Keiko Ozato
#109,413
Most Influential Person Now
Researcher
Keiko Ozato's AcademicInfluence.com Rankings
Keiko Ozatobiology Degrees
Biology
#5961
World Rank
#8570
Historical Rank
Cell Biology
#171
World Rank
#178
Historical Rank
Molecular Biology
#585
World Rank
#599
Historical Rank
Genetics
#554
World Rank
#631
Historical Rank

Download Badge
Biology
Keiko Ozato's Degrees
- PhD Molecular Biology University of Tokyo
- Masters Biochemistry Kyoto University
- Bachelors Biology Osaka University
Similar Degrees You Can Earn
Why Is Keiko Ozato Influential?
(Suggest an Edit or Addition)Keiko Ozato's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- The bromodomain protein Brd4 is a positive regulatory component of P-TEFb and stimulates RNA polymerase II-dependent transcription. (2005) (1107)
- Recruitment of P-TEFb for stimulation of transcriptional elongation by the bromodomain protein Brd4. (2005) (1008)
- A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo (1990) (980)
- Fatty acids and retinoids control lipid metabolism through activation of peroxisome proliferator-activated receptor-retinoid X receptor heterodimers. (1993) (936)
- TRIM family proteins and their emerging roles in innate immunity (2008) (919)
- Hybridoma cell lines secreting monoclonal antibodies to mouse H-2 and Ia antigens. (1980) (823)
- Immunodeficiency and Chronic Myelogenous Leukemia-like Syndrome in Mice with a Targeted Mutation of the ICSBP Gene (1996) (697)
- The double bromodomain protein Brd4 binds to acetylated chromatin during interphase and mitosis (2003) (620)
- Monoclonal antibodies to mouse MHC antigens. III. Hybridoma antibodies reacting to antigens of the H-2b haplotype reveal genetic control of isotype expression. (1981) (558)
- Global Nature of Dynamic Protein-Chromatin Interactions In Vivo: Three-Dimensional Genome Scanning and Dynamic Interaction Networks of Chromatin Proteins (2004) (472)
- Brd4 Coactivates Transcriptional Activation of NF-κB via Specific Binding to Acetylated RelA (2008) (456)
- Displacement of sequence-specific transcription factors from mitotic chromatin (1995) (441)
- IFN Regulatory Factor-4 and -8 Govern Dendritic Cell Subset Development and Their Functional Diversity (2005) (439)
- Interaction of the Bovine Papillomavirus E2 Protein with Brd4 Tethers the Viral DNA to Host Mitotic Chromosomes (2004) (434)
- MONOCLONAL ANTIBODIES TO MOUSE MAJOR HISTOCOMPATIBILITY COMPLEX ANTIGENS: IV. A SERIES OF HYBRIDOMA CLONES PRODUCING ANTI‐H-2d ANTIBODIES AND AN EXAMINATION OF EXPRESSION OF H‐2d ANTIGENS ON THE SURFACE OF THESE CELLS (1982) (431)
- H‐2RIIBP (RXR beta) heterodimerization provides a mechanism for combinatorial diversity in the regulation of retinoic acid and thyroid hormone responsive genes. (1992) (408)
- The histone acetylase PCAF is a nuclear receptor coactivator. (1998) (407)
- Selective recognition of acetylated histones by bromodomain proteins visualized in living cells. (2004) (358)
- Essential role for ICSBP in the in vivo development of murine CD8alpha + dendritic cells. (2003) (354)
- Analysis of interleukin-21-induced Prdm1 gene regulation reveals functional cooperation of STAT3 and IRF4 transcription factors. (2009) (344)
- ICSBP directs bipotential myeloid progenitor cells to differentiate into mature macrophages. (2000) (340)
- Muramyl dipeptide activation of nucleotide-binding oligomerization domain 2 protects mice from experimental colitis. (2008) (334)
- An interferon gamma-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes. (1990) (333)
- Mechanistic Link between PKR Dimerization, Autophosphorylation, and eIF2α Substrate Recognition (2005) (327)
- BRD4 is an atypical kinase that phosphorylates Serine2 of the RNA Polymerase II carboxy-terminal domain (2012) (319)
- Neurophysin in the hypothalamo-neurohypophysial system. I. Production and characterization of monoclonal antibodies (1985) (317)
- Monoclonal antibodies to mouse MHC antigens. II. Antibodies to the H-2Ld antigen, the products of a third polymorphic locus of the mouse major histocompatibility complex. (1980) (305)
- A Bromodomain Protein, MCAP, Associates with Mitotic Chromosomes and Affects G2-to-M Transition (2000) (291)
- Brd4 marks select genes on mitotic chromatin and directs postmitotic transcription. (2009) (284)
- Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1,25-dihydroxyvitamin D3-activated expression of the rat osteocalcin gene (1993) (266)
- H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element. (1989) (260)
- Cutting Edge: IFN Consensus Sequence Binding Protein/IFN Regulatory Factor 8 Drives the Development of Type I IFN-Producing Plasmacytoid Dendritic Cells 1 (2003) (259)
- Interferon regulatory factor-8 regulates bone metabolism by suppressing osteoclastogenesis (2009) (257)
- Interferon Consensus Sequence Binding Protein–deficient Mice Display Impaired Resistance to Intracellular Infection Due to a Primary Defect in Interleukin 12 p40 Induction (1997) (256)
- Cloning of a negative transcription factor that binds to the upstream conserved region of Moloney murine leukemia virus (1992) (245)
- BRD4 is a Histone Acetyltransferase that Evicts Nucleosomes from Chromatin (2016) (242)
- BRD4 assists elongation of both coding and enhancer RNAs by interacting with acetylated histones (2014) (240)
- Distinct but overlapping roles of histone acetylase PCAF and of the closely related PCAF-B/GCN5 in mouse embryogenesis. (2000) (234)
- Induction of MHC class I expression by the MHC class II transactivator CIITA. (1997) (232)
- IRF8 Is a Critical Transcription Factor for Transforming Microglia into a Reactive Phenotype (2012) (226)
- Ebola Zaire Virus Blocks Type I Interferon Production by Exploiting the Host SUMO Modification Machinery (2009) (224)
- An IFN-γ-Inducible Transcription Factor, IFN Consensus Sequence Binding Protein (ICSBP), Stimulates IL-12 p40 Expression in Macrophages (2000) (223)
- Notch-RBP-J Signaling Regulates IRF8 to Promote Inflammatory Macrophage Polarization (2012) (220)
- Exon shuffling: mapping polymorphic determinants on hybrid mouse transplantation antigens (1982) (217)
- Neurophysin in the hypothalamo-neurohypophysial system. II. Immunocytochemical studies of the ontogeny of oxytocinergic and vasopressinergic neurons (1985) (216)
- ICSBP/IRF-8: its regulatory roles in the development of myeloid cells. (2002) (214)
- The Bromodomain Protein Brd4 Stimulates G1 Gene Transcription and Promotes Progression to S Phase* (2008) (213)
- Cutting Edge: Autoantigen Ro52 Is an Interferon Inducible E3 Ligase That Ubiquitinates IRF-8 and Enhances Cytokine Expression in Macrophages1 (2007) (212)
- Essential role of the IRF8-KLF4 transcription factor cascade in murine monocyte differentiation. (2013) (202)
- Modulation of retinoid signalling through NGF-induced nuclear export of NGFI-B (2000) (201)
- Interferon consensus sequence-binding protein, a member of the interferon regulatory factor family, suppresses interferon-induced gene transcription (1993) (200)
- The Interferon Regulatory Factor Family in Host Defense: Mechanism of Action* (2007) (198)
- Transcription factor TFIIB and the vitamin D receptor cooperatively activate ligand-dependent transcription. (1995) (196)
- Kaposi’s Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor (1998) (195)
- The feedback phase of type I interferon induction in dendritic cells requires interferon regulatory factor 8. (2007) (192)
- The BXH2 mutation in IRF8 differentially impairs dendritic cell subset development in the mouse. (2008) (186)
- Toll-like receptor signaling and regulation of cytokine gene expression in the immune system. (2002) (181)
- Binding of Double-stranded RNA to Protein Kinase PKR Is Required for Dimerization and Promotes Critical Autophosphorylation Events in the Activation Loop* (2001) (181)
- Phosphorylation Events Modulate the Ability of Interferon Consensus Sequence Binding Protein to Interact with Interferon Regulatory Factors and to Bind DNA* (1997) (181)
- The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGF3 alpha subunit (or similar) molecule binds (1993) (181)
- Bromodomain 4 activation predicts breast cancer survival (2008) (177)
- Retinoid X receptor (RXR) within the RXR-retinoic acid receptor heterodimer binds its ligand and enhances retinoid-dependent gene expression (1997) (175)
- IRF family proteins and type I interferon induction in dendritic cells (2006) (168)
- Trained immunity, tolerance, priming and differentiation: distinct immunological processes (2020) (168)
- Virus Infection Triggers SUMOylation of IRF3 and IRF7, Leading to the Negative Regulation of Type I Interferon Gene Expression* (2008) (166)
- Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducible genes. (1992) (159)
- Structure and expression of a mouse major histocompatibility antigen gene, H-2Ld. (1982) (158)
- Mouse major histocompatibility class I gene expression begins at midsomite stage and is inducible in earlier-stage embryos by interferon. (1985) (157)
- A Mammalian Bromodomain Protein, Brd4, Interacts with Replication Factor C and Inhibits Progression to S Phase (2002) (156)
- Gene Disruption Study Reveals a Nonredundant Role for TRIM21/Ro52 in NF-κB-Dependent Cytokine Expression in Fibroblasts1 (2009) (155)
- Brd4 binds to active enhancers to control cell identity gene induction in adipogenesis and myogenesis (2017) (154)
- BRD4 Coordinates Recruitment of Pause Release Factor P-TEFb and the Pausing Complex NELF/DSIF To Regulate Transcription Elongation of Interferon-Stimulated Genes (2013) (152)
- Altered Memory Capacities and Response to Stress in p300/CBP-Associated Factor (PCAF) Histone Acetylase Knockout Mice (2008) (146)
- Inhibition of p300 Histone Acetyltransferase by Viral Interferon Regulatory Factor (2000) (146)
- Tripartite Motif-Containing Protein 28 Is a Small Ubiquitin-Related Modifier E3 Ligase and Negative Regulator of IFN Regulatory Factor 7 (2011) (146)
- Interferon Regulatory Factor (Irf)-1 and Irf-2 Regulate Interferon γ–Dependent Cyclooxygenase 2 Expression (2000) (146)
- Toll-Like Receptor 9 Signaling Activates NF-κB through IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein in Dendritic Cells1 (2004) (145)
- IRF-8/Interferon (IFN) Consensus Sequence-binding Protein Is Involved in Toll-like Receptor (TLR) Signaling and Contributes to the Cross-talk between TLR and IFN-γ Signaling Pathways* (2006) (145)
- Autocrine amplification of type I interferon gene expression mediated by interferon stimulated gene factor 3 (ISGF3). (1996) (140)
- The Mitotic Chromosome Binding Activity of the Papillomavirus E2 Protein Correlates with Interaction with the Cellular Chromosomal Protein, Brd4 (2005) (137)
- Binding of the ubiquitous nuclear transcription factor YY1 to a cis regulatory sequence in the human LINE-1 transposable element. (1993) (136)
- Immune cell-specific amplification of interferon signaling by the IRF-4/8-PU.1 complex. (2005) (135)
- Identification of target genes and a unique cis element regulated by IRF-8 in developing macrophages. (2005) (134)
- Synergistic Activation of Interleukin-12 p35 Gene Transcription by Interferon Regulatory Factor-1 and Interferon Consensus Sequence-binding Protein* (2004) (132)
- Heterodimerization among thyroid hormone receptor, retinoic acid receptor, retinoid X receptor, chicken ovalbumin upstream promoter transcription factor, and an endogenous liver protein. (1992) (132)
- The alternative Ctf18-Dcc1-Ctf8-replication factor C complex required for sister chromatid cohesion loads proliferating cell nuclear antigen onto DNA (2003) (131)
- An osteopontin/CD44 immune checkpoint controls CD8+ T cell activation and tumor immune evasion (2018) (129)
- Regulation of Apoptosis in Myeloid Cells by Interferon Consensus Sequence–Binding Protein (1999) (129)
- Interferon-induced transcription of a major histocompatibility class I gene accompanies binding of inducible nuclear factors to the interferon consensus sequence. (1988) (128)
- ICSBP/IRF-8 retrovirus transduction rescues dendritic cell development in vitro. (2003) (127)
- NF kappa B and interferon regulatory factor 1 physically interact and synergistically induce major histocompatibility class I gene expression. (1995) (127)
- Expression of IFN regulatory factor family proteins in lymphocytes. Induction of Stat-1 and IFN consensus sequence binding protein expression by T cell activation. (1996) (125)
- Ligand‐induced recruitment of a histone deacetylase in the negative‐feedback regulation of the thyrotropin β gene (1999) (124)
- Interaction of Bovine Papillomavirus E2 Protein with Brd4 Stabilizes Its Association with Chromatin (2005) (122)
- The Histone Acetylase PCAF Is a Phorbol-Ester-Inducible Coactivator of the IRF Family That Confers Enhanced Interferon Responsiveness (1999) (121)
- Transcription factor IRF8 directs a silencing programme for TH17 cell differentiation (2011) (120)
- IRF8 inhibits C/EBPα activity to restrain mononuclear phagocyte progenitors from differentiating into neutrophils (2014) (118)
- Precancerous Stem Cells Have the Potential for both Benign and Malignant Differentiation (2006) (118)
- Expression of ets genes in mouse thymocyte subsets and T cells. (1989) (115)
- A histone deacetylase inhibitor potentiates retinoid receptor action in embryonal carcinoma cells. (1997) (113)
- IRF‐8/ICSBP and IRF‐1 cooperatively stimulate mouse IL‐12 promoter activity in macrophages (2002) (113)
- The transcription factor IRF8 activates integrin-mediated TGF-β signaling and promotes neuroinflammation. (2014) (113)
- Retinoic acid‐mediated down‐regulation of Oct3/4 coincides with the loss of promoter occupancy in vivo. (1996) (113)
- The interaction of monoclonal antibodies with MHC class I antigens on mouse spleen cells. I. Analysis of the mechanism of binding. (1984) (112)
- Regulation of mouse CYP1A1 gene expression by dioxin: requirement of two cis-acting elements during induction (1989) (112)
- TRIM21 Ubiquitylates SQSTM1/p62 and Suppresses Protein Sequestration to Regulate Redox Homeostasis. (2016) (111)
- T cell–derived inducible nitric oxide synthase switches off TH17 cell differentiation (2013) (111)
- Transcription Factors that Regulate Growth and Differentiation of Myeloid Cells (2001) (110)
- Regulation of the mouse alpha A-crystallin gene: isolation of a cDNA encoding a protein that binds to a cis sequence motif shared with the major histocompatibility complex class I gene and other genes (1990) (110)
- Xenopus peroxisome proliferator activated receptors: Genomic organization, response element recognition, heterodimer formation with retinoid X receptor and activation by fatty acids (1993) (109)
- Structural Basis for Acetylated Histone H4 Recognition by the Human BRD2 Bromodomain* (2010) (108)
- Essential requirement for IRF8 and SLC15A4 implicates plasmacytoid dendritic cells in the pathogenesis of lupus (2013) (107)
- Mouse retinoid X receptor contains a separable ligand-binding and transactivation domain in its E region (1995) (106)
- Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor (1997) (105)
- Cooperation of TLR12 and TLR11 in the IRF8-Dependent IL-12 Response to Toxoplasma gondii Profilin (2013) (104)
- The Sequestosome 1/p62 Attenuates Cytokine Gene Expression in Activated Macrophages by Inhibiting IFN Regulatory Factor 8 and TNF Receptor-Associated Factor 6/NF-κB Activity1 (2009) (103)
- Heterologous dimerization domains functionally substitute for the double‐stranded RNA binding domains of the kinase PKR (2001) (102)
- Expression of H-2Dd and H-2Ld mouse major histocompatibility antigen genes in L cells after DNA-mediated gene transfer. (1983) (101)
- The Chromatin-Remodeling BAF Complex Mediates Cellular Antiviral Activities by Promoter Priming (2004) (100)
- A dual cis-regulatory code links IRF8 to constitutive and inducible gene expression in macrophages (2015) (99)
- Regulation of MHC class I and beta 2-microglobulin gene expression in human neuronal cells. Factor binding to conserved cis-acting regulatory sequences correlates with expression of the genes. (1993) (98)
- Cell type‐specific regulation of major histocompatibility complex (MHC) Class I gene expression in astrocytes, oligodendrocytes, and neurons (1993) (96)
- Interaction of Histone Acetylases and Deacetylases In Vivo (2003) (96)
- Interferon stimulation creates chromatin marks and establishes transcriptional memory (2018) (95)
- Interferons increase transcription of a major histocompatibility class I gene via a 5' interferon consensus sequence (1987) (93)
- TRIM21 Ubiquitylates SQSTM1/p62 and Suppresses Protein Sequestration to Regulate Redox Homeostasis. (2016) (93)
- IFN Consensus Sequence Binding Protein/IFN Regulatory Factor-8 Guides Bone Marrow Progenitor Cells Toward the Macrophage Lineage1 (2002) (93)
- Clinical and Pathological Roles of Ro/SSA Autoantibody System (2012) (91)
- Repression of IFN regulatory factor 8 by DNA methylation is a molecular determinant of apoptotic resistance and metastatic phenotype in metastatic tumor cells. (2007) (90)
- Induction of an anti-inflammatory cytokine, IL-10, in dendritic cells after toll-like receptor signaling. (2006) (89)
- Negative regulation of the major histocompatibility class I gene in undifferentiated embryonal carcinoma cells. (1986) (89)
- Hybrid H-2 histocompatibility gene products assign domains recognized by alloreactive T cells. (1983) (88)
- The role of the interferon regulatory factor (IRF) family in dendritic cell development and function. (2007) (88)
- Peroxisome Proliferator‐Activated Receptors and Lipid Metabolism a (1993) (87)
- IFN consensus sequence binding protein potentiates STAT1-dependent activation of IFNgamma-responsive promoters in macrophages. (2000) (86)
- Shared and Distinct Functions of the Transcription Factors IRF4 and IRF8 in Myeloid Cell Development (2011) (84)
- Mutations in the 1,25-Dihydroxyvitamin D3 Receptor Identifying C-terminal Amino Acids Required for Transcriptional Activation That Are Functionally Dissociated from Hormone Binding, Heterodimeric DNA Binding, and Interaction with Basal Transcription Factor IIB, in Vitro * (1997) (83)
- Vitamin A deficiency in mice causes a systemic expansion of myeloid cells. (2000) (82)
- Occupancy of upstream regulatory sites in vivo coincides with major histocompatibility complex class I gene expression in mouse tissues (1992) (79)
- Developmental and tissue-specific expression of nuclear proteins that bind the regulatory element of the major histocompatibility complex class I gene (1989) (79)
- A constitutive damage-specific DNA-binding protein is synthesized at higher levels in UV-irradiated primate cells (1990) (79)
- Identification of IRF-8 and IRF-1 target genes in activated macrophages. (2007) (77)
- Inducible Deposition of the Histone Variant H3.3 in Interferon-stimulated Genes* (2009) (76)
- Regulation of IFN consensus sequence binding protein expression in murine macrophages. (1999) (76)
- Complex Formation of the Interferon (IFN) Consensus Sequence-binding Protein with IRF-1 Is Essential for Murine Macrophage IFN-γ-induced iNOS Gene Expression* (2003) (76)
- Bromodomain Protein Brd4 Binds to GTPase-Activating SPA-1, Modulating Its Activity and Subcellular Localization (2004) (74)
- Modulation of interferon consensus sequence binding protein mRNA in murine peritoneal macrophages. Induction by IFN-gamma and down-regulation by IFN-alpha, dexamethasone, and protein kinase inhibitors. (1992) (74)
- Dominant negative retinoid X receptor beta inhibits retinoic acid-responsive gene regulation in embryonal carcinoma cells (1994) (73)
- Heterodimerization of thyroid hormone (TH) receptor with H-2RIIBP (RXR beta) enhances DNA binding and TH-dependent transcriptional activation. (1992) (73)
- RAR and RXR selective ligands cooperatively induce apoptosis and neuronal differentiation in P19 embryonal carcinoma cells (1996) (73)
- Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways (1993) (72)
- Induction of anti-H–2 antibodies without alloantigen exposure by in vivo administration of anti-idiotype (1981) (71)
- A Reporter Mouse Reveals Lineage-Specific and Heterogeneous Expression of IRF8 during Lymphoid and Myeloid Cell Differentiation (2014) (70)
- The cyclin B1 gene is actively transcribed during mitosis in HeLa cells (2001) (70)
- ICSBP/IRF-8 inhibits mitogenic activity of p210 Bcr/Abl in differentiating myeloid progenitor cells. (2003) (70)
- Characterization of hUCRBP (YY1, NF-E1, delta): a transcription factor that binds the regulatory regions of many viral and cellular genes. (1994) (69)
- Regulation of IFN-gamma-induced nuclear expression of IFN consensus sequence binding protein in murine peritoneal macrophages. (1994) (68)
- Brd4 is required for recovery from antimicrotubule drug-induced mitotic arrest: preservation of acetylated chromatin. (2005) (68)
- Binding of multiple nuclear factors to the 5' upstream regulatory element of the murine major histocompatibility class I gene (1987) (68)
- Interferon regulatory factors and TFIIB cooperatively regulate interferon-responsive promoter activity in vivo and in vitro (1996) (68)
- Interferon regulatory factor 8/interferon consensus sequence binding protein is a critical transcription factor for the physiological phenotype of microglia (2012) (67)
- Gamma Interferon Triggers Interaction between ICSBP (IRF-8) and TEL, Recruiting the Histone Deacetylase HDAC3 to the Interferon-Responsive Element (2002) (67)
- Ligand-dependent occupancy of the retinoic acid receptor beta 2 promoter in vivo (1994) (67)
- Efficient Inhibition of Activation-induced Fas Ligand Up-regulation and T Cell Apoptosis by Retinoids Requires Occupancy of both Retinoid X Receptors and Retinoic Acid Receptors (*) (1995) (66)
- BRD4 directs hematopoietic stem cell development and modulates macrophage inflammatory responses (2019) (66)
- Vitamin A deficiency in mice causes a systemic expansion of myeloid cells (2000) (66)
- Crystal Structure of the Human BRD2 Bromodomain (2006) (65)
- Coactivator p300 Acetylates the Interferon Regulatory Factor-2 in U937 Cells following Phorbol Ester Treatment* (2001) (65)
- IRF8 regulates acid ceramidase expression to mediate apoptosis and suppresses myelogeneous leukemia. (2011) (65)
- Biallelic mutations in IRF8 impair human NK cell maturation and function (2017) (64)
- Deletion of the proline-rich region of the murine metastasis susceptibility gene Brd4 promotes epithelial-to-mesenchymal transition- and stem cell-like conversion. (2011) (63)
- Astrocytic phagocytosis is a compensatory mechanism for microglial dysfunction (2020) (63)
- The interferon regulatory factor ICSBP/IRF-8 in combination with PU.1 up-regulates expression of tumor suppressor p15(Ink4b) in murine myeloid cells. (2004) (62)
- Immunochemical evidence in two haplotypes for at least three D region-encoded molecules, D, L, and R. (1981) (62)
- Dynamic bookmarking of primary response genes by p300 and RNA polymerase II complexes (2009) (61)
- Retinoid receptors in transcriptional regulation. (1996) (61)
- Positive Regulatory Domain I (PRDM1) and IRF8/PU.1 Counter-regulate MHC Class II Transactivator (CIITA) Expression during Dendritic Cell Maturation* (2011) (61)
- Mechanisms for synergistic activation of thyroid hormone receptor and retinoid X receptor on different response elements. (1994) (60)
- K‐252a inhibits the increase in c‐fos transcription and the increase in intracellular calcium produced by nerve growth factor in PC12 cells (1989) (60)
- Expression and function of a nonglycosylated major histocompatibility class I antigen (1986) (57)
- Innate Immunity to Intraphagosomal Pathogens Is Mediated by Interferon Regulatory Factor 8 (IRF-8) That Stimulates the Expression of Macrophage-specific Nramp1 through Antagonizing Repression by c-Myc* (2008) (57)
- IRF8 directs stress induced autophagy in macrophages and promotes clearance of Listeria monocytogenes (2015) (56)
- Interferon Regulatory Factor-2 Regulates Cell Growth through Its Acetylation* (2003) (56)
- WHSC1 links transcription elongation to HIRA‐mediated histone H3.3 deposition (2013) (55)
- Phosphorylation of histone H3 is functionally linked to retinoic acid receptor β promoter activation (2002) (55)
- BRD4 Short Isoform Interacts with RRP1B, SIPA1 and Components of the LINC Complex at the Inner Face of the Nuclear Membrane (2013) (54)
- Dissection of serological and cytolytic T lymphocyte epitopes on murine major histocompatibility antigens by a recombinant H-2 gene separating the first two external domains (1984) (54)
- IRF1 Maintains Optimal Constitutive Expression of Antiviral Genes and Regulates the Early Antiviral Response (2019) (53)
- Interferon regulatory factor 8 integrates T-cell receptor and cytokine-signaling pathways and drives effector differentiation of CD8 T cells (2012) (53)
- Partner-regulated interaction of IFN regulatory factor 8 with chromatin visualized in live macrophages. (2005) (53)
- Retinoic acid-dependent transactivation of major histocompatibility complex class I promoters by the nuclear hormone receptor H-2RIIBP in undifferentiated embryonal carcinoma cells. (1992) (53)
- Transcription factor IRF8 plays a critical role in the development of murine basophils and mast cells. (2015) (53)
- A burst of c-fos gene expression in the mouse occurs at birth (1987) (52)
- Cholera toxin inhibits IL-12 production and CD8α+ dendritic cell differentiation by cAMP-mediated inhibition of IRF8 function (2009) (51)
- Fine mapping of epitopes by intradomain Kd/Dd recombinants (1987) (51)
- Ubiquitin-dependent Degradation of Interferon Regulatory Factor-8 Mediated by Cbl Down-regulates Interleukin-12 Expression* (2005) (51)
- Intracellular transport blockade caused by disruption of the disulfide bridge in the third external domain of major histocompatibility complex class I antigen. (1986) (50)
- The mouse Rxrb gene encoding RXR beta: genomic organization and two mRNA isoforms generated by alternative splicing of transcripts initiated from CpG island promoters. (1994) (48)
- Differential requirement of IFN consensus sequence binding protein for the production of IL-12 and induction of Th1-type cells in response to IFN-gamma. (1999) (48)
- Interferon Regulatory Factor-8 Is Indispensable for the Expression of Promyelocytic Leukemia and the Formation of Nuclear Bodies in Myeloid Cells* (2007) (47)
- Nramp1-mediated Innate Resistance to Intraphagosomal Pathogens Is Regulated by IRF-8, PU.1, and Miz-1* (2003) (47)
- The Small Ubiquitin-like Modifier-Deconjugating Enzyme Sentrin-Specific Peptidase 1 Switches IFN Regulatory Factor 8 from a Repressor to an Activator during Macrophage Activation (2012) (47)
- Retinoid X receptor-selective ligands produce malformations in Xenopus embryos. (1996) (46)
- Macrophage centripetal migration drives spontaneous healing process after spinal cord injury (2019) (46)
- IFN Regulatory Factor 8 Represses GM-CSF Expression in T Cells To Affect Myeloid Cell Lineage Differentiation (2015) (46)
- Microglia activation in Niemann–Pick disease, type C1 is amendable to therapeutic intervention (2018) (45)
- Ebolavirus VP35 Interacts with the Cytoplasmic Dynein Light Chain 8 (2009) (45)
- Pseudosubstrate inhibition of protein kinase PKR by swine pox virus C8L gene product. (2000) (45)
- Anti-idiotypes to monoclonal anti-H-2 antibodies. II. Expression of anti-H-2Kk idiotypes on antibodies induced by anti-idiotype or H-2Kk antigen (1981) (45)
- Autoantigen TRIM21/Ro52 as a Possible Target for Treatment of Systemic Lupus Erythematosus (2012) (44)
- In vitro mutagenesis of a mouse MHC class I gene for the examination of structure-function relationships. (1985) (43)
- Retinoid-induced chromatin structure alterations in the retinoic acid receptor beta2 promoter (1997) (43)
- Solution structure of the extraterminal domain of the bromodomain‐containing protein BRD4 (2008) (43)
- Induction of major histocompatibility class I antigens by interferons in undifferentiated F9 cells (1987) (42)
- Negative regulation of the major histocompatibility complex class I promoter in embryonal carcinoma cells. (1991) (41)
- Structural implications for K5/K12‐di‐acetylated histone H4 recognition by the second bromodomain of BRD2 (2010) (41)
- Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family. (1995) (40)
- The proliferative response of cloned Peyer's patch switch T cells to syngeneic and allogeneic stimuli. (1985) (40)
- Isolation of a full-length cDNA clone encoding a N-terminally variant form of the human retinoid X receptor beta. (1992) (40)
- Transcription of a subset of human class II major histocompatibility complex genes is regulated by a nucleoprotein complex that contains c-fos or an antigenically related protein. (1991) (40)
- Synergism of bacterial lipopolysaccharides and concanavalin A in the activation of thymic lymphocytes. (1975) (38)
- Monoclonal antibodies to mouse major histocompatibility complex antigens. IV. A series of hybridoma clones producing anti-h- 2d antigens on the surface of these cells. (1982) (38)
- Rapid isolation and characterization of 118 novel C2H2-type zinc finger cDNAs expressed in human brain. (1995) (38)
- Epigenetic control of early dendritic cell lineage specification by the transcription factor IRF8 in mice. (2019) (37)
- Modulation of the Brd4/P-TEFb Interaction by the Human T-Lymphotropic Virus Type 1 Tax Protein (2007) (37)
- Inhibition of human immunodeficiency virus type 1 and vaccinia virus infection by a dominant negative factor of the interferon regulatory factor family expressed in monocytic cells. (1996) (37)
- Phenotypic expression of I-A and I-E/C subregion determinants on murine thymocytes. (1980) (37)
- Natural killer dendritic cells are an intermediate of developing dendritic cells (2007) (36)
- Ebola virus-like particles stimulate type I interferons and proinflammatory cytokine expression through the toll-like receptor and interferon signaling pathways. (2014) (36)
- Transcription Factor IRF8 Governs Enhancer Landscape Dynamics in Mononuclear Phagocyte Progenitors. (2018) (35)
- Interferon regulatory factor-2 physically interacts with NF-κB in vitro and inhibits NF-κB induction of major histocompatibility class I and β2-microglobulin gene expression in transfected human neuroblastoma cells (1995) (35)
- Nucleolin is involved in interferon regulatory factor-2-dependent transcriptional activation (2006) (35)
- Nuclear Hormone Retinoid X Receptor (RXR) Negatively Regulates the Glucose-Stimulated Insulin Secretion of Pancreatic β-Cells (2010) (35)
- Batf3 and Id2 Have a Synergistic Effect on Irf8-Directed Classical CD8α+ Dendritic Cell Development (2013) (34)
- Binding of tissue-specific forms of αA-CRYBP1 to their regulatory sequence in the mouse αA-crystallin-encoding gene: double-label immunoblotting of UV-crosslinked complexes (1993) (33)
- Blocking of allogeneic cell-mediated lympholysis by monoclonal antibodies to H-2 antigens. (1980) (33)
- The nucleotide sequence and comparative analysis of the H-2Dp class I H-2 gene. (1986) (32)
- A 150-base pair 5' region of the MHC class I HLA-B7 gene is sufficient to direct tissue-specific expression and locus control region activity: the alpha site determines efficient expression and in vivo occupancy at multiple cis-active sites throughout this region. (1997) (31)
- Establishment of cell lines from somite stage mouse embryos and expression of major histocompatibility class I genes in these cells. (1988) (31)
- PIASy Inhibits Virus-induced and Interferon-stimulated Transcription through Distinct Mechanisms* (2011) (31)
- Combined histologic and molecular features reveal previously unappreciated subsets of lymphoma in AKXD recombinant inbred mice. (2001) (30)
- Two distinct murine differentiation antigens determined by genes linked to the Ly-6 locus. (1981) (30)
- Inhibition of ligand induced promoter occupancy in vivo by a dominant negative RXR (1996) (30)
- Two upstream elements activate transcription of a major histocompatibility complex class I gene in vitro. (1992) (30)
- Cell cycle gene-specific control of transcription has a critical role in proliferation of primordial germ cells. (2012) (29)
- Cholera toxin inhibits IL-12 production and CD8α+ dendritic cell differentiation by cAMP-mediated inhibition of IRF8 function (2009) (29)
- Cooperative contributions of Interferon regulatory factor 1 (IRF1) and IRF8 to interferon-γ-mediated cytotoxic effects on oligodendroglial progenitor cells (2011) (29)
- ZFR coordinates crosstalk between RNA decay and transcription in innate immunity (2018) (29)
- Key role of regulated upon activation normal T‐cell expressed and secreted, nonstructural protein1 and myeloperoxidase in cytokine storm induced by influenza virus PR‐8 (A/H1N1) infection in A549 bronchial epithelial cells (2011) (28)
- Vesicular stomatitis virus infection induces a nuclear DNA-binding factor specific for the interferon-stimulated response element (1995) (28)
- Chromosomal Integration of Retinoic Acid Response Elements Prevents Cooperative Transcriptional Activation by Retinoic Acid Receptor and Retinoid X Receptor (2002) (28)
- Brd4 associates with mitotic chromosomes throughout early zebrafish embryogenesis (2008) (28)
- CpG‐activated Thy1.2+ dendritic cells protect against lethal Listeria monocytogenes infection (2005) (28)
- Cloning and expression analysis of a human cDNA homologous to Xenopus TFIIIA. (1995) (27)
- Viral Infection Increases Glucocorticoid-Induced Interleukin-10 Production through ERK-Mediated Phosphorylation of the Glucocorticoid Receptor in Dendritic Cells: Potential Clinical Implications (2013) (27)
- The EndoA enhancer contains multiple ETS binding site repeats and is regulated by ETS proteins. (1994) (27)
- Recombinant thyroid hormone receptor and retinoid X receptor stimulate ligand-dependent transcription in vitro. (1994) (27)
- Histone acetylation and subcellular localization of chromosomal protein BRD4 during mouse oocyte meiosis and mitosis. (2007) (27)
- Anti-idiotypes to monoclonal anti-H-2 antibodies. III. Syngeneic anti-idiotypes on antibodies induced by in vivo administration of xenogeneic anti-idiotypes. (1982) (26)
- Critical Role of IRF-8 in Negative Regulation of TLR3 Expression by Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase-2 Activity in Human Myeloid Dendritic Cells (2011) (26)
- Idiotypes of anti-Ia antibodies. II. Effects of in vivo treatment with xenogeneic anti-idiotype. (1982) (26)
- Idiotypes of anti-Ia antibodies. I. Expression of the 14-4-4S idiotype in humoral immune responses (1981) (26)
- Mapping of the mouse Rxr loci encoding nuclear retinoid X receptors RXR alpha, RXR beta, and RXR gamma. (1992) (26)
- A dominant negative mutant of an IFN regulatory factor family protein inhibits both type I and type II IFN-stimulated gene expression and antiproliferative activity of IFNs. (1996) (25)
- The AP-1 site and the cAMP- and serum response elements of the c-fos gene are constitutively occupied in vivo. (1991) (25)
- Evidence for the absence of I-E/C antigen expression on the cell surface in mice of the H-2b or H-2s haplotypes. (1980) (25)
- Developmental and epigenetic regulation of the human TLR3 gene. (2008) (25)
- Spatially distinct allodeterminants of the H-2Kk molecule as detected by monoclonal anti-H-2 antibodies. (1981) (24)
- Heterogeneity of H-2D region associated genes and gene products. (1983) (23)
- Role of a disulfide bridge in the immune function of major histocompatibility class I antigen as studied by in vitro mutagenesis. (1984) (23)
- Tripartite Motif (TRIM) 12c, a Mouse Homolog of TRIM5, Is a Ubiquitin Ligase That Stimulates Type I IFN and NF-κB Pathways along with TNFR-Associated Factor 6 (2015) (23)
- H-2RIIBP expressed from a baculovirus vector binds to multiple hormone response elements. (1992) (23)
- Constitutive expression of c-fos antisense RNA blocks c-fos gene induction by interferon and by phorbol ester and reduces c-myc expression in F9 embryonal carcinoma cells. (1988) (22)
- Regulation of major histocompatibility complex class I genes. (1989) (22)
- A monoclonal antibody detecting unusual Thy-1 determinants. (1982) (22)
- Detection of at least two distinct mouse I-E antigen molecules by the use of a monoclonal antibody. (1982) (21)
- Serological analysis of H-2 mutations using monoclonal antibodies. (1984) (21)
- Transfer of antibodies directed to paternal major histocompatibility class I antigens from pregnant mice to the developing fetus. (1987) (21)
- Comment on “Gene Disruption Study Reveals a Nonredundant Role for TRIM21/Ro52 in NF-κB-Dependent Cytokine Expression in Fibroblasts” (2009) (21)
- Virus-Like Particles Activate Type I Interferon Pathways to Facilitate Post-Exposure Protection against Ebola Virus Infection (2015) (21)
- Studies on monoclonal antibodies to mouse MHC products. (1981) (20)
- A regulatory element in the beta 2-microglobulin promoter identified by in vivo footprinting (1993) (20)
- Polymorphism of murine major histocompatibility Class I antigen: assignment of putative allodeterminants to distinct positions of the amino acid sequence within the first external domain of the antigen. (1985) (20)
- Chromatin Landscape of the IRF Genes and Role of the Epigenetic Reader BRD4. (2016) (20)
- Interferon induction of chicken MHC class I gene expression: phylogenetic conservation of the interferon-responsive element. (1992) (20)
- Genomic footprinting of retinoic acid regulated promoters in embryonal carcinoma cells. (1997) (19)
- Roles of Fc Domain and Exudation in L2 Antibody-Mediated Protection against Human Papillomavirus (2018) (19)
- Quantitative increases in DNA binding affinity and positional effects determine 9-cis retinoic acid induced activation of the retinoid X receptorβ homodimer (1994) (19)
- BRD4 regulates adiponectin gene induction by recruiting the P-TEFb complex to the transcribed region of the gene (2017) (19)
- A molecular hybrid of the H-2Dd and H-2Ld genes expressed in the dm1 mutant. (1984) (19)
- On the role of H3.3 in retroviral silencing (2017) (19)
- Retinoid X receptor beta and peroxisome proliferator-activated receptor activate an estrogen response element. (1995) (18)
- Liposomes as model membrane systems for immune attack. I. Transfer of antigenic determinants to lymphocyte membranes after interactions with hapten-bearing liposomes. (1978) (18)
- Inactivating Mutation in IRF8 Promotes Osteoclast Transcriptional Programs and Increases Susceptibility to Tooth Root Resorption (2019) (18)
- New family of exon-shuffled recombinant genes reveals extensive interdomain interactions in class I histocompatibility antigens and identifies residues involved (1987) (18)
- Flow microfluorometric analysis of H-2L expression. (1981) (18)
- A RUNX–CBFβ-driven enhancer directs the Irf8 dose-dependent lineage choice between DCs and monocytes (2021) (18)
- IRF-8 regulates expansion of myeloid-derived suppressor cells and Foxp3+ regulatory T cells and modulates Th2 immune responses to gastrointestinal nematode infection (2017) (18)
- Ia specificities on parental and hybrid cells of an I-A mutant mouse strain. (1981) (18)
- Accelerated calcium ion uptake in murine thymocytes induced by concanavalin A (1977) (17)
- Intracellular delivery of acetyl‐histone peptides inhibits native bromodomain–chromatin interactions and impairs mitotic progression (2008) (17)
- Immature CD8 Single-Positive Thymocytes Are a Molecularly Distinct Subpopulation, Selectively Dependent on BRD4 for Their Differentiation (2018) (17)
- Antiidiotypes to monoclonal anti-H-2 and anti-Ia hybridoma antibodies. (1981) (17)
- Interaction between the Retinoid X Receptor and Transcription Factor IIB Is Ligand-dependent in Vivo * (1998) (17)
- Control of H-2 antigen and beta 2-microglobulin gene expression in mouse trophoblast cell clones. (1983) (17)
- Mechanisms of Immunity in Post-Exposure Vaccination against Ebola Virus Infection (2015) (16)
- Transcription Factor IRF 8 Directs a Silencing Programme for TH 17 Cell Differentiation (2011) (16)
- Bromodomain protein BRD4 directs and sustains CD8 T cell differentiation during infection (2021) (16)
- T follicular helper cells restricted by IRF8 contribute to T cell-mediated inflammation. (2019) (16)
- The role of IFN regulatory factor-3 in the cytotoxic activity of NS-9, a polyinosinic-polycytidylic acid/cationic liposome complex, against tumor cells (2005) (16)
- TRIM21 Dysfunction Enhances Aberrant B-Cell Differentiation in Autoimmune Pathogenesis (2020) (16)
- Histone acetylation is a checkpoint in FGF‐stimulated mesoderm induction (2000) (15)
- PLZF outreach: a finger in interferon's pie. (2009) (15)
- Genetic regulation of class I major histocompatibility complex (MHC) antigen induction on astrocytes (1989) (15)
- Induction of c-fos gene expression by interferons. (1988) (15)
- Phylogenetic cross-reactivities of monoclonal antibodies produced against rat neurophysin (1984) (14)
- Mysm1 is required for interferon regulatory factor expression in maintaining HSC quiescence and thymocyte development (2016) (14)
- Smad4 is required to inhibit osteoclastogenesis and maintain bone mass (2016) (14)
- Studies on lymphocyte-mediated cytolysis. XII. Hapten transferred to cell surfaces by interaction with liposomes is recognized by antibody but not by hapten-specific H-2 restricted cytotoxic T cells. (1978) (14)
- Myeloid differentiation is impaired in transgenic mice with targeted expression of a dominant negative form of retinoid X receptor β (1997) (14)
- Expression of major histocompatibility complex (MHC) class I genes in astrocytes correlates with the presence of nuclear factors that bind to constitutive and inducible enahcers (1992) (13)
- Innate Immune Memory in Hematopoietic Stem/Progenitor Cells: Myeloid-Biased Differentiation and the Role of Interferon (2021) (13)
- Virus‐induced differential expression of nuclear receptors and coregulators in dendritic cells: Implication to interferon production (2011) (13)
- Complementation between I region genes is revealed by a hybridoma anti-Ia antibody. (1981) (13)
- HIRA, a DiGeorge Syndrome Candidate Gene, Confers Proper Chromatin Accessibility on HSCs and Supports All Stages of Hematopoiesis. (2020) (12)
- Retinoid receptor-induced alteration of the chromatin assembled on a ligand-responsive promoter in Xenopus oocytes. (1998) (12)
- Introduction of H-2Dd determinants into the H-2Ld antigen by site- directed mutagenesis (1987) (12)
- Type I IFN-dependent antibody response at the basis of sex dimorphism in the outcome of COVID-19 (2020) (11)
- Neonatal induction of a nuclear protein that binds to the c-fos enhancer. (1989) (11)
- The products of transferred H-2 genes express determinants that restrict hapten-specific cytotoxic T cells. (1983) (11)
- Dysfunction of TRIM21 in interferon signature of systemic lupus erythematosus (2018) (11)
- Induction of c-ets and c-fos gene expression upon antigenic stimulation of a T cell hybridoma with inducible cytolytic capacity (1987) (11)
- Interferon regulatory factor-2 physically interacts with NF-kappa B in vitro and inhibits NF-kappa B induction of major histocompatibility class I and beta 2-microglobulin gene expression in transfected human neuroblastoma cells. (1995) (11)
- Molecular localization of allogeneic and self determinants recognized by bulk and clonal populations of cytotoxic T cells. (1985) (11)
- Pretreatment of murine thymocytes by phytohemagglutinin inhibits the binding of H-concanavalin A. (1975) (10)
- Alloimmunization against RBC or PLT antigens is independent of TRIM21 expression in a murine model. (2011) (10)
- Concanavalin A potentiates syngeneic response in murine lymphocytes (1976) (10)
- Site-specific mutagenesis of the class I regulatory element the Q10 gene allows expression in non-liver tissues. (1989) (10)
- Proteomic survey of ubiquitin-linked nuclear proteins in interferon-stimulated macrophages. (2011) (10)
- The presence of a common idiotype in anti‐H‐2 immune sera as detected by anti‐idiotype to a monoclonal anti‐H‐2 antibody (1983) (9)
- T cell activation and increases in protein kinase C activity enhance retinoic acid-induced gene transcription. (1994) (9)
- Ia ANTIGEN CROSSREACTIONS BETWEEN SPECIES (1979) (9)
- Physical mapping of the retinoid X receptorB gene in mouse and human (2004) (9)
- Activation of JNK Triggers Release of Brd4 from Mitotic Chromosomes and Mediates Protection from Drug-Induced Mitotic Stress (2012) (9)
- SPT6 interacts with NSD2 and facilitates interferon‐induced transcription (2018) (8)
- Monocyte Subsets with High Osteoclastogenic Potential and Their Epigenetic Regulation Orchestrated by IRF8 (2020) (8)
- Interferon Regulatory Factor 8 (IRF8) Impairs Induction of Interferon Induced with Tetratricopeptide Repeat Motif (IFIT) Gene Family Members* (2016) (8)
- Binding of tissue-specific forms of alpha A-CRYBP1 to their regulatory sequence in the mouse alpha A-crystallin-encoding gene: double-label immunoblotting of UV-crosslinked complexes. (1993) (8)
- Differential 9-cis-Retinoic Acid-dependent Transcriptional Activation by Murine Retinoid X Receptor (RXR) and RXR (1996) (8)
- An IFN regulatory factor-2 DNA-binding domain dominant negative mutant exhibits altered cell growth and gene expression (2000) (8)
- A versatile mouse model of epitope-tagged histone H3.3 to study epigenome dynamics (2018) (8)
- Relationship of cytokines and cytokine signaling to immunodeficiency disorders in the mouse. (1998) (8)
- Another road to interferon: Yasuichi Nagano's journey. (2007) (8)
- Differential lack of class I H-2d antigen expression by sublines of the BALB/c S49 T cell lymphoma. (1986) (7)
- Anti-idiotypes to monoclonal anti-H-2 antibodies--I. Contribution of isolated heavy and light chains to idiotype expression. (1982) (7)
- Differential 9-cis-retinoic acid-dependent transcriptional activation by murine retinoid X receptor alpha (RXR alpha) and RXR beta. Role of cell type and RXR domains. (1996) (7)
- Essential Requirement for IFN Regulatory Factor 7 in Autoantibody Production but Not Development of Nephritis in Murine Lupus (2016) (7)
- c-fos antisense RNA blocks expression of c-fos gene in F9 embryonal carcinoma cells. (1988) (7)
- Induction by concanavalin A of specific mRNAs and cytolytic function in a CD8-positive T cell hybridoma. (1994) (7)
- Transcription elongation factor Brd4-P-TEFb accelerates intestinal differentiation-associated SLC2A5 gene expression (2016) (7)
- Inflammatory monocyte-derived dendritic cells mediate autoimmunity in murine model of systemic lupus erythematosus (2020) (7)
- Liposomes as model membrane systems for immune attack. II. The interaction of complement and K cell populations with immobilized liposomes. (1978) (6)
- Retinoic Acid Induction of Major Histocompatibility Complex Class I Genes in NTera-2 Embryonal Carcinoma Cells Involves Induction of NF-iB (p5O-p65) and Retinoic Acid Receptor ,B-Retinoid X Receptor Heterodimers (6)
- Interferon Regulatory Factor (IRF)-1 and IRF-2 Regulate Interferon g –dependent Cyclooxygenase 2 Expression (2000) (6)
- Author Correction: Trained immunity, tolerance, priming and differentiation: distinct immunological processes (2021) (5)
- Epigenetic regulation of lipoprotein lipase gene via BRD4, which is potentially associated with adipocyte differentiation and insulin resistance. (2019) (5)
- Retention of intact concanavalin A and Lens culinaris lectin in transformed lymphoblasts during mitogenic response. (1978) (5)
- Activation of immunoglobulin control elements in trasgenic mice (2004) (5)
- Autoantigen TRIM 21 / Ro 52 as a Possible Target for Treatment of Systemic Lupus Erythematosus (2014) (5)
- Cloning and chromosome mapping of human retinoid X receptor β: selective amino acid sequence conservation of a nuclear hormone receptor in mammals (2004) (5)
- Evidence for the association of I-A and I-E molecules in d-haplotype mice. (1986) (5)
- The differentiation of suppressor cell populations as revealed by studies of the effects of mitogens on the mixed lymphocyte reaction and on the generation of cytotoxic lymphocytes. (1976) (5)
- Characterization of the chimeric retinoic acid receptor RARα/VDR (1998) (5)
- Chromatin remodeling: demethylating H3K4me3 of type I IFNs gene by Rbp2 through interacting with Piasy for transcriptional attenuation (2017) (4)
- Erratum: Inhibition of estrogen-responsive gene activation by the retinoid X receptor β: Evidence for multiple inhibitory pathways (Molecular and Cellular Biology 13:4 (2258)) (1993) (4)
- Induction of interferons and interferon-induced genes (1996) (4)
- Expression of mutant H-2d proteins encoded by class I genes which alternatively process the 5' end of their transcripts. (1989) (4)
- DNA Damage Induces Dynamic Associations of BRD4/P-TEFb With Chromatin and Modulates Gene Transcription in a BRD4-Dependent and -Independent Manner (2020) (4)
- Lens culinaris lectin is a T-cell mitogen: binding inhibition by concanavalin A and phytohemagglutinin-P. (1978) (4)
- Brd4 binds to active enhancers to control cell identity gene induction in adipogenesis and myogenesis (2017) (3)
- Evaluation of the structure function relationships of MHC class I antigens by molecular genetic techniques. (1986) (3)
- T cell activation: independent induction of killing activity and interleukin 2 secretion in cytolytic hybridomas* (1989) (3)
- Erratum: A dominant negative mutant of an IFN regulatory factor family protein inhibits both type I and type II IFN-stimulated gene expression and antiproliferative activity of IFNs (Journal of Immunology (1996) 157 (5145- 5154)) (1999) (3)
- Modulation of MHC Antigen Expression and Disease: Control of MHC class I gene expression (1995) (3)
- Erratum: BRD4 is a histone acetyltransferase that evicts nucleosomes from chromatin (2017) (3)
- The use of hybrid H-2 genes for localizing the positions of polymorphic determinants recognized by antibodies and by cytotoxic T cells. (1983) (3)
- Characterization of the chimeric retinoic acid receptor RARalpha/VDR. (1998) (3)
- Cell-mediated mitogenic response induced by leukoagglutinin and Lens culinaris lectin in mouse lymphocytes (1977) (3)
- Abstract 3226: The IRF8-osteopontin-CD44 axis functions as an immune checkpoint to control CD8+ T cell activation and tumor immune evasion (2019) (2)
- Chromatin structure undergoes global and local reorganization during murine dendritic cell development and activation (2022) (2)
- Long-term survival of mouse thymic lymphoid cells in vitro: effect of human serum. (1973) (2)
- Enumeration of H-2-gene products: failure to detect L molecules in the H-2b haplotype. (1980) (2)
- Stimulation of alloreactive cytotoxic T cells by paternal major histocompatibility antigens during murine pregnancy. (1985) (2)
- Transfer of concanavalin A between responding lymphocytes and syngeneic stimulating cells in cell-mediated mitogenic response. (1978) (2)
- 194: IRF8 regulates autophagy and activates microglia to exacerbate neuroinflammation (2013) (2)
- PROTEIN STRUCTURE AND FOLDING : Structural basis for acetylated histone H 4 recognition by the human BRD 2 bromodomain (2009) (2)
- PHAGOCYTES , GRANULOCYTES , AND MYELOPOIESIS Essential role of the IRF 8-KLF 4 transcription factor cascade in murine monocyte differentiation (2013) (2)
- The Interferon Regulatory Factor ICSBP/IRF8 in Combination with PU.1 Up-Regulates p15 Tumor Suppressor Expression in Murine Myeloid Cells (2004) (2)
- Interferon regulatory factor 8/interferon consensus sequence binding protein is a critical transcription factor for the physiological phenotype of microglia (2012) (1)
- Repression of osteopontin by IRF8 regulates a novel immunosuppressive checkpoint (2019) (1)
- Trained immunity, tolerance, priming and differentiation: distinct immunological processes (2020) (1)
- Functional Diversity TheirDendritic Cell Subset Development and IFN Regulatory Factor-4 and-8 Govern (2005) (1)
- Biallelic mutations in IRF 8 impair human NK cell maturation and function (2016) (1)
- Two distinct murine differentiation antigens both determined by genes linked to the ly6 locus. Abstr. (1981) (1)
- The E3 ubiquitin ligase TRIM21 forms a complex with p62 and TRAF6 and promotes degradation of TRAF6 (P1176) (2013) (1)
- Site Directed Mutagenesis Identifies Allo-Antigenic Epitopes of an H-2 Antigen Recognized by Antibodies and by Cytotoxic T-Lymphocytes (1987) (1)
- Cloned trans-acting factors that bind to the regulatory elements of the major histocompatibility complex class I gene. (1990) (1)
- Correction: A Reporter Mouse Reveals Lineage-Specific and Heterogeneous Expression of IRF8 during Lymphoid and Myeloid Cell Differentiation (2014) (1)
- Induction of c‐ets and c‐fos Gene Expression upon Antigenic Stimulation of a Memory‐like Cytolytic Hybridoma (1988) (1)
- Erratum: A reporter mouse reveals lineage-specific and heterogeneous expression of IRF8 during lymphoid and myeloid cell differentiation (The Journal of Immunology (2014) 193 (1766-1777)) (2014) (1)
- Induction of interferons-induced genes. (1996) (1)
- Studies on Lymphocyte-Mediated Cytolysis (1978) (1)
- Partial nucleotide sequence of H-2Dd major histocompatibility antigen gene. (1985) (1)
- in vitro ICSBP / IRF-8 retrovirus transduction rescues dendritic cell development (2002) (1)
- Transcriptional induction of genes by IFN-beta in mouse cells is regulated by a transcription factor similar to human ISGF-3. (1994) (1)
- Immature CD 8 Single-Positive Thymocytes Are a Molecularly Distinct Subpopulation , Selectively Dependent on BRD 4 for Their Differentiation (2018) (1)
- Assays of Cell-mediated Cytotoxicity (2003) (0)
- Bromodomain protein BRD4 directs CD8 T cell differentiation during infection and cancer (2021) (0)
- THE TRANSCRIPTION FACTOR IRF8 EPIGENETICALLY REGULATES EARLY DENDRITIC CELL SPECIFICATION (2019) (0)
- Dexamethasone synergistically increases secretion of the anti-inflammatory cytokine interleukin(IL)-10 in murine dendritic cells (DCs) upon viral infection: Potential implication to stress-mediated modification of susceptibility to viral infection. (94.4) (2010) (0)
- Abstract PR05: IRF8 regulates GM-CSF expression in T cells and tumor cells to mediate myeloid-derived suppressor cell differentiation (2015) (0)
- Negative Transcription Factor That Binds to the Upstream Conserved Region of Moloney Murine Leukemia Virus (2003) (0)
- Abstract 4682: IRF8 controls T cell development and survival to regulate T cell antitumor activity (2018) (0)
- Macrophages play a leading role in determining the direction of astrocytic migration in spinal cord injury via ADP-P2Y1R axis (2023) (0)
- Hapten Recognition by Cytotoxic T Cells (1981) (0)
- Hybrid H-2 histocompatibility gene recognized by alloreactive T cells (2016) (0)
- Abstract 5761: An alternative isoform of the metastasis susceptibility gene Brd4 promotes EMT and metastatic progression (2010) (0)
- A role of the transcription factor IRF8 in basophil and mast cell development (2015) (0)
- O029 Chromatin exchange in interferon induced transcription (2012) (0)
- This information is current as IFN-Producing Plasmacytoid Dendritic Cells Drives the Development of Type I Binding Protein/IFN Regulatory Factor 8 Cutting Edge: IFN Consensus Sequence (2017) (0)
- , V gene expression . its ligand and enhances retinoid-dependent RXR-retinoic acid receptor heterodimer binds Retinoid X receptor ( RXR ) within the (1997) (0)
- Effects of in vivo treatment with anti-idiotype to 14-4-4s, an anti-ia monoclonal antibody. Abstr. (1982) (0)
- The H-2 System: Biology of the Mouse Histocompatibility-2 Complex . Principles of Immunogenetics Applied to a Single System. Jan Klein. Springer-Verlag, New York, 1975. xii, 620 pp., illus. $39.80. (1975) (0)
- Ligand-Dependent Occupancy oftheRetinoic AcidReceptor P2Promoter InVivo (1994) (0)
- Transcription factor IRF8 governs enhancer landscape dynamics during mononuclear phagocyte development (2017) (0)
- Dendritic Cells Phosphatase-2 Activity in Human Myeloid Domain-Containing Protein Tyrosine TLR3 Expression by Src Homology 2 Critical Role of IRF-8 in Negative Regulation of (2011) (0)
- The Transcription Factor IRF8 is a Key Transcription Factor for Basophil Development (2013) (0)
- Enhancer Landscape Dynamics and the Role of IRF8 in Mononuclear Phagocyte Development (2015) (0)
- datamethod for processing cDNA microarray Preprocessing implementation for microarray (PRIM) (2015) (0)
- CELL-MEDIATED MITOGENIC RESPONSE INDUCED BY LEUKOAGGLUTININ AND L E N S C U L I N A R I S LECTIN IN MOUSE LYMPHOCYTES (2003) (0)
- Transacting Nuclear Proteins That Bind to the Upstream Regulatory Region of a MHC Class I Gene (1987) (0)
- proliferation of primordial germ cells Cell cycle gene-specific control of transcription has a critical role in Material Supplemental (2012) (0)
- Brd4 Coactivates Transcriptional Activation of NF- (cid:2) B via Specific Binding to Acetylated RelA (cid:1) (2009) (0)
- GCCAGGGC CGCGTGTT CTGC AGCGGCAACGC GGTGGT GTGC AAGGGCAGGCC CAACAAGCTGGAGC GGGACGAGGTGGT GC AGGTC TTT GACACCAAC CAGTT CAT CCGA Gl uLeuGl nGl nPheTyrAldThrGlnSerArgLeuProAspSerArgVdl ValLeuCysPheGlyGl uGl uPheProAspThrVal ProLeuArgSerLysLeul leLeu 1000 GAGCTGCAGCAATTCT ACGCCACCCAGAGCCGCCTACCTGACAGCAGG (0)
- S-19 : Epigenetic regulation of interferon response (2014) (0)
- Electrophysiological analysis of the spinal network function in the in situ adult interferon regulatory factor 8 (IRF8) knockout mice (2012) (0)
- Binding Protein Expression in Murine Regulation of IFN Consensus Sequence (1999) (0)
- Mouse Homolog of Human IRF8G388S Mutation Provides Novel Insight into Osteoclastogenesis and Tooth Root Resorption (2023) (0)
- Viral infection alters mRNA expression of nuclear hormone receptors (NRs) and their coregulators in mouse dendritic cells (DCs) (131.1) (2009) (0)
- Irf 8 Have a Synergistic Effect on Id 2 and Batf 3 (2013) (0)
- 226: The transcription factor IRF8 is required for the development of basophils (2013) (0)
- ID: 211: Chromatin exchange in macrophages and IRF8 dependent autophagy (2015) (0)
- PHAGOCYTES , GRANULOCYTES , AND MYELOPOIESIS Transcription factor IRF 8 plays a critical role in the development of murine basophils and mast cells (2014) (0)
- The murine H-2RIIBP, a ZN-finger protein with binding activity to the murine H-2 class I region II, is almost perfectly conserved in the human system (1991) (0)
- コアクチベータp300は,ホルボールエステル処理を行ったU937細胞において,インターフェロン調節因子‐2をアセチル化する (2001) (0)
- The expression level of autoantigen TRIM21 changes during lymphocyte development (84.10) (2009) (0)
- Altered memory capacities and endocrine allostasis in p300/CBP associated factor (PCAF) histone acetylase knockout mice (2008) (0)
- Tadpoles and tumors. Cell Differentiation and Cancer sponsored by the National Cancer Institute and the Japan Society for the Promotion of Science, Lihue, HI, USA, January 18-20, 1990. (1990) (0)
- BRD4 regulates adiponectin gene induction by recruiting the P-TEFb complex to the transcribed region of the gene (2017) (0)
- IRF8 inhibits the activity of C/EBPα to restrain mononuclear phagocyte progenitors from differentiating into neutrophils (2015) (0)
- Editorial: BET proteins in chromatin architecture, transcription and disease (2022) (0)
- AB0050 Irf8 Promotes TH17 Differentiation via Activation of Integrin-Mediated Tgfbeta Signaling in Neuroinflammation (2014) (0)
- BRD4 Deficiency Selectively Affects a Unique Developmental Subpopulation in Thymocytes (2018) (0)
- Lineage Differentiation Expression in T Cells To Affect Myeloid Cell IFN Regulatory Factor 8 Represses GM-CSF (2015) (0)
- Role of bromodomain 4 in breast cancer progression and metastasis (2008) (0)
- PS2-48 PIASy inhibits virus induced type I interferon production (2010) (0)
- Herbal extracts that induce type I interferons through Toll-like receptor 4 signaling (2022) (0)
- IRF8-Dependent IL-12 Response to Cooperation of TLR12 and TLR11 in the (0)
- Expression of mouse major histocompatibility (MHC) class I genes in embryos and F9 teratocarcinoma cell line (1985) (0)
- PL-13 The mechanism of interferon gene transcription in dendritic cells (2008) (0)
- Mono clonal antibodies to mouse major histo compatibility complex products (1981) (0)
- Nuclear Hormone Receptor RXR Negatively Regulates the Glucose-Stimulated Insulin Secretion of Pancreatic β-Cells (2010) (0)
- CS13-1. SUMO Modification of IRF Family Proteins and Regulation of Anti-Viral Innate Immunity (2011) (0)
- Regulation of major histocompatibility complex class i gene expression in the central nervous system the role of enhancer binding factors (1992) (0)
- Inhibition of type I interferon transcription by IRF3/7 SUMOylation the process hijacked by the Ebola virus VP35 (2009) (0)
- Enhancer landscape dynamics during monocyte and dendritic cell development and the role of the transcription factor IRF8 (2015) (0)
- インターフェロン応答因子(IRF)特異的DNA結合配列の転写制御におけるヒストンアセチル化酵素の役割 (1998) (0)
- Differentiation during Lymphoid and Myeloid Cell and Heterogeneous Expression of IRF 8 A Reporter Mouse Reveals Lineage-Specific (2014) (0)
- Fattore di trascrizione interferon regulatory factor-1 quale marcatore molecolare e target per la manipolazione di cellule del sistema immune in nuove strategie combinate di immunoterapia dei tumori (2012) (0)
- Interferon Regulates Major Histocompatibility Class I Gene Expression through a 5′ Upstream Regulatory Region (1987) (0)
- Negative Regulator of IFN Regulatory Factor 7 Ubiquitin-Related Modifier E3 Ligase and Tripartite Motif-Containing Protein 28 Is a Small (2011) (0)
- Retinoic Acid Receptors (2002) (0)
- 74 Proteomic Approach to Identifying Ubiquitinated Nuclear Proteins in Stimulated Macrophages (2007) (0)
- Transcriptomics and quantitative proteomics reveal changes after second stimulation of bone marrow-derived macrophages from lupus-prone MRL/lpr mice (2022) (0)
- Mechanisms of post-exposure protection mediated by virus-like particles against Ebola virus infection (52.18) (2010) (0)
- 154 : The IRF8-KLF4 transcription factor cascade is essential for the development of monocytes (2013) (0)
- The dysfunction of the E3 ubiquitin ligase TRIM21 in systemic lupus erythematosus (HUM7P.301) (2014) (0)
- Transcription Factor ICSBP/IRF8 Regulates B Cell Development at Multiple Checkpoints. (2005) (0)
- SS3-7 Transcriptional regulation of interferon stimulated genes: Role of chromatin binding protein Brd4 (2010) (0)
- Epigenetic targeting of Brd4 constrains CD8+ T cell differentiation during infection and cancer (2019) (0)
- SS3-1 Chromatin dynamics in interferon signaling: Analysis of the histone H3.3 deposition (2010) (0)
- Inhibition of human immunodeficiency virus type 1 and vaccinia virus infection by a dominant negative factor of the interferon regulatory factor family expressed in monocytic cells (antiviral activity/interferoni-stimulated response element/transcription factor ICSBP/DNA-binding domain/monocyte) (2016) (0)
- IRF8 Restrains Monocyte-Dendritic Cell Progenitors from Differentiating into Neutrophils by Inhibiting C/EBPα Activity (2013) (0)
- IRF8 expressed in T cells regulates GM-CSF expression to control myeloid derived suppressor cell differentiation (TUM6P.955) (2015) (0)
- A single-cell genomic strategy for alternative transcript start sites identification (2021) (0)
- Factor 7 and Negative Regulator of IFN Regulatory Small Ubiquitin-Related Modifier E3 Ligase Tripartite Motif-Containing Protein 28 Is a (2011) (0)
- The effects of concanavalin-a (con-a) and bacterial lipopolysacchar- ide (lps) on mixed lymphocyte cultures and the generation of cytotoxic effector lymphocytes. Abstr. (1975) (0)
- Introduction to a Special Issue on IFN Regulatory Factors in Innate Immune Responses. (2016) (0)
- ZFR coordinates crosstalk between RNA decay and transcription in innate immunity (2018) (0)
- Lineage commitment (WS-033) Chairpersons: Hiroshi Kawamoto, Koji Yasutomo (2010) (0)
- Brief Definitive Report INDUCTION OF c-ets AND cfos GENE EXPRESSION UPON ANTIGENIC STIMULATION OF A T CELL HYBRIDOMA WITH INDUCIBLE CYTOLYTIC CAPACITY (2003) (0)
- PS2-016. Selective regulation of monocyte subsets by the transcription factor Interferon Regulatory Factor 8 (2011) (0)
- [Transcriptional regulation of major histocompatibility complex class I gene]. (1990) (0)
- IRF8 is present in microglia in the CNS and modulates the response of these cells to IFN-γ (2009) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Keiko Ozato?
Keiko Ozato is affiliated with the following schools:
- University of California, Irvine
- University of Tokyo
- Baylor College of Medicine
- Johns Hopkins University
- University of Toronto
- University of Iowa
- Columbia University
- Osaka University
- Uniformed Services University of the Health Sciences
- University of Texas Southwestern Medical Center
- Kyoto University
- Harvard University
- University of Lausanne
- Hokkaido University