Kevin Struhl | Academic Influence

Kevin Struhl's AcademicInfluence.com Rankings

Kevin Struhl

Biology

#3187

World Rank

#4913

Historical Rank

Cell Biology

#69

World Rank

#73

Historical Rank

Molecular Biology

#221

World Rank

#225

Historical Rank

Genetics

#237

World Rank

#284

Historical Rank

biology Degrees

Download Badge

Biology

Kevin Struhl's Degrees

Bachelors Biology Stanford University

Similar Degrees You Can Earn

Best Online Bachelor's in Biology 2025

Why Is Kevin Struhl Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Kevin Struhl is an American molecular biologist and the David Wesley Gaiser Professor of Biological Chemistry and Molecular Pharmacology at Harvard Medical School. Struhl is primarily known for his work on transcriptional regulatory mechanisms in yeast using molecular, genetic, biochemical, and genomic approaches. More recently, he has used related approaches to study transcriptional regulatory circuits involved in cellular transformation and the formation of cancer stem cells.

(See a Problem?)

Kevin Struhl's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project (2007) (5196)
Current Protocols in Molecular Biology (New York: Greene Publishing Associates and Wiley-Interscience). Host-Range Shuttle System for Gene Insertion into the Chromosomes of Gram-negative Bacteria. (1988) (3277)
The ENCODE (ENCyclopedia Of DNA Elements) Project (2004) (2194)
An integrated encyclopedia of DNA elements in the human genome (2012) (2080)
Histone acetylation and transcriptional regulatory mechanisms. (1998) (1856)
A User's Guide to the Encyclopedia of DNA Elements (ENCODE) (2011) (1467)
An Epigenetic Switch Involving NF-κB, Lin28, Let-7 MicroRNA, and IL6 Links Inflammation to Cell Transformation (2009) (1325)
High-frequency transformation of yeast: autonomous replication of hybrid DNA molecules. (1979) (1244)
Targeted recruitment of Set1 histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. (2003) (1163)
Unbiased Mapping of Transcription Factor Binding Sites along Human Chromosomes 21 and 22 Points to Widespread Regulation of Noncoding RNAs (2004) (1154)
Metformin selectively targets cancer stem cells, and acts together with chemotherapy to block tumor growth and prolong remission. (2009) (1062)
The GCN4 basic region leucine zipper binds DNA as a dimer of uninterrupted α Helices: Crystal structure of the protein-DNA complex (1992) (865)
TREX is a conserved complex coupling transcription with messenger RNA export (2002) (830)
STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer. (2010) (827)
Sterile host yeasts (SHY): a eukaryotic system of biological containment for recombinant DNA experiments. (1979) (827)
Methylation of H3-Lysine 79 Is Mediated by a New Family of HMTases without a SET Domain (2002) (823)
Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of Yeast (1986) (798)
Isolation and characterisation of a yeast chromosomal replicator (1979) (713)
The gradient morphogen bicoid is a concentration-dependent transcriptional activator (1989) (621)
Transcriptional noise and the fidelity of initiation by RNA polymerase II (2007) (609)
Inducible formation of breast cancer stem cells and their dynamic equilibrium with non-stem cancer cells via IL6 secretion (2011) (604)
Determinants of nucleosome positioning (2013) (586)
Repression by Ume6 Involves Recruitment of a Complex Containing Sin3 Corepressor and Rpd3 Histone Deacetylase to Target Promoters (1997) (571)
Lysine methylation within the globular domain of histone H3 by Dot1 is important for telomeric silencing and Sir protein association. (2002) (554)
Eaf3 chromodomain interaction with methylated H3-K36 links histone deacetylation to Pol II elongation. (2005) (551)
SIRT7 links H3K18 deacetylation to maintenance of oncogenic transformation (2012) (494)
Fundamentally Different Logic of Gene Regulation in Eukaryotes and Prokaryotes (1999) (488)
Binding of TBP to promoters in vivo is stimulated by activators and requires Pol II holoenzyme (1999) (479)
Ubiquitination of Histone H2B by Rad6 Is Required for Efficient Dot1-mediated Methylation of Histone H3 Lysine 79* (2002) (449)
Poly(dA:dT), a ubiquitous promoter element that stimulates transcription via its intrinsic DNA structure. (1995) (436)
Metformin decreases the dose of chemotherapy for prolonging tumor remission in mouse xenografts involving multiple cancer cell types. (2011) (415)
Naturally occurring poly(dA-dT) sequences are upstream promoter elements for constitutive transcription in yeast. (1985) (402)
Loss of miR-200 inhibition of Suz12 leads to polycomb-mediated repression required for the formation and maintenance of cancer stem cells. (2010) (387)
Intrinsic histone-DNA interactions are not the major determinant of nucleosome positions in vivo (2009) (385)
Metformin inhibits the inflammatory response associated with cellular transformation and cancer stem cell growth (2012) (381)
Distinction and relationship between elongation rate and processivity of RNA polymerase II in vivo. (2005) (379)
Evidence for Eviction and Rapid Deposition of Histones upon Transcriptional Elongation by RNA Polymerase II (2004) (378)
Promoters, activator proteins, and the mechanism of transcriptional initiation in yeast (1987) (374)
Many lncRNAs, 5’UTRs, and pseudogenes are translated and some are likely to express functional proteins (2015) (372)
Intrinsic histone-DNA interactions and low nucleosome density are important for preferential accessibility of promoter regions in yeast. (2005) (367)
GCN4 protein, synthesize in vitro, binds HIS3 regulatory sequences: Implications for general control of amino acid biosynthetic genes in yeast (1985) (365)
The FACT Complex Travels with Elongating RNA Polymerase II and Is Important for the Fidelity of Transcriptional Initiation In Vivo (2003) (353)
Hog1 kinase converts the Sko1-Cyc8-Tup1 repressor complex into an activator that recruits SAGA and SWI/SNF in response to osmotic stress. (2002) (351)
An HNF4α-miRNA Inflammatory Feedback Circuit Regulates Hepatocellular Oncogenesis (2011) (349)
Nucleosome positioning signals in genomic DNA. (2007) (344)
The TATA-binding protein is required for transcription by all three nuclear RNA polymerases in yeast cells (1992) (343)
Targeted Recruitment of the Sin3-Rpd3 Histone Deacetylase Complex Generates a Highly Localized Domain of Repressed Chromatin In Vivo (1998) (337)
Defining the sequence specificity of DNA-binding proteins by selecting binding sites from random-sequence oligonucleotides: analysis of yeast GCN4 protein (1989) (335)
Folding transition in the DMA-binding domain of GCN4 on specific binding to DNA (1990) (331)
Lysine-79 of histone H3 is hypomethylated at silenced loci in yeast and mammalian cells: A potential mechanism for position-effect variegation (2003) (325)
Yap, a novel family of eight bZIP proteins in Saccharomyces cerevisiae with distinct biological functions (1997) (322)
Functional dissection of the yeast Cyc8–Tupl transcriptional co-repressor complex (1994) (319)
A transcriptional signature and common gene networks link cancer with lipid metabolism and diverse human diseases. (2010) (317)
A nuclear receptor-like pathway regulating multidrug resistance in fungi (2008) (313)
Coordinate regulation of yeast ribosomal protein genes is associated with targeted recruitment of Esa1 histone acetylase. (2000) (312)
TBP-associated factors are not generally required for transcriptional activation in yeast (1996) (295)
The Rtf1 Component of the Paf1 Transcriptional Elongation Complex Is Required for Ubiquitination of Histone H2B* (2003) (295)
Genome-wide location and regulated recruitment of the RSC nucleosome-remodeling complex. (2002) (294)
Relationships between p63 binding, DNA sequence, transcription activity, and biological function in human cells. (2006) (291)
GCN4, a eukaryotic transcriptional activator protein, binds as a dimer to target DNA. (1987) (289)
Helix-turn-helix, zinc-finger, and leucine-zipper motifs for eukaryotic transcriptional regulatory proteins. (1989) (280)
A unified nomenclature for protein subunits of mediator complexes linking transcriptional regulators to RNA polymerase II. (2004) (280)
Chromatin Immunoprecipitation for Determining the Association of Proteins with Specific Genomic Sequences In Vivo (2004) (274)
Asf1 mediates histone eviction and deposition during elongation by RNA polymerase II. (2006) (273)
Yeast and human TATA-binding proteins have nearly identical DNA sequence requirements for transcription in vitro (1990) (269)
Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. (1995) (267)
Structural and functional characterization of the short acidic transcriptional activation region of yeast GCN4 protein (1988) (264)
Saturation mutagenesis of the yeast his3 regulatory site: requirements for transcriptional induction and for binding by GCN4 activator protein. (1986) (263)
Histone deacetylase activity of Rpd3 is important for transcriptional repression in vivo. (1998) (260)
The UV response involving the ras signaling pathway and AP-1 transcription factors is conserved between yeast and mammals (1994) (234)
HBO1 histone acetylase activity is essential for DNA replication licensing and inhibited by Geminin. (2010) (233)
The histone deacetylase RPD3 counteracts genomic silencing in Drosophila and yeast (1996) (230)
The transcription factor Ifh1 is a key regulator of yeast ribosomal protein genes (2004) (230)
Molecular mechanisms of transcriptional regulation in yeast. (1989) (228)
Histone Acetylation at Promoters Is Differentially Affected by Specific Activators and Repressors (2001) (225)
Dynamics of global histone acetylation and deacetylation in vivo: rapid restoration of normal histone acetylation status upon removal of activators and repressors. (2002) (220)
Global Analysis of mRNA Isoform Half-Lives Reveals Stabilizing and Destabilizing Elements in Yeast (2014) (220)
The transition between transcriptional initiation and elongation in E. coli is highly variable and often rate limiting. (2006) (220)
NOT1(CDC39), NOT2(CDC36), NOT3, and NOT4 encode a global-negative regulator of transcription that differentially affects TATA-element utilization. (1994) (214)
Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells (2014) (214)
Functional genetic expression of eukaryotic DNA in Escherichia coli. (1976) (214)
MicroRNAs Differentially Regulated by Akt Isoforms Control EMT and Stem Cell Renewal in Cancer Cells (2009) (212)
Gcn4 activator targets Gcn5 histone acetyltransferase to specific promoters independently of transcription. (2000) (212)
MAP Kinase-Mediated Stress Relief that Precedes and Regulates the Timing of Transcriptional Induction (2004) (211)
Mapping accessible chromatin regions using Sono-Seq (2009) (211)
The DNA-binding domains of the jun oncoprotein and the yeast GCN4 transcriptional activator protein are functionally homologous (1987) (199)
Genomic Binding Profiles of Functionally Distinct RNA Polymerase III Transcription Complexes in Human Cells (2010) (198)
Close association of RNA polymerase II and many transcription factors with Pol III genes (2010) (191)
A wide variety of DNA sequences can functionally replace a yeast TATA element for transcriptional activation. (1990) (188)
The new yeast genetics (1983) (184)
Connecting a promoter-bound protein to TBP bypasses the need for a transcriptional activation domain (1995) (184)
Nucleotide sequence and transcriptional mapping of the yeast pet56-his3-ded1 gene region. (1985) (184)
Saturation mutagenesis of a yeast his3 "TATA element": genetic evidence for a specific TATA-binding protein. (1988) (182)
Absolute mRNA levels and transcriptional initiation rates in Saccharomyces cerevisiae. (1996) (177)
Yeast transcriptional regulatory mechanisms. (1995) (176)
Protein kinase A mediates growth-regulated expression of yeast ribosomal protein genes by modulating RAP1 transcriptional activity (1994) (173)
Chromatin Structure and RNA Polymerase II Connection: Implications for Transcription (1996) (170)
Heterochromatin formation involves changes in histone modifications over multiple cell generations (2005) (167)
HBO1 histone acetylase is a coactivator of the replication licensing factor Cdt1. (2008) (166)
Genome-Wide Occupancy Profile of the RNA Polymerase III Machinery in Saccharomyces cerevisiae Reveals Loci with Incomplete Transcription Complexes (2004) (165)
The Swi/Snf Complex Is Important for Histone Eviction during Transcriptional Activation and RNA Polymerase II Elongation In Vivo (2007) (161)
Constitutive and inducible Saccharomyces cerevisiae promoters: evidence for two distinct molecular mechanisms (1986) (161)
The stress-activated Hog1 kinase is a selective transcriptional elongation factor for genes responding to osmotic stress. (2006) (154)
TFIIH phosphorylation of the Pol II CTD stimulates mediator dissociation from the preinitiation complex and promoter escape. (2014) (153)
Genomic analysis of LexA binding reveals the permissive nature of the Escherichia coli genome and identifies unconventional target sites. (2005) (152)
MiR-27b targets PPARγ to inhibit growth, tumor progression, and the inflammatory response in neuroblastoma cells (2011) (151)
The VP16 Activation Domain Interacts with Multiple Transcriptional Components as Determined by Protein-Protein Cross-linking in Vivo * (2002) (150)
Yeast and human TFIID with altered DNA-binding specificity for TATA elements (1992) (149)
Selectivity of ORC binding sites and the relation to replication timing, fragile sites, and deletions in cancers (2016) (149)
The TAFs in the HAT (1998) (149)
An HMG Protein, Hmo1, Associates with Promoters of Many Ribosomal Protein Genes and throughout the rRNA Gene Locus in Saccharomyces cerevisiae (2006) (147)
Systematic evaluation of variability in ChIP-chip experiments using predefined DNA targets. (2008) (147)
Activator-specific recruitment of TFIID and regulation of ribosomal protein genes in yeast. (2002) (142)
The JUN oncoprotein, a vertebrate transcription factor, activates transcription in yeast (1988) (141)
An integrated transcriptional regulatory circuit that reinforces the breast cancer stem cell state (2012) (139)
Mechanisms of transcriptional activation in vivo: two steps forward. (1996) (133)
Inflammatory regulatory network mediated by the joint action of NF-kB, STAT3, and AP-1 factors is involved in many human cancers (2019) (131)
A functional evolutionary approach to identify determinants of nucleosome positioning: a unifying model for establishing the genome-wide pattern. (2012) (131)
Production of a functional eukaryotic enzyme in Escherichia coli: cloning and expression of the yeast structural gene for imidazole-glycerolphosphate dehydratase (his3). (1977) (130)
Increased recruitment of TATA-binding protein to the promoter by transcriptional activation domains in vivo. (1994) (129)
The Cyc8-Tup1 complex inhibits transcription primarily by masking the activation domain of the recruiting protein. (2011) (127)
NF-Y coassociates with FOS at promoters, enhancers, repetitive elements, and inactive chromatin regions, and is stereo-positioned with growth-controlling transcription factors (2013) (127)
The transition from transcriptional initiation to elongation. (2008) (122)
Activator-mediated recruitment of the RNA polymerase II machinery is the predominant mechanism for transcriptional activation in yeast. (1998) (122)
An HNF4α-miRNA Inflammatory Feedback Circuit Regulates Hepatocellular Oncogenesis (2013) (121)
SAGA and ATAC histone acetyl transferase complexes regulate distinct sets of genes and ATAC defines a class of p300-independent enhancers. (2011) (121)
Introduction of plasmid DNA into cells. (2001) (120)
The histone H3-like TAF is broadly required for transcription in yeast. (1998) (119)
Cloning of random-sequence oligodeoxynucleotides. (1986) (118)
Chromatin Immunoprecipitation for Determining the Association of Proteins with Specific Genomic Sequences In Vivo (2004) (118)
ATR1, a Saccharomyces cerevisiae gene encoding a transmembrane protein required for aminotriazole resistance (1988) (118)
Akt2 regulates all Akt isoforms and promotes resistance to hypoxia through induction of miR-21 upon oxygen deprivation. (2011) (117)
Regulatory sites for his3 gene expression in yeast (1982) (116)
Distinguishing between mechanisms of eukaryotic transcriptional activation with bacteriophage T7 RNA polymerase (1987) (115)
Genomic analysis of protein–DNA interactions in bacteria: insights into transcription and chromosome organization (2007) (114)
Quantitative sequential chromatin immunoprecipitation, a method for analyzing co-occupancy of proteins at genomic regions in vivo. (2004) (113)
CDC39, an essential nuclear protein that negatively regulates transcription and differentially affects the constitutive and inducible HIS3 promoters. (1993) (113)
Activator-specific recruitment of Mediator in vivo (2006) (111)
The TBP-TFIIA interaction in the response to acidic activators in vivo. (1995) (111)
Yeast mRNA initiation sites are determined primarily by specific sequences, not by the distance from the TATA element. (1985) (110)
Genetic properties and chromatin structure of the yeast gal regulatory element: an enhancer-like sequence. (1984) (107)
Mechanisms for diversity in gene expression patterns (1991) (104)
Functional distinctions between yeast TATA elements (1989) (103)
Functional differences between yeast and human TFIID are localized to the highly conserved region (1991) (102)
Transcription of the his3 gene region in Saccharomyces cerevisiae. (1981) (102)
Extensive functional overlap between sigma factors in Escherichia coli. (2006) (101)
Extensive functional overlap between σ factors in Escherichia coli (2006) (97)
Alternative to the soft-agar assay that permits high-throughput drug and genetic screens for cellular transformation (2015) (97)
Mediator Undergoes a Compositional Change during Transcriptional Activation. (2016) (96)
Genomic Studies with Escherichia coli MelR Protein: Applications of Chromatin Immunoprecipitation and Microarrays (2004) (96)
Regional codon randomization: defining a TATA-binding protein surface required for RNA polymerase III transcription. (1993) (96)
TAF-Containing and TAF-independent forms of transcriptionally active TBP in vivo. (2000) (93)
Introduction of plasmid DNA into cells. (2001) (93)
A physical, genetic and transcriptional map of the cloned his3 gene region of Saccharomyces cerevisiae. (1980) (89)
Eaf3 Regulates the Global Pattern of Histone Acetylation in Saccharomyces cerevisiae (2004) (88)
Inhibition of miR-193a expression by Max and RXRα activates K-Ras and PLAU to mediate distinct aspects of cellular transformation. (2011) (88)
Mutations that define the optimal half-site for binding yeast GCN4 activator protein and identify an ATF/CREB-like repressor that recognizes similar DNA sites (1990) (88)
Yeast NC2 Associates with the RNA Polymerase II Preinitiation Complex and Selectively Affects Transcription In Vivo (2001) (87)
An efficient method for generating proteins with altered enzymatic properties: application to beta-lactamase. (1989) (86)
Nucleosome depletion at yeast terminators is not intrinsic and can occur by a transcriptional mechanism linked to 3’-end formation (2010) (86)
Genomewide Identification of Sko1 Target Promoters Reveals a Regulatory Network That Operates in Response to Osmotic Stress in Saccharomyces cerevisiae (2005) (83)
Yeast homologues of higher eukaryotic TFIID subunits. (1996) (82)
Splitting of H3–H4 tetramers at transcriptionally active genes undergoing dynamic histone exchange (2011) (82)
ACR1, a yeast ATF/CREB repressor. (1992) (81)
Changing Fos oncoprotein to a Jun-independent DNA-binding protein with GCN4 dimerization specificity by swapping "leucine zippers" (1989) (80)
Mechanism of differential utilization of the his3 TR and TC TATA elements (1995) (77)
High-throughput sequencing reveals a simple model of nucleosome energetics (2010) (74)
Aca1 and Aca2, ATF/CREB Activators in Saccharomyces cerevisiae, Are Important for Carbon Source Utilization but Not the Response to Stress (2000) (73)
Histone H3R2 symmetric dimethylation and histone H3K4 trimethylation are tightly correlated in eukaryotic genomes. (2012) (73)
Duality of TBP, the universal transcription factor. (1994) (70)
Targeted Recruitment of Rpd3 Histone Deacetylase Represses Transcription by Inhibiting Recruitment of Swi/Snf, SAGA, and TATA Binding Protein (2002) (69)
Adaptability at the protein-DNA interface is an important aspect of sequence recognition by bZIP proteins. (1993) (68)
Where Does Mediator Bind In Vivo? (2009) (68)
TFIIS Enhances Transcriptional Elongation through an Artificial Arrest Site In Vivo (2001) (67)
Direct selection for gene replacement events in yeast. (1983) (66)
The yeast his3 promoter contains at least two distinct elements. (1982) (65)
Genetic analysis of the role of Pol II holoenzyme components in repression by the Cyc8-Tup1 corepressor in yeast. (2000) (64)
Mutations on the DNA-binding surface of TATA-binding protein can specifically impair the response to acidic activators in vivo (1995) (63)
Analysis of Saccharomyces cerevisiae his3 transcription in vitro: biochemical support for multiple mechanisms of transcription (1990) (62)
Uracil interference, a rapid and general method for defining protein-DNA interactions involving the 5-methyl group of thymines: the GCN4-DNA complex. (1992) (62)
The Ground State and Evolution of Promoter Region Directionality (2017) (62)
A Paradigm for Precision (2001) (61)
The leucine zipper symmetrically positions the adjacent basic regions for specific DNA binding. (1991) (60)
The glutamine-rich activation domains of human Sp1 do not stimulate transcription in Saccharomyces cerevisiae (1995) (60)
Preferential Accessibility of the Yeast his3 Promoter Is Determined by a General Property of the DNA Sequence, Not by Specific Elements (2000) (58)
Ubiquitination of Histone H 2 B by Rad 6 Is Required for Efficient Dot 1-mediated Methylation of Histone H 3 Lysine 79 * (2002) (58)
Mot1 Associates with Transcriptionally Active Promoters and Inhibits Association of NC2 in Saccharomyces cerevisiae (2002) (58)
Extensive chromatin fragmentation improves enrichment of protein binding sites in chromatin immunoprecipitation experiments (2008) (56)
Transcriptional activation by artificial recruitment in yeast is influenced by promoter architecture and downstream sequences. (1999) (55)
A new class of activation-defective TATA-binding protein mutants: evidence for two steps of transcriptional activation in vivo (1996) (54)
Association of distinct yeast Not2 functional domains with components of Gcn5 histone acetylase and Ccr4 transcriptional regulatory complexes (1998) (54)
Defining the consensus sequences of E.coli promoter elements by random selection. (1988) (54)
Endonucleases (1989) (54)
Yeast GCN4 as a probe for oncogenesis by AP-1 transcription factors: transcriptional activation through AP-1 sites is not sufficient for cellular transformation. (1992) (52)
JNK1 phosphorylation of Cdt1 inhibits recruitment of HBO1 histone acetylase and blocks replication licensing in response to stress. (2011) (51)
The use of random-sequence oligonucleotides for determining consensus sequences. (1987) (51)
Cellular stress alters the transcriptional properties of promoter-bound Mot1-TBP complexes. (2004) (50)
Genome-Wide Mapping Indicates That p73 and p63 Co-Occupy Target Sites and Have Similar DNA-Binding Profiles In Vivo (2010) (49)
Evidence against a genomic code for nucleosome positioning Reply to “Nucleosome sequence preferences influence in vivo nucleosome organization” (2010) (49)
Tc, an unusual promoter element required for constitutive transcription of the yeast HIS3 gene (1990) (48)
Nutrient Deprivation Elicits a Transcriptional and Translational Inflammatory Response Coupled to Decreased Protein Synthesis (2018) (47)
Mechanisms of increasing expression of a yeast gene in Escherichia coli. (1980) (47)
Differential Gene Regulation by Selective Association of Transcriptional Coactivators and bZIP DNA-Binding Domains (2006) (47)
Association of RNA polymerase with transcribed regions in Escherichia coli. (2004) (46)
Yeast and human TFIIDs are interchangeable for the response to acidic transcriptional activators in vitro. (1992) (46)
Artificial Recruitment of TFIID, but Not RNA Polymerase II Holoenzyme, Activates Transcription in Mammalian Cells (2000) (46)
Introduction of Plasmid DNA into Cells (2000) (45)
ArticleEaf 3 Chromodomain Interaction with Methylated H 3K 36 Links Histone Deacetylation to Pol II Elongation (45)
Conserved and nonconserved functions of the yeast and human TATA-binding proteins. (1994) (44)
The Mating-Type Proteins of Fission Yeast Induce Meiosis by Directly Activating mei3 Transcription (1998) (44)
Deletion mapping a eukaryotic promoter. (1981) (43)
LINC00520 is induced by Src, STAT3, and PI3K and plays a functional role in breast cancer (2016) (43)
Transcriptome-scale RNase-footprinting of RNA-protein complexes (2015) (43)
Extensive divergence of yeast stress responses through transitions between induced and constitutive activation (2011) (41)
Species-specific factors mediate extensive heterogeneity of mRNA 3′ ends in yeasts (2013) (41)
Mutagenesis with degenerate oligonucleotides: an efficient method for saturating a defined DNA region with base pair substitutions. (1987) (41)
Negative control at a distance mediates catabolite repression in yeast (1985) (41)
Determinants of half-site spacing preferences that distinguish AP-1 and ATF/CREB bZIP domains (1995) (41)
Highly conserved residues in the bZIP domain of yeast GCN4 are not essential for DNA binding (1991) (41)
Genome-wide location analysis of the stress-activated MAP kinase Hog1 in yeast. (2006) (40)
A nucleosome-positioning sequence is required for GCN4 to activate transcription in the absence of a TATA element (1990) (40)
Requirements for RNA polymerase II preinitiation complex formation in vivo (2019) (39)
Evidence that Mediator is essential for Pol II transcription, but is not a required component of the preinitiation complex in vivo (2017) (39)
Subcloning of DNA Fragments (1991) (39)
Yeast GCN4 transcriptional activator protein interacts with RNA polymerase II in vitro. (1989) (39)
Molecular characterization of GCD1, a yeast gene required for general control of amino acid biosynthesis and cell-cycle initiation. (1988) (38)
Molecular mechanisms of transcriptional regulation in yeast (1990) (38)
Lysine methyltransferase 2D regulates pancreatic carcinogenesis through metabolic reprogramming (2018) (37)
A severely defective TATA-binding protein-TFIIB interaction does not preclude transcriptional activation in vivo (1997) (36)
Expanding the repertoire of plasmids for PCR‐mediated epitope tagging in yeast (2008) (36)
Synergistic transcriptional enhancement does not depend on the number of acidic activation domains bound to the promoter. (1991) (36)
Chipper: discovering transcription-factor targets from chromatin immunoprecipitation microarrays using variance stabilization (2005) (35)
Promoter elements, regulatory elements, and chromatin structure of the yeast his3 gene. (1983) (34)
STAT3 acts through pre-existing nucleosome-depleted regions bound by FOS during an epigenetic switch linking inflammation to cancer (2015) (34)
Epigenomics: A Roadmap, But to Where? (2008) (33)
Transcriptional activation in yeast cells lacking transcription factor IIA. (1999) (32)
Two related regulatory sequences are required for maximal induction of Saccharomyces cerevisiae his3 transcription (1987) (32)
Enzymatic Manipulation of DNA and RNA (2002) (31)
TFIIA Has Activator-dependent and Core Promoter Functions in Vivo * 210 (2000) (30)
Equivalent mutations in the two repeats of yeast TATA-binding protein confer distinct TATA recognition specificities (1994) (30)
Gene regulation. A paradigm for precision. (2001) (30)
The Rtf 1 Component of the Paf 1 Transcriptional Elongation Complex Is Required for Ubiquitination of Histone H 2 B * (2003) (30)
Yeast upstream activator protein GCN4 can stimulate transcription when its binding site replaces the TATA element. (1989) (29)
Constitutive and coordinately regulated transcription of yeast genes: promoter elements, positive and negative regulatory sites, and DNA binding proteins. (1986) (29)
YAP and TAZ are transcriptional co-activators of AP-1 proteins and STAT3 during breast cellular transformation (2021) (28)
Multiple functions of the nonconserved N-terminal domain of yeast TATA-binding protein. (2001) (28)
Hog 1 Kinase Converts the Sko 1-Cyc 8-Tup 1 Repressor Complex into an Activator that Recruits SAGA and SWI / SNF in Response to Osmotic Stress michos (2002) (27)
Control of Gene Expression (1974) (27)
Transcriptional activation by TFIIB mutants that are severely impaired in interaction with promoter DNA and acidic activation domains (1997) (27)
Promotor mutants of the yeast his3 gene. (1981) (26)
Role of the conserved leucines in the leucine zipper dimerization motif of yeast GCN4. (1992) (26)
Is DNA methylation of tumour suppressor genes epigenetic? (2014) (25)
Dimerization of leucine zippers analyzed by random selection. (1993) (25)
Yeast transcription factors. (1993) (24)
Targeted profiling of RNA translation reveals mTOR-4EBP1/2-independent translation regulation of mRNAs encoding ribosomal proteins (2018) (24)
Extensive Structural Differences of Closely Related 3' mRNA Isoforms: Links to Pab1 Binding and mRNA Stability. (2018) (23)
Mutations in the bZIP domain of yeast GCN4 that alter DNA-binding specificity. (1992) (22)
A physiological study of functional expression in Escherichia coli of the cloned yeast imidazoleglycerolphosphate dehydratase gene. (1980) (21)
Ribonucleases (1989) (21)
Iwr1 Protein Is Important for Preinitiation Complex Formation by All Three Nuclear RNA Polymerases in Saccharomyces cerevisiae (2011) (19)
Analysis of protein co-occupancy by quantitative sequential chromatin immunoprecipitation. (2004) (19)
Region of Yeast TAF 130 Required for TFIID To Associate with Promoters (2001) (19)
Position effects in Saccharomyces cerevisiae. (1981) (18)
Promoter-specific dynamics of TATA-binding protein association with the human genome (2019) (18)
An efficient method for generating proteins with altered enzymatic properties: Application to β-lactamase (1992) (18)
Genome-scale identification of transcription factors that mediate an inflammatory network during breast cellular transformation (2018) (18)
TATA-Binding Protein Mutants That Increase Transcription from Enhancerless and Repressed Promoters In Vivo (2000) (18)
S100A8/S100A9 cytokine acts as a transcriptional coactivator during breast cellular transformation (2021) (18)
GCN 4 , a eukaryotic transcriptional activator protein , binds as a diner to target DNA (18)
Hybridization analysis of DNA blots. (2001) (17)
Suppressors of Saccharomyces cerevisiae his3 promoter mutations lacking the upstream element (1985) (16)
Activation and repression mechanisms in yeast. (1998) (16)
Chipper: discovering transcription-factor targets from chromatin immunoprecipitation microarrays using variance stabilization (2005) (16)
The FACT Complex Travels with Elongating RNA Polymerase II and Is Important for the Fidelity of Transcriptional Initiation In Vivo (2004) (14)
Mapping 3′ mRNA Isoforms on a Genomic Scale (2015) (14)
DNA‐Dependent DNA Polymerases (1997) (14)
Secondary structures involving the poly(A) tail and other (2014) (13)
The transcriptional elongation rate regulates alternative polyadenylation in yeast (2020) (13)
Reverse biochemistry: methods and applications for synthesizing yeast proteins in vitro. (1991) (13)
A TATA-Binding Protein Mutant Defective for TFIID Complex Formation In Vivo (1999) (12)
Rank-statistics based enrichment-site prediction algorithm developed for chromatin immunoprecipitation on chip experiments (2006) (12)
Characterisation of 3' end formation of the yeast HIS3 mRNA. (1997) (11)
CDC 39 , an essential nuclear protein that negatively regulates transcription and differentially affects the constitutive and inducible HIS 3 promoters (11)
Effect of deletion and insertion on double-strand-break repair in Saccharomyces cerevisiae. (1987) (11)
Chromatin Immunoprecipitation for Determining the Association of Proteins with Specific Genomic Sequences In Vivo (2004) (11)
S1 Analysis of Messenger RNA Using Single‐Stranded DNA Probes (1999) (10)
Selective roles for TATA-binding-protein-associated factors in vivo. (1997) (10)
ArticleAsf 1 Mediates Histone Eviction and Deposition during Elongation by RNA Polymerase II (10)
Methylation and Uracil Interference Assays for Analysis of Protein‐DNA Interactions (1996) (10)
ResourceRelationships between p 63 Binding , DNA Sequence , Transcription Activity , and Biological Function in Human Cells (10)
Differential analysis for high density tiling microarray data (2007) (10)
CHAPTER 2 – Yeast Promoters (1986) (9)
Transcriptional activation: mediator can act after preinitiation complex formation. (2005) (8)
Yeast HIS3 expression in Escherichia coli depends upon fortuitous homology between eukaryotic and prokaryotic promoter elements. (1986) (8)
Interpreting Chromatin Immunoprecipitation Experiments (2008) (8)
Comparison of transcriptional initiation by RNA polymerase II across eukaryotic species (2021) (8)
Saturation mutagenesis of a yeast his 3 " TATA element " : Genetic evidence for a specific TATA-binding protein ( gene regulation / eukaryotic promoters / transcription / DNA-binding protein / mRNA initiation ) (7)
Reply to Evidence against a genomic code for nucleosome positioning (2010) (7)
Chromatin and transcription factors : who's on first? (1993) (7)
Ammonia-sensitive mutant of Klebsiella aerogenes (1976) (6)
A rapid method for determining tRNA charging levels in vivo: analysis of yeast mutants defective in the general control of amino acid biosynthesis. (1986) (6)
Reagents and radioisotopes used to manipulate nucleic acids. (2001) (6)
Transcriptional enhancement by acidic activators. (1996) (6)
The ENCODE (ENCyclopedia Of DNA Elements) Project The ENCODE Project Consortium (2004) (6)
Conservation and DNA sequence arrangement of the DNA polymerase I gene region from Klebsiella aerogenes, Klebsiella pneumoniae and Escherichia coli. (1980) (5)
Different SP1 binding dynamics at individual genomic loci in human cells (2020) (5)
Synthesizing Proteins In Vitro by Transcription and Translation of Cloned Genes (1999) (5)
NUCLEUS AND GENE EXPRESSION MULTIPROTEIN COMPLEXES, MECHANISTIC CONNECTIONS AND NUCLEAR ORGANIZATION (1999) (5)
Deletion, recombination and gene expression involving the bacteriophage λ attachment site (1981) (5)
Coordinate Regulation of Yeast Ribosomal Protein Genes Is Associated with Targeted Recruitment of Esa 1 Histone Acetylase nucleosomes (2000) (5)
Suppression of a yeast amber mutation in Escherichia coli (1979) (5)
31 Yeast GCN4 Transcriptional Activator Protein (1992) (5)
Transcriptional activation by yeast GCN4, a functional homolog to the jun oncoprotein. (1988) (4)
Functional distinctions between yeast TATA (2003) (4)
Pheno-RNA, a method to associate genes with a specific phenotype, identifies genes linked to cellular transformation (2020) (4)
Defining In Vivo Targets of Nuclear Proteins by Chromatin Immunoprecipitation and Microarray Analysis (2004) (3)
UNIT 3.13 Ribonucleases (2001) (3)
A compensatory link between cleavage/polyadenylation and mRNA turnover regulates steady-state mRNA levels in yeast (2022) (3)
[Histone H4 lysine 16 acetylation: from genome regulation to tumoral progression]. (2007) (3)
3′ Untranslated Regions Are Modular Entities That Determine Polyadenylation Profiles (2022) (3)
RAPID SELECTION AND SCREENING METHODS FOR THE ISOLATION OF PARTICULAR CLONED EUKARYOTIC DNA SEQUENCES (1977) (3)
Incorporation of Drosophila TAF110 into the yeast TFIID complex does not permit the Sp1 glutamine‐rich activation domain to function in vivo (1999) (3)
From E. coli to elephants (2002) (3)
Fundamentally Different Logic Minireview of Gene Regulation in Eukaryotes and Prokaryotes (1999) (2)
Cellular Stress Alters the Transcriptional Properties of Promoter-Bound Mot 1-TBP Complexes 2000 (2004) (2)
The hisB463 Mutation and Expression of a Eukaryotic Protein in Escherichia coli (2008) (2)
Charting a revolution (1991) (2)
Production of a functional eukaryotic enzyme in Escherichia coli : Cloning and expression of the yeast structural gene for imidazole-glycerolphosphate dehydratase ( his 3 ) ( gene expression / cloned yeast genes / gene selection / yeast his 3 ) (2)
STRUCTURAL AND FUNCTIONAL ANALYSIS OF THE HIS3 GENE AND GALACTOSE INDUCIBLE SEQUENCES IN YEAST (1979) (2)
High level and molecular nature of transcriptional noise in yeast cells (2022) (2)
Nucleotide-level linkage of transcriptional elongation and polyadenylation (2022) (2)
and Saccharomyces cerevisiae of NC 2 in Active Promoters and Inhibits Association Mot 1 Associates with Transcriptionally (2002) (2)
Cloning cookbook for the laboratory (1985) (2)
Regulatory network controlling tumor-promoting inflammation in human cancers (2018) (2)
Enzymatic Manipulation of DNA and RNA (2006) (2)
Systematic evaluation of variability in ChIP-chip experiments using data (2008) (2)
Genome-wide maps of DNA-protein interactions using a yeast ORF and intergenic microarray (1999) (2)
Correction: Evidence that Mediator is essential for Pol II transcription, but is not a required component of the preinitiation complex in vivo (2017) (2)
Supplemental Data Relationships between p 63 Binding , DNA Sequence , Transcription Activity , and Biological Function in Human Cells (2006) (1)
Nucleosome positioning signals in genomic DNA data (2007) (1)
Global mapping of functionally-important and regulatory regions on human chromosomes 21 and 22 reveal novel regulatory networks in the human genome (2003) (1)
STAT3 acts through pre-existing nucleosome-depleted regions bound by FOS during an epigenetic switch linking inflammation to cancer (2015) (1)
GENETIC SELECTIONS AND THE CLONING OF PROKARYOTIC AND EUKARYOTIC GENES (1976) (1)
Analysis of Protein Co‐Occupancy by Quantitative Sequential Chromatin Immunoprecipitation (2004) (1)
A wide variety of DNA sequences can functionally replace a.yeast TATA. element for transcnpnonal acuvaUon (2007) (1)
Preface (2012) (1)
Deletion mapping a eukaryotic promoter ( gene expression / gene regulation / yeast his 3 gene / transcription / recombinant DNA ) (1)
Deletion, recombination and gene expression involving the bacteriophage lambda attachment site. (1981) (0)
Tumor and Stem Cell Biology Akt 2 Regulates All Akt Isoforms and Promotes Resistance to Hypoxia through Induction of miR-21 upon Oxygen Deprivation (2011) (0)
Saccharomyces cerevisiae. human Sp1 do not stimulate transcription in The glutamine-rich activation domains of (2013) (0)
Nucleic Acids Research A rapid A rapid method for determningw tRNA charging levels in vivo : anailysis of yeas mutants defective in the general control of amino acid biosynthesis (0)
Effect of deletion and insertion on double-strand-break repair in Saccharomyces cerevisiae (1987) (0)
Author response: Comparison of transcriptional initiation by RNA polymerase II across eukaryotic species (2021) (0)
Hidden complexities of the human genome revealed by unbiased mapping of transcriptome (2003) (0)
Genome-scale identification of transcription factors that mediate an inflammatory network during breast cellular transformation (2018) (0)
Transcriptional Activator Protein , GCN 4 of Yeas (2003) (0)
BINDING DOMAIN OF YEAST GCN 4 PROTEIN (2011) (0)
GCN 4 , the Yeost Version (2011) (0)
Highly Conserved Residues inthebZIPDomainofYeastGCN4 AreNotEssential forDNA Binding (1991) (0)
Condition-specific 3' mRNA isoform half-lives and stability elements in yeast. (2023) (0)
How proteins find their genomic targets in vivo? Implications for epigenetic inheritance (2009) (0)
Miniaturizing 3D assay for high-throughput drug and genetic screens for small patient-derived tumor samples (Conference Presentation) (2017) (0)
TTTTC TTTTT CTATTACTCTT GGCC TCCTCTAGTACACTCTATATTTTTTTATGC CTCGGTAATGATTTTCATTTTTTiTTTTTCCAC CTA ' GCGGA ' TGAC ' TC TTTTTTTTT ' CTT ' A AAAAGAAAAAGATAATGAGAACCGGAGGAGATCAT GTGAGATATAAAAAATACGGAGC CATTACTAAAAGTAAAAAAAGGTGGATC GCCTAC TGAGAAAAAAAAAGAAT (0)
Reagents and Radioisotopes Used to Manipulate Nucleic Acids (1992) (0)
Analysis ofSaccharomyces cerevisiae his3Transcription InVitro: Biochemical Support forMultiple Mechanisms ofTranscription (1990) (0)
Kevin Struhl factor Cdt 1 HBO 1 histone acetylase is a coactivator of the replication licensing Material Supplemental (2008) (0)
MafB, WDR77, and ß-catenin interact with each other and have similar genome association profiles (2022) (0)
Kevin Struhl. Interview. (2008) (0)
GENETIC AND EUKARYOTIC PHYSICAL SELECTION OF GFNES CLONED IN E . COLI (2011) (0)
MOLECULAR MECHANISMS OF TRAl'SCRIPTIONAL REGULATION IN YEAST (1989) (0)
Bindingof TBP topromoters in vivo isstimulatedbyactivators and requiresPol II holoenzyme (0)
RNA‐Protein Interactions (2003) (0)
Functional genetic expression of eukaryotic DNA in Escherichia coli. 1976. (1992) (0)
Book Review The Recombinant DNA Controversy: A Memoir — Science, Politics, and the Public Interest; 1974–1981 By Donald S. Fredrickson. 388 pp., illustrated. Washington, D.C., ASM Press, 2001. $39.95. 1-55581-222-8 (2001) (0)
Requirements for RNA polymerase II preinitiation complex formation in 1 vivo 2 3 4 5 6 Running title : Requirements for preinitiation complex formation in vivo (0)
UNIT 3.12 Endonucleases (2001) (0)
BSTRACT The GCD 1 gene product of Saccharomyces cerevisiae has been implicated in the coordination of the cell cycle with the general control of amimo acid biosynthesis ( (2003) (0)
Author response: Requirements for RNA polymerase II preinitiation complex formation in vivo (2019) (0)
ACR1, a yeast ATF/CREB repressor (1992) (0)
Analysis of DNA‐Protein Interactions Using Proteins Synthesized In Vitro from Cloned Genes (1993) (0)
Chromatin Structure Minireview and RNA Polymerase II Connection : Implications for Transcription (1997) (0)
Editorial Board (2009) (0)
Pheno-RNA, a method to identify genes linked to a specific phenotype: application to cellular transformation (2020) (0)
Enzymatic labeling of DNA. (2001) (0)
Enzymatic Manipulation of DNA and RNA (2009) (0)
An epigenetic switch linking inflammation to cancer and the use of metformin as an anti-cancer drug (2012) (0)
Functional analysis of a random-sequence chromosome reveals a high level and the molecular nature of transcriptional noise in yeast cells. (2023) (0)
Prolong Remission Together with Chemotherapy to Block Tumor Growth and Metformin Selectively Targets Cancer Stem Cells , and Acts (2009) (0)
factor Cdt1 HBO1 histone acetylase is a coactivator of the replication licensing (2009) (0)
YeastandHumanTATA-Binding Proteins HaveNearly Identical DNA Sequence Requirements forTranscription InVitro (1990) (0)
Reply from Struhl (1989) (0)
34 – Mutagenesis with Degenerate Oligonucleotides: An Efficient Method for Saturating a Defined DNA Region with Base Pair Substitutions (1989) (0)
RNA‐Protein Interactions (2003) (0)
Author response: The transcriptional elongation rate regulates alternative polyadenylation in yeast (2020) (0)
An efficient method for generating proteins with altered enzymatic properties : Application to f 8-lactamase ( drug resistance / protein engineering / mutagenesis / antibiotics / random selection ) (0)

This paper list is powered by the following services:

Other Resources About Kevin Struhl

en.wikipedia.org

What Schools Are Affiliated With Kevin Struhl?

Kevin Struhl is affiliated with the following schools: