism of juvenile turbot (Scophthalmus maximus L.) (2022) (4)
- Molecular cloning and functional characterization of arachidonate 5-lipoxygenase (Alox5), and its expression in response to the ratio of linolenic acid to linoleic acid in diets of large yellow croaker (Larmichthys crocea). (2016) (4)
- Influences of dietary antimicrobial peptide APSH‐07 on the growth performance, immune response and vibriosis resistance of abalone Haliotis discus hannai Ino (2020) (4)
- Fine-Tuning of Postprandial Responses via Feeding Frequency and Leucine Supplementation Affects Dietary Performance in Turbot (Scophthalmus maximus L.). (2021) (4)
- Changes in Growth Performance, Nutrient Metabolism, Antioxidant Defense and Immune Response After Fishmeal Was Replaced by Low-Gossypol Cottonseed Meal in Golden Pompano (Trachinotus ovatus) (2021) (4)
- Octanoate Alleviates Dietary Soybean Oil-Induced Intestinal Physical Barrier Damage, Oxidative Stress, Inflammatory Response and Microbial Dysbiosis in Large Yellow Croaker (Larimichthys Crocea) (2022) (4)
- SHP1 tyrosine phosphatase gets involved in host defense against Streptococcus agalactiae infection and BCR signaling pathway in Nile tilapia (Oreochromis niloticus). (2020) (4)
- Effects of Clostridium autoethanogenum protein as substitute for dietary fishmeal on the growth, feed utilization, intestinal health and muscle quality of large yellow croaker Larimichthys crocea (2022) (4)
- In vitro study of sodium butyrate on soyasaponin challenged intestinal epithelial cells of turbot (Scophthalmus maximus L.) refer to inflammation, apoptosis and antioxidant enzymes (2021) (4)
- Effects of dietary soybean stachyose and phytic acid on gene expressions of serine proteases in Japanese flounder (Paralichthys olivaceus) (2011) (4)
- Effects of Dietary Mannan Oligosaccharides on Non-Specific Immunity, Intestinal Health, and Antibiotic Resistance Genes in Pacific White Shrimp Litopenaeus vannamei (2021) (4)
- Characterization of difference in muscle volatile compounds between triploid and diploid crucian carp (2021) (4)
- Cloning and characterization of an abalone (Haliotis discus hannai) actin gene (2004) (4)
- Isolation and identification of a bacterium from marine shrimp digestive tract: A new degrader of starch and protein (2011) (4)
- Effects of dietary protein and lipid levels on growth and ovary pig-mentation in Portunus trituberculatus: Effects of dietary protein and lipid levels on growth and ovary pig-mentation in Portunus trituberculatus (2013) (4)
- Effects of soybean oligosaccharides on lipid metabolism of Japanese flounder (Paralichthys olivaceus Temminck et Schlegel) fed animal or plant protein source-based diets (2007) (3)
- Leptin and its receptor in turbot Scophthalmus maximus: cloning, characterization and expression response to ratios of dietary carbohydrate–lipid (2016) (3)
- Influence of dietary biotin levels on growth and non‐specific immune response in large yellow croaker, Larimichthys crocea R (2017) (3)
- FoxO3 Modulates LPS-Activated Hepatic Inflammation in Turbot (Scophthalmus maximus L.) (2021) (3)
- Regulation of Δ6Fads2 Gene Involved in LC-PUFA Biosynthesis Subjected to Fatty Acid in Large Yellow Croaker (Larimichthys crocea) and Rainbow Trout (Oncorhynchus mykiss) (2022) (3)
- LPS stimulation stabilizes HIF‐1α by enhancing HIF‐1α acetylation via the PARP1‐SIRT1 and ACLY‐Tip60 pathways in macrophages (2022) (3)
- Effect of waterborne zinc exposure on lipid deposition and metabolism in hepatopancreas and muscle of grass carp Ctenopharyngodon idella (2016) (3)
- Replacement of dietary kelp meal with three macroalgae sources on the growth performance, immune responses and anti-stress capacity of abalone Haliotis discus hannai (2021) (3)
- Effects of dietary eucommia ulmoides leaf extract on growth performance, expression of feeding-related genes, activities of digestive enzymes, antioxidant capacity, immunity and cytokines expression of large yellow croaker (Larimichthys crocea) larvae (2021) (3)
- Effects of Chitosan-Coated Microdiet on Dietary Physical Properties, Growth Performance, Digestive Enzyme Activities, Antioxidant Capacity, and Inflammation Response of Large Yellow Croaker (Larimichthys crocea) Larvae (2022) (3)
- Effects of dietary supplementation of astaxanthin (Ast) on growth performance, activities of digestive enzymes, antioxidant capacity and lipid metabolism of large yellow croaker ( Larimichthys crocea ) larvae (2022) (3)
- Adiponectin’s roles in lipid and glucose metabolism modulation in fish: Mechanisms and perspectives (2021) (3)
- Apoptosis of cancer cells is triggered by selective crosslinking and inhibition of receptor tyrosine kinases (2019) (3)
- Protective effects of dietary selenium on abalone Haliotis discus hannai against the toxicity of waterborne cadmium (2018) (3)
- Interactions of dietary carbohydrate and vitamin D3 on growth performance, insulin signaling pathway and glucose metabolism in juvenile abalone Haliotis discus hannai (2021) (3)
- Apoptosis of cancer cells is triggered by selective crosslinking and inhibition of receptor tyrosine kinases (2019) (3)
- Replacement of fishmeal by yellow mealworm meal on the growth performance, feed utilisation and quality of large yellow croaker (2022) (3)
- Effects of Dietary Carbohydrate‐to‐lipid Ratio on Growth Performance, Body Composition, Digestive Enzyme Activities, and Hepatic Enzyme Activities in Juvenile Large Yellow Croaker, Larimichthys crocea (2016) (3)
- Stachyose protects intestinal mucosal barrier via promotion of tight junction and Lactobacillus casei-drived inhibition of apoptosis in juvenile turbot, Scophthalmus maximus L. (2022) (3)
- Dietary supplementation of stachyose and Lactobacillus casei improves the immunity and intestinal health of turbot ( Scophthalmus maximus . L) (2021) (3)
- Effects of dietary carbohydrates sources on lipids compositions in abalone, Haliotis discus hannai Ino (2009) (3)
- Replacement of dietary fishmeal by cottonseed protein concentrate on growth performance, feed utilization and protein metabolism of large yellow croaker Larimichthys crocea (2022) (3)
- Activation of Autophagy Relieves Linoleic Acid-Induced Inflammation in Large Yellow Croaker (Larimichthys crocea) (2021) (3)
- Effects of Dietary Lipid Levels on Growth, Digestive Enzyme Activities, Antioxidant Capacity, and Lipid Metabolism in Turbot (Scophthalmus maximus L.) at Three Different Stages (2022) (3)
- Effects of dietary lysolecithin on growth performance, serum biochemical indexes, antioxidant capacity, lipid metabolism and inflammation-related genes expression of juvenile large yellow croaker (Larimichthys crocea). (2022) (3)
- Corrigendum to “Effects of dietary Astragalus polysaccharides (APS) on survival, growth performance, activities of digestive enzyme, antioxidant responses and intestinal development of large yellow croaker (Larimichthys crocea) larvae” [Aquaculture, Volume 517, 734752] (2020) (2)
- INFLUENCE OF PRACTICAL DIET SUPPLEMENTATION WITH FREE D-METHIONINE ON THE GROWTH AND BODY COMPOSITION IN TILAPIA OREOCHROMIS NILOTICUS×O.AUREUS : INFLUENCE OF PRACTICAL DIET SUPPLEMENTATION WITH FREE D-METHIONINE ON THE GROWTH AND BODY COMPOSITION IN TILAPIA OREOCHROMIS NILOTICUS×O.AUREUS (2009) (2)
- Lysophosphatidylcholine acyltransferase 3 (LPCAT3) mediates palmitate-induced inflammation in macrophages of large yellow croaker (Larimichthys crocea). (2022) (2)
- Effects of dietary methionine on growth and body composition, indicators of digestion, protein metabolism and immunity, and resistance to heat stress of abalone Haliotis discus hannai (2022) (2)
- POTENTIAL RISKS OF HIGH LEVEL REPLACEMENT OF DIETARY FISH MEAL BY CANOLA MEAL ON LARGE YELLOW CROAKER LARIMICHTHYS CROCEA (RICHARDSON, 1846): GROWTH, HEALTH AND NUTRITIONAL VALUES AS A FOOD FISH (2017) (2)
- Supplementation of Yeast Extract to Practical Diet Improves the Growth, Anti-Oxidative Capacity and Intestinal Morphology of Shrimp Litopenaeus vannamei (2019) (2)
- The Open Access Israeli Journal of Aquaculture – Bamidgeh (2014) (2)
- The Assessment of Dietary Organic Zinc on Zinc Homeostasis, Antioxidant Capacity, Immune Response, Glycolysis and Intestinal Microbiota in White Shrimp (Litopenaeus vannamei Boone, 1931) (2022) (2)
- Characterization of Caspase8 and its role in the regulation of apoptosis-related genes in large yellow croaker (Larimichthys crocea) (2021) (2)
- Fucoidan Improves Growth, Digestive Tract Maturation, and Gut Microbiota in Large Yellow Croaker (Larimichthys crocea) Larvae (2022) (2)
- Suppression of cideb under endoplasmic reticulum stress exacerbated hepatic inflammation by inducing hepatic steatosis and oxidative stress. (2022) (2)
- LPS Stimulation Induces Small Heterodimer Partner Expression Through the AMPK-NRF2 Pathway in Large Yellow Croaker (Larimichthys crocea) (2021) (2)
- Dietary guaiacol improves the growth of juvenile abalone, Haliotis discus hannai Ino (2009) (2)
- Shell microstructure, mineralogy and in vitro crystallization studies on the shell soluble matrix of abalone, Haliotis discus hannai Ino (2004) (2)
- Fish nutrition—history and perspectives (2022) (2)
- Effects of dietary arginine and lysine on growth and non-specific immune responses of juvenile darkbarbel catfish( Pelteobagrus vachelli ): Effects of dietary arginine and lysine on growth and non-specific immune responses of juvenile darkbarbel catfish( Pelteobagrus vachelli ) (2012) (2)
- Vitamin D3 deficiency induced intestinal inflammatory response of turbot through nuclear factor-κB/inflammasome pathway, accompanied by the mutually exclusive apoptosis and autophagy (2022) (2)
- Dietary lysine level affects digestive enzyme, amino acid transport and hepatic intermediary metabolism in turbot (Scophthalmus maximus) (2022) (2)
- Additional supplementation of sulfur-containing amino acids in the diets improves the intestinal health of turbot fed high-lipid diets. (2022) (2)
- TAT improves in vitro transportation of fortilin through midgut and into hemocytes of white shrimp Litopenaeus vannamei (2012) (2)
- Molecular cloning of AKT1 and AKT2 and their divergent responses to insulin and glucose at transcriptional level in the liver of Japanese flounder Paralichthys olivaceus (2022) (2)
- Proteomics analysis of skin coloration of large yellow croaker Larimichthys crocea fed different dietary carotenoids (2020) (2)
- Muscle Nutritive Metabolism Changes after Dietary Fishmeal Replaced by Cottonseed Meal in Golden Pompano (Trachinotus ovatus) (2022) (2)
- Palmitic acid induces intestinal lipid metabolism disorder, endoplasmic reticulum stress and inflammation by affecting phosphatidylethanolamine content in large yellow croaker Larimichthys crocea (2022) (2)
- Effects of Fish Meal Replaced by Maggot Culture on Growth Performance, Body Composition, and Antioxidant Responses of Hybrid Tilapia (Oreochromis niloticus × O. aureus) (2019) (2)
- Effects of different microbes on fermenting feed for sea cucumber (Apostichopus japonicus) (2015) (2)
- Functions of Forkhead Box O on Glucose Metabolism in Abalone Haliotis discus hannai and Its Responses to High Levels of Dietary Lipid (2021) (2)
- Effects of fishmeal substitution by four fermented soybean meals on growth， antioxidant capacity and immune responses of turbot juveniles (Scophthalmus maximus L.) (2022) (2)
- Fatty acid composition and total lipid content of 33 strains in the genus Cylindrotheca (1999) (2)
- Optimal dietary protein to energy ratio for juvenile peanut worm Sipunculus nudus Linnaeus (2015) (2)
- Artificial intelligence–based method for the rapid detection of fish parasites (Ichthyophthirius multifiliis, Gyrodactylus kobayashii, and Argulus japonicus) (2022) (2)
- Vitamin D regulates insulin pathway and glucose metabolism in zebrafish (Danio rerio) (2022) (2)
- GSK-3β participates in the regulation of hepatic lipid deposition in large yellow croaker (Larmichthys crocea) (2015) (2)
- Efficacy of crystalline methionine and microencapsulation methionine in diets for Pacific white shrimpLitopenaeus vannamei (2020) (2)
- Effects of enzymatic hydrolysis chicken by‐product in high plant‐based protein diet on growth performance, digestive capacity, antioxidant capacity and non‐specific immunity of juvenile turbot ( Scophthalmus maximus L.) (2021) (2)
- Molecular Cloning , Characterization , and Nutritional Regulation of Elovl 6 in Large Yellow Croaker ( Larimichthys crocea ) (2019) (2)
- Vitamin D impacts on the intestinal health, immune status and metabolism in turbot (Scophthalmus maximus L.) (2022) (2)
- Protein and amino acids (2022) (2)
- Lysine supplemented to poultry by‐product meal replacement diet modulates body growth, metabolism and related gene expressions of hybrid sturgeon ( Acipenser schrenckii ♀ × Acipenser baerii ♂ ) (2021) (2)
- Alleviation effect of dietary cerium and its complex with chitosan oligosaccharide on cadmium accumulation in juvenile turbot, Scophthalmus maximus L., under cadmium stress (2016) (2)
- High dietary lipid level decreases the immunity and disease resistance of abalone Haliotis discus hannai and affects the perilipin‐2/TLR4, JNK and Keap1/Nrf2 pathways (2021) (2)
- Effects of dietary inorganic salts supplementation on growth performance, bone mineral deposition, intestinal morphology and immune response of turbot juveniles ( Scophthalmus maximus L.) in fermented soybean meal‐based diets (2021) (2)
- Fishmeal substitution with low-gossypol cottonseed meal in the diet for juvenile turbot (Scophthalmus maximus L.): Effects on growth, nutrients utilization and haematological responses (2022) (2)
- Evaluation of the mitigation efficacy of a yeast cell wall extract toward deoxynivalenol contaminated diet fed to turbot (Scophthalmus maximus). (2021) (1)
- Effects of fecal bacteria on growth, digestive capacity, antioxidant capacity, intestinal health of large yellow croaker (Larimichthys crocea) larvae (2022) (1)
- EVALUATION OF MICRODIETS AND FROZEN COPEPODS ON DIGESTIVE ENZYME ACTIVITIES, INTESTINAL AND LIVER MICROSTRUCTURES OF LARGE YELLOW CROAKER (PSEUDOSCIAENA CROCEA R.) LARVAE: EVALUATION OF MICRODIETS AND FROZEN COPEPODS ON DIGESTIVE ENZYME ACTIVITIES, INTESTINAL AND LIVER MICROSTRUCTURES OF LARGE YELLO (2013) (1)
- Slc38a9 Deficiency Induces Apoptosis and Metabolic Dysregulation and Leads to Premature Death in Zebrafish (2022) (1)
- Replacement of fishmeal with Shewanella sp. MR‐7 fermented soya bean meal in Pacific white shrimp (2020) (1)
- Effects of dietary arginine on growth, activity of digestive enzymes, GCN2‐ATF4 signalling pathway and nutritional metabolism‐related gene expression of large yellow croaker ( Larimichthys crocea ) larvae (2021) (1)
- Long-chain fatty acids regulate SIRT3 expression by affecting intracellular NAD+ levels in large yellow croaker (Larimichthys crocea) (2022) (1)
- Vitamin D3 enhances the antibacterial ability in head-kidney macrophages of turbot (Scophthalmus maximus L.) through C-type lectin receptors. (2022) (1)
- Effects of dietary organic trace mineral mixture levels on survival, growth performance, body composition and antioxidant capacity of juvenile turbot ( Scophthalmus maximus ) (2020) (1)
- Molecular cloning and functional characterization of a putative Elovl4 gene and its expression in response to dietary fatty acid profiles in orange-spotted grouper Epinephelus coioides. Aquac (2017) (1)
- Effects of recombinant anti-lipopolysaccharide factor expressed by Pichia pastoris on the growth performance, immune response and disease resistance of Litopenaeusvannamei. (2022) (1)
- Effects of Dietary Carbohydrates with Different Molecular Complexity on Growth Performance, Feed Utilization, and Metabolic Responses of Juvenile Turbot Scophthalmus maximus (2016) (1)
- Docosahexaenoic Acid Ameliorates the Toll-Like Receptor 22-Triggered Inflammation in Fish by Disrupting Lipid Raft Formation. (2022) (1)
- Effects of Glycyrrhizin (GL) Supplementation on Survival, Growth Performance, Expression of Feeding-Related Genes, Activities of Digestive Enzymes, Antioxidant Capacity, and Expression of Inflammatory Factors in Large Yellow Croaker (Larimichthys crocea) Larvae (2022) (1)
- The regulation of fenofibrate on lipid metabolism in obscure puffer ( Takifugu obscurus ) is dependent on dietary lipid content (2021) (1)
- Response of Intestinal Microbiota of Tiger Puffer (Takifugu rubripes) to the Fish Oil Finishing Strategy (2023) (1)
- Effects of Dietary Vegetable Oils Replacing Fish Oil on Fatty Acid Composition, Lipid Metabolism and Inflammatory Response in Adipose Tissue of Large Yellow Croaker (Larimichthys crocea) (2022) (1)
- Arginine Regulates TOR Signaling Pathway through SLC38A9 in Abalone Haliotis discus hannai (2021) (1)
- Effects of Lysophosphatidylcholine on Intestinal Health of Turbot Fed High-Lipid Diets (2022) (1)
- Effects of replacing dietary fish meal with enzyme-treated soybean meal on growth performance, intestinal microbiota, immunity and mTOR pathway in abalone Haliotis discus hannai. (2022) (1)
- Effects of phosphatidic acid on growth and antioxidant capacity in juvenile turbot, Scophthalmus maxius L., fed with high plant protein‐based diets (2021) (1)
- Long noncoding RNA LTCONS_00091578 associated with adipose triglyceride lipase (ATGL) regulates hepatic lipolysis in rainbow trout (2022) (1)
- Oleic and palmitic acids induce hepatic angiopoietin-like 4 expression predominantly via PPAR-γ in Larimichthys crocea (2021) (1)
- Effect of Dietary Carbohydrate Levels on Growth Performance , Body Composition and Apparent Digestibility Coefficients in Cobia Rachycentron canadum L , at Two Different Growth Stages (2015) (1)
- Dietary l-carnitine regulates liver lipid metabolism via simultaneously activating fatty acid β-oxidation and suppressing endoplasmic reticulum stress in large yellow croaker fed with high-fat diets (2022) (1)
- Effects of dietary protein levels on growth performance, digestibility, anti‐oxidative responses and expressions of growth‐related genes in triploid rainbow trout Oncorhynchus mykiss farmed in seawater (2021) (1)
- Comparation of oxylipin profiles as well as their substrates and synthetic enzymes transcriptional expression between marine fish Larimichthys crocea and freshwater fish Oncorhynchus mykiss (2021) (1)
- Interactions of dietary eicosapentaenoic acid and vitamin C on growth performance, anti-oxidation and muscle quality of abalone Haliotis discus hannai Ino (2022) (1)
- Effects of dietary glucose and dextrin on activity and gene expression of glucokinase and fructose-1,6-bisphosphatase in liver of turbot Scophthalmus maximus (2015) (1)
- Effect of Partial Substitution of Fish Meal with Sunflower Meal on Feed Utilization, Intestinal Digestive Enzyme, Hematological Indexes, Intestinal, and Liver Morphology on Juvenile Turbot (Scophthal musmaximus L.) (2016) (1)
- Chromium polynicotinate inclusion in the diet affects growth, feed utilization, and chromium retention in Japanese seabass Lateolabrax japonicas fed a low protein starch-based diet (2022) (1)
- Effects of supplemental glycerol monolaurate on growth, hepatic lipid metabolism, antioxidant capacity and mitochondrial function of large yellow croaker (Larimichthys crocea) fed diets with high soybean oil level (2022) (1)
- Effects of probiotics from the shrimp intestine on the non-specific immunity and antiviral capacity of Litopenaeus vannamei: Effects of probiotics from the shrimp intestine on the non-specific immunity and antiviral capacity of Litopenaeus vannamei (2013) (1)
- Beneficial effects of phytase and/or protease on growth performance, digestive ability, immune response and muscle amino acid profile in low phosphorus and/or low fish meal gibel carp (Carassius auratus gibelio) diets (2022) (1)
- Ontogeny and kinetics of carnitine palmitoyltransferase I in hepatopancreas and skeletal muscle of grass carp (Ctenopharyngodon idella) (2015) (1)
- Ontogenic development of digestive enzyme activities in juvenile soft-shelled turtle (Pelodiscus sinensis) under cultured conditions (2011) (1)
- Dietary Olive and Perilla Oils Affect Liver Mitochondrial DNA Methylation in the Large (2015) (1)
- Corrigendum: Effects of dietary mannan oligosaccharides on non-specific immunity, intestinal health, and antibiotic resistance genes in Pacific White Shrimp Litopenaeus vannamei (2022) (0)
- Interaction between dietary lipid and bile acids on the growth performance and lipid metabolism in abalone Haliotis discus hannai Ino (2023) (0)
- Calcium pyruvate attenuates fat deposition by augmenting fatty acid oxidation and inhibiting glucose oxidation in juvenile large yellow croaker (Larimichthys crocea) consuming a high-fat diet (2022) (0)
- ω-6 Polyunsaturated fatty acids (linoleic acid) activate both autophagy and antioxidation in a synergistic feedback loop via TOR-dependent and TOR-independent signaling pathways (2020) (0)
- Effects of supplemental octanoate on hepatic lipid metabolism, serum biochemical indexes, antioxidant capacity and inflammation-related genes expression of large yellow croaker (Larimichthys crocea) fed with high soybean oil diet (2023) (0)
- Functional characterization and differential nutritional regulation of putative Elovl5 and Elovl4 elongases in large yellow croaker (Larimichthys crocea) (2017) (0)
- Role of acyl-coenzyme A oxidase 1 (ACOX1) on palmitate-induced inflammation and ROS production of macrophages in large yellow croaker (Larimichthys crocea). (2022) (0)
- Feed Developments in Mariculture (2018) (0)
- Optimal dietary protein to energy ratio for juvenile peanut worm Sipunculus nudus Linnaeus (2015) (0)
- Effects of Supplementation of Ferulic Acid (FA) on Growth Performance, Activities of Digestive Enzymes, Antioxidant Capacity and Lipid Metabolism of Large Yellow Croaker (Larimichthys crocea) Larvae (2022) (0)
- Contributors (2022) (0)
- Effects of dietary tributyrin supplementation on the growth performance, serum biochemistry, antioxidant capability and intestinal morphology and structure of golden pompano ( Trachinotus ovatus ) (2022) (0)
- Dietary choline can partially spare methionine to improve the feeds utilization and immune response in juvenile largemouth bass (Micropterus salmoides): Based on phenotypic response to gene expression (2023) (0)
- The protective role of daidzein in intestinal health of turbot (Scophthalmus maximus L.) fed soybean meal-based diets (2021) (0)
- Short-Term Alternate Feeding between Terrestrially Sourced Oil- and Fish Oil-Based Diets Modulates the Intestinal Microecology of Juvenile Turbot (2023) (0)
- Comparative evaluation on the effects of dietary docosahexaenoic acid on growth performance, fatty acid profile and lipid metabolism in two sizes of abalone Haliotis discus hannai Ino (2022) (0)
- Long noncoding RNA lincsc5d regulates hepatic cholesterol synthesis by modulating sterol C5 desaturase in large yellow croaker. (2022) (0)
- Nutrient sensing for the future of land animal and aquaculture nutrition (2022) (0)
- Nutritional programming of large yellow croaker (Larimichthys crocea) larvae by dietary vegetable oil: effects on growth performance, lipid metabolism and antioxidant capacity (2022) (0)
- Dietary phospholipids improve growth performance and change the lipid composition and volatile flavor compound profiles in the muscle of abalone Haliotis discus hannai by affecting the glycerophospholipid metabolism (2023) (0)
- Comparative analysis of glucose metabolism responses of large yellow croaker Larimichthys crocea fed diet with fish oil and palm oil (2019) (0)
- Leucine promotes protein synthesis of juvenile white shrimp Litopenaeus vannamei through TOR signaling pathway (2022) (0)
- Effects of supplemental fulvic acid on survival, growth performance, digestive ability and immunity of large yellow croaker (Larimichthys crocea) larvae (2023) (0)
- Effects of Dietary Soy Protein Concentrate on Growth Performance, Digestion, and Protein Metabolism of Juvenile Darkbarbel Catfish Pelteobagrus vachelli (2014) (0)
- Leptin and its receptor in turbot Scophthalmus maximus: cloning, characterization and expression response to ratios of dietary carbohydrate–lipid (2016) (0)
- Effects of postprandial starvation on mRNA expression of endocrine-, amino acid and peptide transporter-, and metabolic enzyme-related genes in zebrafish (Danio rerio) (2015) (0)
- Sodium acetate alleviates adverse effects caused by the diet with high proportion of soybean meal in turbot (Scophthalmus maximus L.) (2022) (0)
- Effects of DGAT1 inhibition on hepatic lipid deposition, antioxidant capacity and inflammatory response in Larimichthys crocea (2021) (0)
- Molecular cloning and functional characterization of arachidonate 5-lipoxygenase (Alox5), and its expression in response to the ratio of linolenic acid to linoleic acid in diets of large yellow croaker (Larmichthys crocea) Part B Biochemistry & molecular biology (2016) (0)
- Transcription factor EB (TFEB) participates in antiviral immune responses independent of mTORC1 in macrophage of large yellow croaker (Larimichthys crocea). (2023) (0)
- Biotin alleviates hepatic and intestinal inflammation and apoptosis induced by high dietary carbohydrate in juvenile turbot (Scophthalmus maximus L.). (2022) (0)
- Comparision of nitrogen removal characteristic and microbial community in freshwater and marine recirculating aquaculture systems. (2023) (0)
- Tragacanth Gum and Linseed Gum as Adhesives Improved the Survival, Digestive Function, Antioxidant Enzyme Activities, and Immunity in Large Yellow Croaker (Larimichthys crocea) Larvae (2023) (0)
- Vitamin D influences gut microbiota and acetate production in zebrafish (Danio rerio) to promote intestinal immunity against invading pathogens (2023) (0)
- Evaluation of the effects of dietary mycotoxin-degrading adsorbent on juvenile turbot (Scophthalmus maximus L.) fed aflatoxin B1-contaminated diets (2023) (0)
- Effects of supplemental ferulic acid (FA) on survival, growth performance, digestive enzyme activities, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea) larvae. (2022) (0)
- The Effects of Sodium Propionate Supplementation in the Diet with High Soybean Meal on Growth Performance, Intestinal Health, and Immune Resistance to Bacterial Infection in Turbot (Scophthalmus maximus L.) (2022) (0)
- In vivo DNA methylation editing in zebrafish (2023) (0)
- A negative feedback mechanism in the insulin-regulated glucose homeostasis in Japanese flounder Paralichthys olivaceus by two ways of glucose administration (2017) (0)
- Effect of NaHCO_(3) concentration on growth of Isochrysis galbana 3011 strain, Tahitian I.galbana strain and Pavlova viridis (2001) (0)
- Chronic stress of high dietary carbohydrate level causes inflammation and influences glucose transport through SOCS3 in Japanese flounder Paralichthys olivaceus (2018) (0)
- Dietary lysine level affects digestive enzyme, amino acid transport and hepatic intermediary metabolism in turbot (Scophthalmus maximus) (2022) (0)
- Effects of different dietary lipid sources on growth performance, hepatic lipid deposition and transcriptome response in spotted sea bass (Lateolabrax maculatus) (2022) (0)
- Fishmeal Protein Replacement by Defatted and Full-Fat Black Soldier Fly Larvae Meal in Juvenile Turbot Diet: Effects on the Growth Performance and Intestinal Microbiota (2023) (0)
- Effects of nucleotides on growth performance, immune response, disease resistance and intestinal morphology in shrimp Litopenaeus vannamei fed with a low fish meal diet (2015) (0)
- Nutrient sensing signaling and metabolic responses in shrimp Litopenaeus vannamei under acute ammonia stress. (2023) (0)
- Establishment and characterization of a fibroblast-like cell line from the muscle of turbot (Scophthalmus maximus L.) (2019) (0)
- Wnt/β-catenin signaling participates in the regulation of lipogenesis in the liver of juvenile turbot (Scophthalmus maximus L.) Part B Biochemistry & molecular biology (2016) (0)
- Effects of replacing fish meal with rubber seed meal on growth, nutrient utilization, and cholesterol metabolism of tilapia (Oreochromis niloticus × O. aureus) (2017) (0)
- Activation of farnesoid X receptor suppresses ER stress and inflammation via the YY1/NCK1/PERK pathway in large yellow croaker (Larimichthys crocea) (2022) (0)
- Replacement of Dietary Fishmeal Protein with Degossypolized Cottonseed Protein on Growth Performance, Nonspecific Immune Response, Antioxidant Capacity, and Target of Rapamycin Pathway of Juvenile Large Yellow Croaker (Larimichthys crocea) (2022) (0)
- Effects of dietary tert-butylhydroquinone on domoic acid metabolism and transcription of detoxification-related liver genes in red sea bream Pagrus major (2013) (0)
- CTCCACTGCT TATGGCGGCTGAGGAAG TCAAACTGTGG GTGCCAACCTGGATGAGC TATGGCAACGA GGTCACTGGCATTGGTCAC GATCCACGAAGCC TGGTCTTTCCAGTGAGTATGAGCC GTTATGCCCTGCC TGAAGGAGTAACCGCGCTCTGT GGACGCACACTG GCAGACGGGCATAGCACTTG AGCCTAACAT TACCTCCAGACAGCACGG CCATAGCCCACA GTGGCTGGCACGAGTTTGA AGCCTTCATT GCGATGAATAGGGAAAGCA GGTG (2015) (0)
- Effects of supplemental mixed bile acids on growth performance, body composition, digestive enzyme activities, skin color, and flesh quality of juvenile large yellow croaker (Larimichthys crocea) in soybean oil based diet (2023) (0)
- Vitamins (2022) (0)
- Dietary xanthophyll improved growth, antioxidant, pigmentation and meat quality in the southern catfish (Silurus soldatovi meridionalis Chen) (2022) (0)
- Development of a Whole Organism Platform for Phenotype-Based Analysis of IGF1R-PI3K-Akt-Tor Action (2017) (0)
- Butyrate-induced IL-22 expression in fish macrophages contributes to bacterial clearance. (2023) (0)
- Comparative analysis of nutritional and transcriptional regulation of hacd1 in large yellow croaker (Larimichthys crocea) and rainbow trout (Oncorhynchus mykiss). (2023) (0)
- Effects of GRP78 on Endoplasmic Reticulum Stress and Inflammatory Response in Macrophages of Large Yellow Croaker (Larimichthys crocea) (2023) (0)
- Nutrient Requirements Abalone (2001) (0)
- Organic copper promoted copper accumulation and transport, enhanced low temperature tolerance and physiological health of white shrimp (Litopenaeus vannamei Boone, 1931). (2022) (0)
- Interactions between dietary protein level and water temperature on the growth performance, innate immunity and disease resistance of juvenile abalone Haliotis discus hannai Ino (2023) (0)
- Taurine alleviates endoplasmic reticulum stress, inflammatory cytokine expression and mitochondrial oxidative stress induced by high glucose in the muscle cells of olive flounder (Paralichthysolivaceus). (2022) (0)
- Vitamin D impacts on the intestinal health, immune status and metabolism in turbot (Scophthalmus maximus L.) – CORRIGENDUM (2022) (0)
- Nutritional Regulation and the Different Transcriptional Regulation Mechanisms of the 3-Hydroxyacyl-Coa Dehydratases 1(Hacd1)Between Large Yellow Croaker (Larimichthys Crocea) and Rainbow Trout (Oncorhynchus Mykiss) (2023) (0)
- Optimal dietary methionine requirement of sub-adult turbot (Scophthalmus maximus L.): Growth performance, feed utilization and hepatic lipid metabolism (2022) (0)
- Corrigendum to “Characterization of difference in muscle volatile compounds between triploid and diploid crucian carp” [Aquacult. Rep. 20 (July) (2021) 100641] (2021) (0)
- Lipid and fatty acid compositions of cod ( Gadus morhua ), haddock ( Melanogrammus aeglefinus (2010) (0)
- The Fish Microbiota: Research Progress and Potential Applications (2023) (0)
- Influences of replacing dietary fish meal by Antarctic krill meal on growth performance, immunity and muscle quality of white shrimp Litopenaeus vannamei (2022) (0)
- Effects of fishmeal substitution by α-galactosidase hydrolytic soybean meal (EhSBM) on growth, antioxidant capacity, inflammatory responses and intestinal health of turbot juveniles (Scophthalmus maximus L.) (2022) (0)
- Effects of Tributyrin Supplementation on Growth Performance, Intestinal Digestive Enzyme Activity, Antioxidant Capacity, and Inflammation-Related Gene Expression of Large Yellow Croaker (Larimichthys crocea) Fed with a High Level of Clostridium autoethanogenum Protein (2023) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Kang-sen Mai?
Kang-sen Mai is affiliated with the following schools:
