Keith G. Harding

Q: What Schools Are Affiliated With Keith G. Harding

Keith G. Harding is affiliated with the following schools: Cardiff University, University of Birmingham

Keith G. Harding's AcademicInfluence.com Rankings

Keith G. Harding

Philosophy

#5651

World Rank

#8518

Historical Rank

Logic

#2893

World Rank

#3965

Historical Rank

philosophy Degrees

Download Badge

Philosophy

Why Is Keith G. Harding Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Keith G. Harding CBE FRCGP FRCP FRCS FLSW is a British physician. Harding graduated from Birmingham University with an MBChB degree in Medicine in 1976. Harding is the Director of TIME Institute and Head of the Wound Healing Research Unit in the School of Medicine at Cardiff University. He is Clinical Lead for Wound Healing in the Cardiff & Vale NHS Trust. In September 2013 Harding was appointed Dean of Clinical Innovation at Cardiff University. From 2002 to 2005 he was Head of the Department of Surgery at Cardiff University. He is Editor-in-Chief of the International Wound Journal.

(See a Problem?)

Keith G. Harding's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Wound bed preparation: a systematic approach to wound management (2003) (1232)
Bacteria and wound healing (2004) (886)
Diabetic foot ulcers (2003) (532)
Healing chronic wounds (2002) (431)
Antibacterial Activity of Honey against Strains of Staphylococcus Aureus from Infected Wounds (1999) (405)
Clinical challenges of chronic wounds: searching for an optimal animal model to recapitulate their complexity (2014) (329)
Wound dressings (2006) (287)
Gas Plasma: Medical Uses and Developments in Wound Care (2010) (274)
Science, medicine and the future: healing chronic wounds. (2002) (269)
Psychological Factors and Delayed Healing in Chronic Wounds (2001) (265)
An evaluation of the efficacy of methods used in screening for lower-limb arterial disease in diabetes. (2005) (254)
Alginates from wound dressings activate human macrophages to secrete tumour necrosis factor-alpha. (2000) (213)
Cardiff Wound Impact Schedule: the development of a condition‐specific questionnaire to assess health‐related quality of life in patients with chronic wounds of the lower limb (2004) (213)
Guidelines for the treatment of venous ulcers (2006) (201)
FAILURE OF TETRACHLORODECAOXYGEN ANION COMPLEX TO ASSIST WOUND HEALING (1989) (194)
Defective extracellular matrix reorganization by chronic wound fibroblasts is associated with alterations in TIMP-1, TIMP-2, and MMP-2 activity. (2000) (193)
Wound healing and treatments for people with diabetic foot ulcers (2004) (190)
Wound assessment (2006) (183)
Human Wound Contraction: Collagen Organization, Fibroblasts, and Myofibroblasts (1998) (178)
Wound dressings in diabetic foot disease. (2004) (178)
Serial surgical debridement: A retrospective study on clinical outcomes in chronic lower extremity wounds (2009) (166)
A prospective study of the microbiology of chronic venous leg ulcers to reevaluate the clinical predictive value of tissue biopsies and swabs (2007) (158)
Venous and arterial leg ulcers (2006) (156)
Wound chronicity and fibroblast senescence – implications for treatment (2005) (155)
Estimating the costs associated with the management of patients with chronic wounds using linked routine data (2016) (155)
Early healing rates and wound area measurements are reliable predictors of later complete wound closure (2008) (153)
An in vitro model of chronic wound biofilms to test wound dressings and assess antimicrobial susceptibilities. (2010) (152)
Numerous keratinocyte subtypes involved in wound re-epithelialization. (2006) (148)
Use of 16S Ribosomal DNA PCR and Denaturing Gradient Gel Electrophoresis for Analysis of the Microfloras of Healing and Nonhealing Chronic Venous Leg Ulcers (2004) (147)
Dressing‐related pain in patients with chronic wounds: an international patient perspective (2008) (145)
Causes and effects of the chronic inflammation in venous leg ulcers. (2000) (132)
Comparison of oxidative stress biomarker profiles between acute and chronic wound environments (2004) (130)
Recent advances and emerging treatments (2006) (124)
Wound bed preparation: TIME for an update (2016) (118)
Randomised controlled trial of the use of three dressing preparations in the management of chronic ulceration of the foot in diabetes. (2009) (115)
Pilonidal sinus excision — healing by open granulation (1985) (115)
Anaerobic cocci populating the deep tissues of chronic wounds impair cellular wound healing responses in vitro (2003) (114)
The molecular and clinical impact of hepatocyte growth factor, its receptor, activators, and inhibitors in wound healing. (2006) (113)
Dilemmas in measuring and using pressure ulcer prevalence and incidence: an international consensus (2009) (110)
Manuka Honey Used to Heal a Recalcitrant Surgical Wound (2001) (108)
Use of molecular techniques to study microbial diversity in the skin: Chronic wounds reevaluated (2001) (104)
Effect of sharp debridement using curette on recalcitrant nonhealing venous leg ulcers: A concurrently controlled, prospective cohort study (2005) (102)
Diagnosing foot infection in diabetes. (2004) (100)
Differential expression of matrix metalloproteinases during impaired wound healing of the diabetes mouse. (2002) (100)
Prognostic value of markers of collagen remodeling in venous ulcers (1999) (99)
A comparison of skin grafting and healing by granulation, following axillary excision for hidradenitis suppurativa. (1983) (99)
Role of collagen in wound management (2011) (99)
ABC of wound healing (2006) (99)
ABC of wound healing: Venous and arterial leg ulcers (2006) (97)
The role of lymphocytes in human dermal wound healing. (2000) (96)
Walking performance in people with diabetic neuropathy: benefits and threats (2006) (94)
Diabetic Foot Australia guideline on footwear for people with diabetes (2018) (94)
A comparison of two dressings in the management of chronic wounds. (1997) (93)
The cost-effectiveness of wound management protocols of care. (2000) (92)
Advances in Wound Care and Healing Technology (2000) (91)
Inflammatory-cell subpopulations in keloid scars. (2001) (90)
Cutaneous wound healing: a current perspective. (1995) (89)
Wound management and dressings (2019) (89)
Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications. (2012) (89)
A prospective, multicentre, randomised controlled study of human fibroblast‐derived dermal substitute (Dermagraft) in patients with venous leg ulcers (2013) (88)
Prediction and monitoring the therapeutic response of chronic dermal wounds (2006) (86)
Plantar pressure relief in the diabetic foot using forefoot offloading shoes. (2009) (84)
Molecular analysis of the microflora in chronic venous leg ulceration. (2003) (84)
TIME heals all wounds (2004) (83)
Analysis of Skin Wound Images Using Digital Color Image Processing: A Preliminary Communication (2004) (77)
Non-surgical and drug treatments (2006) (76)
Incisional hernia — when do they occur? (1983) (74)
Early diagnosis is vital in the management of squamous cell carcinomas associated with chronic non healing ulcers: a case series and review of the literature (2004) (72)
Criteria for identifying wound infection. (1994) (70)
Wounds : biology and management (1998) (69)
Iodine released from the wound dressing Iodosorb modulates the secretion of cytokines by human macrophages responding to bacterial lipopolysaccharide. (1997) (69)
Non-healing is associated with persistent stimulation of the innate immune response in chronic venous leg ulcers. (2010) (69)
A randomized controlled trial of larval therapy for the debridement of leg ulcers: Results of a multicenter, randomized, controlled, open, observer blind, parallel group study (2014) (68)
Plantar pressure in off‐loading devices used in diabetic ulcer treatment (2005) (66)
Social support: some pragmatic implications for health care professionals. (1996) (65)
Management of Diabetic Foot Ulcers (2015) (63)
Surgical treatment of hidradenitis suppurativa: case series and review of the literature (2006) (63)
Pressure ulcers (2006) (59)
A comparison of two dressings in pressure sore management. (1997) (59)
Bioresponsive dextrin-rhEGF conjugates: in vitro evaluation in models relevant to its proposed use as a treatment for chronic wounds. (2010) (59)
Wound duration and healing rates: Cause or effect? (2014) (58)
Minimising wound‐related pain at dressing change: evidence‐informed practice (2008) (58)
Evaluation of a new polyurethane foam dressing. (1997) (58)
Potential role of anaerobic cocci in impaired human wound healing (2002) (56)
Ephrin-Bs Drive Junctional Downregulation and Actin Stress Fiber Disassembly to Enable Wound Re-epithelialization (2015) (54)
The influence of diabetes and lower limb arterial disease on cutaneous foot perfusion. (2006) (54)
Methods of measuring wound size: a comparative study. (1994) (53)
Wound Infection in Clinical Practice (2008) (53)
Healing responses of skin and muscle in critical illness (2003) (53)
A randomised controlled 8‐week crossover clinical evaluation of the 3M™ Coban™ 2 Layer Compression System versus Profore™ to evaluate the product performance in patients with venous leg ulcers (2008) (52)
Sustained silver-releasing dressing in the treatment of diabetic foot ulcers. (2005) (52)
The use of Silastic foam dressing in the treatment of advanced hidradenitis suppurativa (1980) (51)
Dressings for treating cavity wounds. (1996) (51)
Investigation of standing balance in patients with diabetic neuropathy at different stages of foot complications. (2008) (51)
Wound exudate and the role of dressings. A consensus document. (2008) (50)
An analysis of replicative senescence in dermal fibroblasts derived from chronic leg wounds predicts that telomerase therapy would fail to reverse their disease-specific cellular and proteolytic phenotype. (2003) (48)
Surface bacteriology of venous leg ulcers and healing outcome (2010) (47)
English for Specific Purposes (2007) (47)
Need for Improved Definition of "Chronic Wounds" in Clinical Studies. (2018) (46)
ORIGINAL RESEARCH–CLINICAL SCIENCE: Reducing wound pain in venous leg ulcers with Biatain Ibu: A randomized, controlled double‐blind clinical investigation on the performance and safety (2008) (46)
Challenging the pressure sore paradigm. (1999) (46)
The management of deep sternal wound infections using vacuum assisted closure™ (V.A.C.®) therapy (2006) (45)
The Impact of Foot Complications on Health-Related Quality of Life in Patients with Diabetes (2000) (45)
The effect of a radiant heat dressing on pressure ulcers. (2000) (44)
Cost and dressing evaluation of hydrofiber and alginate dressings in the mManagement of community-based patients with chronic leg ulceration (2001) (44)
Costs of dressings in the community. (1998) (44)
Venous leg ulcers – the search for a prognostic indicator (2007) (44)
The pathogenesis of hypertrophic/keloid scarring. (1994) (43)
Vacuum Assisted Closure: Recommendations for Use (2008) (43)
Deciphering the impaired cytokine cascades in chronic leg ulcers (review). (2003) (42)
Skin breakdown: the silent epidemic (2007) (42)
A comparison of two amorphous hydrogels in the debridement of pressure sores. (1998) (41)
The physics of sub-bandage pressure measurement. (2000) (41)
Music, Communication and Medicine: Discussion Paper (1989) (40)
A Randomized Crossover Investigation of Pain at Dressing Change Comparing 2 Foam Dressings (2009) (40)
FERM family proteins and their importance in cellular movements and wound healing (review). (2014) (40)
Hepatocyte growth factor regulation: An integral part of why wounds become chronic (2007) (39)
"FINGERTIP UNIT" IN DERMATOLOGY (1989) (39)
Less pain with Biatain–Ibu: initial findings from a randomised, controlled, double‐blind clinical investigation on painful venous leg ulcers (2007) (38)
A prospective, multi‐centre, randomised, open label, parallel, comparative study to evaluate effects of AQUACEL® Ag and Urgotul® Silver dressing on healing of chronic venous leg ulcers (2012) (38)
Risk of plantar ulceration in diabetic patients with single-leg amputation. (2006) (38)
2015 International Working Group on the Diabetic Foot Guidance on the prevention and management of foot problems in diabetes (2015) (37)
Societal pandemic burnout: A COVID legacy (2020) (37)
Pressure sore prevention in a hospice. (1995) (37)
Acute and chronic wounds: differences in self-reported health-related quality of life. (2000) (36)
Exploring the use of an alginate dressing for diabetic foot ulcers. (2001) (36)
National audit of pressure ulcers and incontinence-associated dermatitis in hospitals across Wales: a cross-sectional study (2017) (36)
A prospective, multicentre study on the use of epidermal grafts to optimise outpatient wound management (2016) (35)
Effectiveness and tissue compatibility of a 12‐week treatment of chronic venous leg ulcers with an octenidine based antiseptic – a randomized, double‐blind controlled study (2012) (35)
Clinical and economic burden of wound care in the tropics: a 5‐year institutional population health review (2020) (35)
Cadexomer iodine in ulcers colonised by Pseudomonas aeruginosa. (1997) (35)
Single-Case Research Designs for the Clinician (1991) (35)
Pressure ulcers in patients receiving palliative care: A systematic review (2019) (34)
A clinical investigation into the microbiological status of ‘locally infected’ leg ulcers (2009) (33)
Hyperspectral imaging in wound care: A systematic review (2020) (33)
Nonlinear modeling of venous leg ulcer healing rates (2009) (33)
The use of two dressings for moderately exuding pressure sores. (1994) (32)
Efficacy and safety of the freeze‐dried cultured human keratinocyte lysate, LyphoDerm™ 0.9%, in the treatment of hard‐to‐heal venous leg ulcers (2005) (32)
The structure and composition of chronic wound eschar. (1999) (32)
A pilot study on the effect of topical negative pressure on quality of life. (2007) (32)
A new methodology for costing wound care (2013) (31)
The role of vascular endothelial growth inhibitor in wound healing (2007) (30)
Cost of managing patients with venous leg ulcers (2020) (29)
Epidermal grafting versus split-thickness skin grafting for wound healing (EPIGRAAFT): study protocol for a randomised controlled trial (2016) (29)
Contrasting host immuno‐inflammatory responses to bacterial challenge within venous and diabetic ulcers (2014) (29)
Management of sacrococcygeal pilonidal sinus disease (2018) (29)
Adaptive compression therapy for venous leg ulcers: a clinically effective, patient‐centred approach (2016) (28)
Stability Assessments of Conserved Plant Germplasm (1999) (28)
A is for adults (2014) (28)
Maggot debridement therapy: the current perspectives (2017) (27)
Late development of incisional hernia: an unrecognised problem. (1983) (27)
Chronic wounds (2022) (27)
Expression of IL‐24 and IL‐24 receptors in human wound tissues and the biological implications of IL‐24 on keratinocytes (2012) (26)
Circumference, area and volume of the healing wound. (1994) (26)
Measurement of forces associated with compression therapy (2006) (26)
Prediction of healing time as an aid to the management of open granulating wounds (1983) (26)
Investigating the bacterial barrier properties of four contemporary wound dressings. (2000) (25)
Human skin cancer stem cells: a tale of mice and men (2012) (25)
Hyaluronic acid induces tumour necrosis factor-α production by human macrophages in vitro (1997) (25)
Safety and performance evaluation of a next‐generation antimicrobial dressing in patients with chronic venous leg ulcers (2016) (25)
New horizons in the understanding of the causes and management of diabetic foot disease: report from the 2017 Diabetes UK Annual Professional Conference Symposium (2017) (24)
Guidelines for the prevention of venous ulcers (2008) (24)
The aetiology and healing rates of chronic leg ulcers. (1995) (24)
A study to compare two film dressings used as secondary dressings. (1997) (24)
Challenging passivity in venous leg ulcer care – the ABC model of management (2016) (23)
The clinical and histological effects of Dermagraft® in the healing of chronic venous leg ulcers (2003) (23)
Comparing two dressings for exuding pressure sores in community patients. (1994) (23)
Non‐contact low‐frequency ultrasound therapy compared with UK standard of care for venous leg ulcers: a single‐centre, assessor‐blinded, randomised controlled trial (2015) (22)
Specific growth factors and the healing of chronic wounds. (2001) (22)
The use of cultured dermis in the treatment of diabetic foot ulcers. (1998) (22)
Healing and medicine. (1991) (22)
Evolution or revolution? Adapting to complexity in wound management (2007) (22)
Movement-related variation in forces under compression stockings. (1999) (21)
Evaluating the effectiveness of a dressing for use in malodorous, exuding wounds. (2002) (21)
Dystrophic calcification as a cause for non healing leg ulcers (2005) (21)
Chronic Wounds and Their Management and Prevention is a Significiant Public Health Issue (2010) (21)
Re‐amputation occurrence in the diabetic population in South Wales, UK (2007) (21)
Evidence and wound care: what is it? (2000) (20)
Defining quality of life. (1993) (20)
Acute and chronic wound healing (2015) (20)
Use of a hydrocapillary dressing in the management of highly exuding ulcers: a comparative study. (2005) (20)
Assessing pain at wound dressing-related procedures. (2004) (20)
Molecular angiogenic events of a two‐herb wound healing formula involving MAPK and Akt signaling pathways in human vascular endothelial cells (2013) (19)
COLLAGEN VII EXPRESSION IN HUMAN CHRONIC WOUNDS AND SCARS (1997) (19)
Managing patients unable to tolerate therapeutic compression. (2003) (18)
Dressings for venous leg ulcers (2018) (18)
The Delivery of Health Care Alternatives: Discussion Paper (1990) (18)
Social support for elderly patients with chronic wounds. (1997) (18)
Nicorandil ulcer: moves beyond the mucosa. (2010) (17)
Aesthetics and the Individual in the Practice of Medical Research: Discussion Paper (1991) (17)
How compression therapy works. (1999) (17)
Topical steroids for chronic wounds displaying abnormal inflammation. (2013) (17)
Innovation and wound healing. (2015) (17)
Expression of WAVEs, the WASP (Wiskott–Aldrich syndrome protein) family of verprolin homologous proteins in human wound tissues and the biological influence on human keratinocytes (2010) (17)
Activated leukocyte cell adhesion molecule impacts on clinical wound healing and inhibits HaCaT migration (2011) (17)
Comparing hydrocolloid dressings in management of exuding wounds. (1999) (17)
Measuring quality of life in patients with granulating wounds. (1994) (16)
Ulcerated tophaceous gout (2010) (16)
Managing gravitational eczema and allergic contact dermatitis. (2001) (16)
Use of 16 S Ribosomal DNA PCR and Denaturing Gradient Gel Electrophoresis for Analysis of the Microfloras of Healing and Nonhealing Chronic Venous Leg Ulcers (2004) (16)
Potential roles of suppressor of cytokine signaling in wound healing. (2016) (16)
How to measure success in treating chronic leg ulcers (2009) (16)
Safety and performance of a new non-adhesive foam dressing for the treatment of diabetic foot ulcers. (2004) (15)
Potential implications of interleukin-7 in chronic wound healing (2016) (15)
The use of an oxygenating hydrogel dressing in VLU (2007) (15)
Superficial pressure sores: comparing two regimes. (1994) (15)
A narrative review of the epidemiology and economics of chronic wounds (2021) (14)
Uncommon causes of ulceration (2006) (14)
Tetanus in patients with chronic wounds – are we aware? (2012) (14)
Early use of negative pressure therapy in combination with silver dressings in a difficult breast abscess (2011) (14)
Methods for assessing change in ulcer status. (1995) (14)
Reverse transcription‐polymerase chain reaction detection of collagen transcripts in healing human wounds (1995) (13)
Hyaluronic acid induces tumour necrosis factor-alpha production by human macrophages in vitro. (1997) (13)
New Surfactant-based Dressing Product to Improve Wound Closure Rates of Nonhealing Wounds: A European Multicenter Study Including 1036 Patients. (2016) (13)
Molecular and cellular impact of Psoriasin (S100A7) on the healing of human wounds (2017) (13)
A dynamic regulator: the role of growth factors in tissue repair. (2001) (13)
Silastic foam dressing for skin graft donor sites--a preliminary report. (1980) (13)
The role of Nicorandil in non-healing surgical wounds. (2010) (12)
Factors affecting healing. (1998) (12)
Humidified Warmed CO2 Treatment Therapy Strategies Can Save Lives With Mitigation and Suppression of SARS-CoV-2 Infection: An Evidence Review (2020) (12)
Symmetrical peripheral digital gangrene following severe Plasmodium falciparum malaria‐induced disseminated intravascular coagulopathy (2010) (12)
A comparison of two dressings in pressure sore management. (1997) (12)
‘Woundology’– an emerging clinical specialty (2008) (12)
The effects of hyperbaric oxygen on cultured fibroblasts. (1994) (11)
Expressed in high metastatic cells (Ehm2) is a positive regulator of keratinocyte adhesion and motility: The implication for wound healing. (2013) (11)
Incidence of chronic wounds in Singapore, a multiethnic Asian country, between 2000 and 2017: a retrospective cohort study using a nationwide claims database (2020) (11)
Wound infection: Managing wound infection. (1996) (11)
Effectiveness of an acellular synthetic matrix in the treatment of hard‐to‐heal leg ulcers (2014) (10)
Measurement of the skin microcirculation through intact bandages using laser Doppler flowmetry (2004) (10)
Acute generalised exanthematous pustulosis following intravitreal Ranibizumab (2011) (10)
Managing Wound Infection. (1998) (10)
Impact of pigment epithelium-derived factor on colorectal cancer in vitro and in vivo (2018) (10)
Wound registries – a new emerging evidence resource (2011) (9)
Expression of the SOCS family in human chronic wound tissues: Potential implications for SOCS in chronic wound healing (2016) (9)
Teacher's resource book (1998) (9)
The laboratory evaluation of lower limb perfusion in diabetes mellitus. A clinical review (2005) (9)
Electric Cell-Substrate Impedance Sensing as a Screening Tool for Wound Healing Agents (2012) (9)
A 25-year wound care journey within the evolution of wound care. (2012) (9)
Beacon community program. (2011) (9)
COVID‐19 a short‐term challenge, telewound a lifetime change (2020) (9)
Hue, saturation and intensity in the healing wound image. (1994) (9)
Using modern dressings to effect debridement. (1990) (9)
The clinical evaluation of lower limb perfusion in diabetic foot disease (2003) (9)
Value of wound biopsy in chronic venous ulceration (2004) (9)
Comparing Allevyn cavity wound dressings and Silastic foam. (1992) (9)
New treatments for diabetic neuropathic foot ulceration: Views from a wound healing unit (2003) (8)
Cushing's syndrome and chronic venous ulceration – a clinical challenge (2011) (8)
Going international, English for tourism (1998) (8)
Potential pitfalls of minor surgery in general practice. (1993) (8)
The clinical significance and impact of interleukin 15 on keratinocyte cell growth and migration (2016) (8)
Aspirin for Venous Ulcers: Randomised Trial (AVURT): study protocol for a randomised controlled trial (2015) (8)
Clinical Evaluation of a Novel Topical Negative Pressure Device in Promoting Healing in Chronic Wounds. (2014) (8)
Ankle systolic blood pressure measurement and cuff application (1996) (8)
The effects of education and training on clinical practice in wound healing (2008) (8)
Wound problems due to zinc deficiency (2004) (8)
Effect of human fibroblast‐derived dermis on expansion of tissue from venous leg ulcers (2003) (8)
Recognizing the feet as being at risk from pressure damage. (2001) (8)
Development and validation of a gene expression test to identify hard‐to‐heal chronic venous leg ulcers (2019) (8)
Pattern of expression of CCN family members Cyr61, CTGF and NOV in human acute and chronic wounds. (2011) (8)
Pressure sore prevention in a hospice. (1995) (8)
Trends in wound care – the development of a specialty (2006) (7)
Is wound photography becoming sloppy? (2020) (7)
A spline based method for assessment of wound images (2000) (7)
Making and Taking Health Care Decisions: Discussion Paper (1990) (7)
A pilot multi‐centre prospective randomised controlled trial of RECELL for the treatment of venous leg ulcers (2020) (7)
Amputation and mortality in new-onset diabetic foot ulcers stratified by etiology: response to Moulik, Mtonga, and Gill. (2003) (7)
Neuromuscular electrostimulation on lower limb wounds. (2018) (7)
ABC of wound healing : Traumatic & surgical wounds (2006) (7)
The use of honey in healing a recalcitrant wound following surgical treatment of hidradenitis suppurativa (2001) (6)
Herbicides and transgenic rape (1993) (6)
A rheumatology perspective on cutaneous vasculitis: assessment and investigation for the non‐rheumatologist (2016) (6)
An unusual presentation of a common condition: Allergic contact dermatitis (2018) (6)
Project red and asthmapolis. (2011) (6)
Nutritional intake and wound healing in elderly people. (1993) (6)
Wound healing: potential therapeutic options (2021) (6)
Wound care in an ageing population. (1993) (6)
Five years and counting (2008) (6)
High Season: English for the Hotel and Tourist Industry (1994) (6)
Foams still find favour. Wound management using foam dressings. (1991) (6)
Social Media Can Revolutionise Health Care Provider–Patient Relationship (2014) (6)
The wound-healing matrix. (1992) (6)
Assessment of acceptability and ease of use of gelling fiber dressings in the management of heavily exuding wounds (2019) (5)
Major concerns regarding the generic product specification for wound care. (2019) (5)
Data‐driven specialisation of wound care through artificial intelligence (2019) (5)
Nutritional status of elderly patients with venous ulceration of the leg–report of a pilot study (1993) (5)
The Evidence Debate Continues (2010) (5)
Role of HuR in keratinocyte migration and wound healing. (2011) (5)
Silastic foam elastomer for treating open granulating wounds. (1979) (5)
The molecular and clinical impact of hepatocyte growth factor, its receptor, activators, and inhibitors in wound healing (2006) (5)
Foot Infections in Diabetic Patients: An Overview of the Problem (2004) (5)
Antibiotic prophylaxis for minor dermatological surgery in primary care (2009) (5)
The use of antiseptics in wound care: Critique II. (1996) (5)
Queensland wood properties research during the 1980s. (1990) (5)
Chronic ulcers, calcification and calcified fibrous tumours: phenotypic manifestations of a congenital disorder of heterotopic ossification (2007) (4)
Education and improved clinical outcomes (2017) (4)
Measuring outcomes with complex patients: An audit of the effect of Actiform Cool on painful wounds (2008) (4)
Reimbursement of dressings: a WUWHS statement (2006) (4)
Are chronic wounds a feature of frailty? (2020) (4)
The International Wound Infection Institute—a new global platform for the clinical management of infected wounds (2009) (4)
Innovation in wound healing (2017) (4)
Is 2014 the year of the wound? (2014) (4)
Clinical evaluation of a new pressure-relieving mattress. (1999) (4)
An overview of the relationship between anaemia, iron, and venous leg ulcers (2019) (4)
THE CHRONIC NON-HEALING WOUND : HOW TO MAKE IT BETTER (1998) (4)
The use of a point-of-care test for bacterial protease activity in chronic wounds (2015) (4)
The legacy of the COVID‐19 pandemic and potential impact on persons with wounds (2021) (4)
Quality of life. (1995) (3)
AVURT: aspirin versus placebo for the treatment of venous leg ulcers - a Phase II pilot randomised controlled trial. (2018) (3)
The use of antiseptics in wound care. Critique. (1996) (3)
Wound Healing Research Unit (1991) (3)
A prospective pilot study of thigh‐administered intermittent pneumatic compression in the management of hard‐to‐heal lower limb venous and mixed aetiology ulcers (2019) (3)
Case report and literature review of leishmaniasis as a cause of leg ulceration in the United Kingdom. (2006) (3)
Commentaries on venous leg ulcers diagnostic and treatment draft guideline. (1996) (3)
Can 2015 be a transformative year for diagnostics in wound care? (2015) (3)
An unusual cause of leg ulceration (1999) (3)
Pressure injuries among admissions to a hospital in the tropics (2020) (3)
Tumour endothelial marker-8 in wound healing and its impact on the proliferation and migration of keratinocytes (2015) (3)
In vitro significance of SOCS-3 and SOCS-4 and potential mechanistic links to wound healing (2017) (3)
The next millennium. (1999) (3)
Education: a World of Difference in the Provision of Wound Care (2010) (3)
Evolution or revolution? (2011) (3)
Klippel-Trenaunay syndrome: what are the implications for wound care? (2001) (3)
National approaches to wound treatment and prevention (2012) (3)
Case series evaluation of a silver non-adherent dressing (2011) (3)
Pilonidal Sinus Disease (2003) (3)
Treatment strategies for wound infection (2016) (3)
Major limb amputation and mortality in patients with neuro‐ischaemic lower extremity wounds managed in a tertiary hospital: Focus on the differences among patients with diabetes, peripheral arterial disease and both (2021) (3)
Chronic wounds: a clinical problem requiring ownership and coordination (2022) (3)
Challenges for skin and wound care in the new century. (2000) (3)
An integrated instrumentation approach to the study of wound healing (1998) (3)
Measuring progress to healing: A challenge and an opportunity (2021) (3)
Issues for debate (2005) (3)
Wounds and wound healing: new insights, fresh challenges (2015) (3)
International Wound Journal comes of age (2008) (3)
Wound-related osteomyelitis: a case of containment not cure. (2004) (3)
Journal of wound care nursing. Reach for the sky. (1991) (2)
Skin repair technology (2019) (2)
Are personal health records the answer to better clinician–patient interaction for the treatment of wounds? (2014) (2)
Electrical stimulation in wound care (2013) (2)
Does localized iron loss in venous disease lead to systemic iron deficiency? A descriptive pilot study (2019) (2)
Data capture, analysis, utility and privacy and a COVID legacy (2022) (2)
Innovation and inertia in wounds (2019) (2)
The IWJ editor‐in‐chief discusses the World Union Congress 2008 with the chair of meeting (2007) (2)
Microcirculatory flux and pulsatility in arterial leg ulcers is increased by intermittent neuromuscular electrostimulation of the common peroneal nerve. (2020) (2)
Modified compression therapy in mixed arterial–venous leg ulcers: An integrative review (2021) (2)
Leg ulcers: education for nurses and patients. (1989) (2)
Skin surface temperature changes associated with application of compression therapy (1999) (2)
Initial reduction in ulcer size as a prognostic indicator for complete wound healing: a systematic review of diabetic foot and venous leg ulcers. (2022) (2)
Staphylococcal infection of open granulating wounds (1988) (2)
COVID‐19 consequences in the management of persons with wounds (2022) (2)
Editor‐in‐Chief's perspective (2004) (2)
Nonhealing wounds: recalcitrant, chronic, or not understood? (2000) (2)
Innovation in Pressure Ulcer Prevention and Management (2006) (2)
Prologue: transformational healing solutions. (2015) (2)
The chronic non-healing wound: how to make it better. (1998) (2)
The effects of nicorandil on wound healing (case series) [Abstract] (2008) (2)
Wound management protocols of care (2001) (2)
Ultrasound imaging of the leg in patients with chronic wounds (1999) (2)
Expression of Hepatocyte Growth Factor-Like Protein in Human Wound Tissue and Its Biological Functionality in Human Keratinocytes (2015) (2)
Identifying the molecular and genetic basis for non-healing wounds, scarless healing and scarring: study of human fibroblasts (2004) (2)
CHAPTER 15 – WOUND HEALING IN THE DIABETIC FOOT (2008) (2)
ECIS, Cellular Adhesion and Migration in Keratinocytes (2012) (2)
The evolution of wound care (2016) (2)
Reimbursement for the cost of compression therapy for the management of venous leg ulcers in Australia (2019) (2)
Risk profiling in the prevention and treatment of chronic wounds using artificial intelligence (2022) (2)
Wound Care Requires A Refocusing of Effort–Should 2011 Be The Time? (2010) (1)
Stroke patients. A model of support. (1986) (1)
Cochrane's legacy and its impact on wound care (2009) (1)
Measurement of sub-bandage forces (1999) (1)
Sharp debridement of intransigent venous leg ulcers stimulates healing (2003) (1)
What happens to the contra-lateral foot following diabetic foot amputations? (2008) (1)
An improved cleansing regime for a modified foam cavity dressing. (1995) (1)
A World Union of Wound Healing Societies Initiative (2007) (1)
World Union of Wound Healing Societies Meeting, 2020 (2020) (1)
Development of foot drop following compression therapy (2004) (1)
A new year for the International Wound Journal (2005) (1)
Analysis of macrophage sub-populations in human chronic and acute wounds (2001) (1)
Chronic leg ulcers: beware the 'wolf in sheep's clothing!'. (1997) (1)
Treatment of natal cleft sinus. (1992) (1)
Communities and resistance (2019) (1)
Management of foot ulceration in a patient with diabetes mellitus. (1995) (1)
Markers of extracellular matrix metabolism as predictors of healing in venous ulcers (2000) (1)
Accident and emergency. Dressing down the discomfort. (1985) (1)
Issue Information (2019) (1)
Role of Industry in Wound Healing (2007) (1)
Wound Care World Comes to South Africa (2011) (1)
Who should pay for research? (1993) (1)
Wound Care Challenges in 2006 (2006) (1)
Wound management: The treatment of open granulating wounds can often present a challenge to nurses. Sue Bale and Keith Harding briefly outline current trends in their management (1988) (1)
How millennials could impact the evolution of wound care (2018) (1)
International Wound Journal impact factor increases year on year (2016) (1)
Measurement of wounds – the simplest diagnostic? (2016) (1)
2017 In reflection (2017) (1)
How to manage recurrent orofacial herpes simplex virus-1 lesions (2009) (1)
An Evaluation of the Efficacy of Methods Used in Screening for Lower-Limb Arterial Disease in Diabetes Response to Janssen and Chantelau (2006) (1)
Healing and Medicine (1991) (1)
Publication (translated from original German): Effectiveness of an Acellular Synthetic Matrix as an Adjunct to Standard Care in Venous and Mixed Leg Ulcers: Comparison of Clinical Study Data and Routine Data (2015) (1)
Education in wound care. (1996) (1)
Time for the government to deliver. (1994) (1)
Relationship between peripheral vascular disease and higher plantar pressures in diabetic neuro-ischaemic patients. (2004) (1)
Chronic wound and postamputation claudication pain in a diabetic patient. (2013) (1)
Chronic Wound Healing (2020) (1)
Important News from the International Wound Journal (2020) (1)
What's the point of observation? (2014) (1)
Can health care catch up with technology (2018) (1)
International express : student's book : pre-intermidiate (2014) (1)
PTH-329 Expression of pigment epithelium-derived factor in colorectal cancer (2015) (1)
Realist evaluation of social outcomes in community care: the application of affordance theory to the Lindsay Leg Clubs (2021) (1)
3 layer tubular pressure/support bandages is an alternative and effective form of compression in the management of venous leg ulceration (2004) (1)
Education in wound care. (1996) (1)
Wound care 2010 – a clinician’s perspective! (2007) (1)
Leg Ulcers (1991) (1)
2020 the year we would rather forget (2020) (1)
2021 Surely has to be a year of change (2021) (1)
The role of pressure groups. (1995) (1)
Managing chronic wounds with Acticoat Moisture Control TM (2007) (1)
Pulse oximetry screening for congenital heart disease: A pilot study to determine practicalities of implementation (2015) (0)
The effects of adjuvant chemotherapy on alpha5-beta1 integrin expression of keratinocytes and on wound fibronectin level (1999) (0)
The diabetic foot in the real world (2003) (0)
Information Technology-Enabled Care Management: the Southern Piedmont Beacon Community Story (2012) (0)
More Products? More Research? More Efficient Service Delivery? (2013) (0)
Wound Care Awards 1997. (1997) (0)
A successful first year of open access (2021) (0)
International Express, Pre-Intermediate (2013) (0)
List of contributors (2019) (0)
International express : student's book ; intermediate ; withpocket book and multiROM (2007) (0)
News and comment (1994) (0)
Tourism 3 Teacher's Resource Book (2009) (0)
Don't let the digital imperialists hijack blended learning: putting the case for TLE (2016) (0)
Important Pieces of the Research Puzzle (2010) (0)
The <scp>IWJ</scp> turns 20 (2022) (0)
Retraction (2010) (0)
International express : student's book (2004) (0)
International Express Elementary, Student´s Book, New Edition (2004) (0)
Tourism 3 Student's Book (2009) (0)
English for specific purposes / Keith Harding (2008) (0)
Spanning the globe – an international collaboration over 10 361 miles (2014) (0)
A new year, a big year (2022) (0)
Changes in Laser Doppler Flux in Normal and Lipodermatosclerotic Skin During Compression Therapy (1995) (0)
International Express Intermediate (New edition) - StudentsBook (2006) (0)
International express: Intermediate student's book / Keith Harding & Liz Taylor (2007) (0)
A non-vasculitic rheumatoid ulcer. (1994) (0)
Incidence of Chronic Wounds in a Multi-Ethnic Asian Country Over 18 Years: A Population-Based Cohort Study Using Singapore's Nationwide Claims Database (2020) (0)
Setting standards for research. (1993) (0)
Advances in Acellular Matrices (ECM) for Wound Healing (2016) (0)
Management of a lesion in a patient with necrobiosis lipoidica diabeticorum. (1994) (0)
Evaluating The SF 36 as a Measure of Quality of Life in Patients with Chronic Leg Ulcers (1995) (0)
Book Reviews (2001) (0)
A prospective study on the wound healing and quality of life outcomes of patients with venous leg ulcers in Singapore-Interim analysis at 6 month follow up. (2023) (0)
Retrospective matched cohort study of incidence rates and excess length of hospital stay owing to pressure injuries in an Asian setting (2023) (0)
Management of foot ulceration in a patient with diabetes mellitus. (1995) (0)
Research in Wound Healing (2007) (0)
Postanal sinus. (1981) (0)
The impact of a new intervention for venous leg ulcers: A within-patient controlled trial. (2023) (0)
Reply to: Observation on the article “More details are needed in calculating the burden of disease” (2020) (0)
Quality of life (1995) (0)
The state of wound care in the United Kingdom. (2007) (0)
WUWHS‐Toronto and Beyond (2008) (0)
Postanal sinus. (1980) (0)
Changes in Chronic Wound Stressors Over a Four Month Period (1997) (0)
Regarding "Cutaneous microcirculation in the neuropathic diabetic foot improves significantly but not completely after successful lower extremity revascularization". (2002) (0)
The Chronic Wound Experience: Measuring Stressors (1996) (0)
Management practice at leg ulcer clinics. 3. Factors affecting healing. (1998) (0)
Chronic wounds: Measuring stressors in an elderly population (1995) (0)
A gene expression signature that predicted the clinical outcome of chronic wounds [Abstract] (2014) (0)
A cellular and molecular analysis of the chronic wound fibroblast phenotype (2005) (0)
Importance of imaging to wound care practice (2023) (0)
The IWJ turns 20 (2022) (0)
Final thoughts for 2019 (2019) (0)
Innovation in Pressure Ulcer Prevention and Treatment (2018) (0)
Buchbesprechungen (2007) (0)
Assessing practice in preventing pressure damage. (1999) (0)
Ulcers and Nonhealing Chronic Venous Leg for Analysis of the Microfloras of Healing Denaturing Gradient Gel Electrophoresis Use of 16S Ribosomal DNA PCR and (2014) (0)
Primers Forward Reverse SOCS 1 5 '-GATGGTAGCACACAACCAG 5 '-ACTGAACCTGACCGTACA GAGGAGGAGGAGGAAGGTT SOCS 2 5 '-GGATGGTACTGGGGAAGTAT 5 '-ACTGAACCTGACCGTACA TGGGAGCTATCTCTAATCAA SOCS 3 5 '-TCAAGACCTTCAGCTCCA 5 '-ACTGAACCTGACCGTACAGTCACTGCGCTCCAGTAG SOCS 4 5 '-GGCAGTGTTTTCCAATAAAG 5 '-ACTGAACCTGACCGTACA (2016) (0)
Collagen and cytokine gene expression in lower limb ulcers in humans (1994) (0)
Guidelines for Ethical Publishing (2017) (0)
Conference season (2005) (0)
Founder of Leg Club model awarded Order of the British Empire in recent Queen's Birthday Honours (2015) (0)
The management of a patient with a factitious wound. (1994) (0)
The ‘Olympics’ of wound care arrives in Europe (2016) (0)
Comparative Effectiveness of An Acellular Synthetic Matrix As An Adjunct to Standard Care In The Treatment of Venous And Mixed Leg Ulcers: Modeling of Clinical Data And Routine Data. (2014) (0)
Advances in Acellular Extracellular Matrices (ECM) for Wound Healing (2016) (0)
A Checklist of Stressors Associated With Chronic Wounds (1994) (0)
Topical nitrates in refactory wounds: a potential role in the management of wounds in microvascular disease (2003) (0)
Expression of vegi, vascular endothelial growth inhibitor, and its impact on cellular functions of keratinocytes [Abstract] (2010) (0)
PULMONARY EMBOLUS AFTER CORONARY-ARTERY VEIN GRAFTING (1978) (0)
Is leg pain a significant contributor to health care budget pain? (2015) (0)
Determining authorship. (1994) (0)
New vistas in wound care. Interview by Charlotte Alderman. (1991) (0)
Ten good reasons – to support the International Wound Journal (2011) (0)
nWASP (neural Wiskott-Aldrich syndrome protein) is a novel therapeutic target in human wound healing [Conference Abstract] (2014) (0)
International Wound Journal completes it first 3 years (2006) (0)
Audit in wound care. (1993) (0)
Share your research with us and help the IWJ to grow in 2006 (2005) (0)
Activated leukocyte cell adhesion molecule (ALCAM) - biological impact on vascular endothelial cells [Abstract] (2010) (0)
The IWJ enters its tenth year (2012) (0)
Expression of the suppressor of cytokine signalling (SOCS) family members in chronic wound tissue (2014) (0)
Knowledge of risk factors may not improve management (1994) (0)
The effect of interleukin-17B on an in vitro model of human keratinocyte cell migration during wound healing (2014) (0)
Wound carers around the world (2018) (0)
The expression of interleukin 17c (IL-17c) in chronic wounds and its effect on an in vitro model of keratinocyte cell migration [Abstract] (2014) (0)
Clinical Practice 01–09 (2004) (0)
Cell regeneration therapy as an adjunct to healing in recalcitrant wounds [Abstract] (2008) (0)
Expression of hepatocyte growth factor-like/macrophage stimulating protein in human wound tissue and its biological functionality in human keratinocytes (2014) (0)
Brain-derived neurotrophic factor (bdnf) is a novel therapeutic agent in human wound healing [Abstract] (2014) (0)
Wanted: a new wound dressing. (1979) (0)
Compression Therapy reduces neutrophil priming in venous ulcer disease (1995) (0)
Ehm2 promotes wounds healing; the involvement of FAKand NWasp [Abstract] (2012) (0)
Authors' response. (2013) (0)
0171: PERSONALISING WOUND CARE: A GENE EXPRESSION SIGNATURE FOR PREDICTING CLINICAL OUTCOMES OF VENOUS LEG ULCERS (2015) (0)
Assessment of sub-bandage forces under compression bandages (2000) (0)
P4-09-24: Correlation of Aurora Family Member Expression with Clinical Breast Cancer Prognosis. (2011) (0)
New treatments for old problems? (1997) (0)
Adjunctive therapy for healing venous leg ulcers (2018) (0)
Principles of Treatment of the Chronic Wound (2002) (0)
Is the hepatocyte growth factor regulatory system the reason for wounds becoming chronic (2005) (0)
The role of HuR in keratinocyte migration and wound healing [Abstract] (2011) (0)
The new year brings editorial changes to IWJ (2009) (0)
Evidence and wound care: what is it? If research into wound care is to make a real difference to the way we treat patients, it must be undertaken by practitioners at all levels, argues Keith Harding (2000) (0)
Understanding Biofilm-based Wound Care : What You Need To Know (2011) (0)
Comprar Lecture Notes: Psychiatry | Joseph E. Grey | 9781405118699 | Wiley (2009) (0)
Relationship of extracellular signal-regulated kinase (ERK) and epithelial protein lost in meoplasm(EPLIN) in hacat cell migration [Abstract] (2012) (0)
Role of VEGI/DR3 interactions in keratinocyte growth and migration: Implications to wound healing (2012) (0)
The role of metastasis suppressor 1 (MTSS1) in angiogenesis [Abstract] (2011) (0)
Additional file 2: Figure S1. of Aspirin for Venous Ulcers: Randomised Trial (AVURT): study protocol for a randomised controlled trial (2015) (0)
Personalising wound care: A gene expression signature for predicting clinical outcomes of venous leg ulcers (2015) (0)
The role of infection in delayed healing of open wounds (1984) (0)
Venous ulceration. (1983) (0)
Difficulties in recruiting subjects with partial foot amputations for kinesiological research (2006) (0)
Microbial diversity in biofilms, wounds and medical device (2008) (0)
nWASP Inhibition Increases Wound Healing via TrKb/PLCγ Signalling (2023) (0)
International Wound Journal – A Year in Review (2013) (0)
Recurrence of diffuse large B cell lymphoma presenting as a chronic non healing wound - case report [Abstract] (2011) (0)
British Society for Dermatopathology (2010) (0)
Sensitivity of the Wound Edge Gene Signature “WD14” in Responding to Clinical Change: A Longitudinal Cohort Study (2021) (0)
Application Notes: Wound Education App - Providing digitized wound care information on - the - go (2019) (0)
International wound journal obtains MEDLINE listing (2006) (0)
Dressing cavities. (1990) (0)
Education for nurses and patients: Leg ulcers are a perennial nursing problem. Sue Bale and Keith Harding look at the educational needs of both nurses and patients (1989) (0)
Pressure ulceration and leg ulcers (2009) (0)
Characterisation of biofilms within medical devices [Abstract] (2008) (0)
Ten good reasons – to support the International Wound Journal (2014) (0)
CWCMR_A_162687 19..26 (2019) (0)
Wound dressings and debridement (2014) (0)
World Union of Wound Healing Societies position statement on the ethical considerations for wound care research in humans and animals. (2022) (0)
The maturity of wound healing (2009) (0)
Characterisation of biofilms within medical devices (2008) (0)
Are we any further forward with wound care as a clinical specialty? (2015) (0)
In vitro significance of SOCS-3 and SOCS-4 and potential mechanistic links to wound healing (2017) (0)
One Problem! One Voice! – World Union 2008 (2007) (0)
3. Managing wound infection. (1996) (0)
Effect of Compression Stockings on Neutrophil Priming in Chronic Venous Disease (1995) (0)
Wound managementof care (2001) (0)
Do diabetic patients with foot disease require special consideration when deliberating on intervention for lower limb vascular disease (2003) (0)
Hidradenitis Suppurativa (2019) (0)
ABC of Arterial and Venous Disease (ABC Series) (2017) (0)
Venous ulceration (1993) (0)
A cross‐sector systematic review and synthesis of knowledge on telemedicine interventions in chronic wound management—Implications from a system perspective (2022) (0)
EHM2 promotes wound healing; the involvement of FAK and NWasp (2012) (0)
What happens to the contra-lateral foot with diabetic plantar ulceration? (2008) (0)
Social Support in an Elderly Population: Preliminary Results and Methodological Considerations (1996) (0)
Diagnosis of Raynauds phenomenon using a handheld infrared scanner compared to thermal imaging (2003) (0)
Abstract PS17-48: Potential role of activated leukocyte cell adhesion molecule (ALCAM) in hepatocyte growth factor (HGF) signalling in vascular endothelial cells and implications in breast cancer (2021) (0)
Abstract: Thermal imaging in diabetic foot ulceration (1999) (0)
International Wound Journal 2016: a year in review (2016) (0)
Chronic wound fibroblasts: ageing before their time? (2006) (0)
A successful first year for the IWJ (2004) (0)
Team effort. (1992) (0)
Pilot study comparing Kendall™ AMD antimicrobial foam dressing with ALLEVYN™ Ag hydrocellular antimicrobial dressing in venous leg ulcers (2014) (0)
To oxygenate or not to oxygenate – that is the question! (2007) (0)
Running head: VIRTUAL 3-D ENVIRONMENTS FOR NURSING EDUCATION Evaluating the New Frontier: Virtual 3-D Environments for Nursing Education (2008) (0)
Understanding Local Drivers of Health Outcomes: The North Carolina Community Health Information Portal (2014) (0)

This paper list is powered by the following services:

Other Resources About Keith G. Harding

en.wikipedia.org

What Schools Are Affiliated With Keith G. Harding?

Keith G. Harding is affiliated with the following schools: