Larry Kay Keefer
#147,450
Most Influential Person Now
Larry Kay Keefer's AcademicInfluence.com Rankings
Larry Kay Keeferchemistry Degrees
Chemistry
#3945
World Rank
#4996
Historical Rank
Inorganic Chemistry
#201
World Rank
#215
Historical Rank
Organic Chemistry
#629
World Rank
#721
Historical Rank
Download Badge
Chemistry
Larry Kay Keefer's Degrees
- PhD Chemistry University of California, Berkeley
- Bachelors Chemistry Stanford University
Why Is Larry Kay Keefer Influential?
(Suggest an Edit or Addition)Larry Kay Keefer's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Complexes of .NO with nucleophiles as agents for the controlled biological release of nitric oxide. Vasorelaxant effects. (1991) (676)
- "NONOates" (1-substituted diazen-1-ium-1,2-diolates) as nitric oxide donors: convenient nitric oxide dosage forms. (1996) (656)
- New nitric oxide-releasing zwitterions derived from polyamines (1993) (542)
- Chemistry of the nitric oxide-releasing diazeniumdiolate ("nitrosohydroxylamine") functional group and its oxygen-substituted derivatives. (2002) (326)
- Targeting nitric oxide (NO) delivery in vivo. Design of a liver-selective NO donor prodrug that blocks tumor necrosis factor-alpha-induced apoptosis and toxicity in the liver. (1997) (266)
- Nitric Oxide (NO) Donor Molecules: Effect of NO Release Rate on Vascular Smooth Muscle Cell Proliferation In Vitro (1995) (240)
- Complexes of Nitric Oxide with Nucleophiles as Agents for the Controlled Biological Release of Nitric Oxide: Hemodynamic Effect in the Rabbit (1993) (232)
- Quantitative measurement of endogenous estrogens and estrogen metabolites in human serum by liquid chromatography-tandem mass spectrometry. (2007) (229)
- Key bioactive reaction products of the NO/H2S interaction are S/N-hybrid species, polysulfides, and nitroxyl (2015) (221)
- Overexpression of glutathione S-transferase II and multidrug resistance transport proteins is associated with acquired tolerance to inorganic arsenic. (2001) (220)
- Measuring fifteen endogenous estrogens simultaneously in human urine by high-performance liquid chromatography-mass spectrometry. (2004) (216)
- Estrogen metabolism and risk of breast cancer in postmenopausal women. (2012) (191)
- Chemistry of the diazeniumdiolates. 2. Kinetics and mechanism of dissociation to nitric oxide in aqueous solution. (2001) (181)
- Hypoxic mammalian cell radiosensitization by nitric oxide. (1993) (174)
- Nitric oxide-releasing polymers containing the [N(O)NO]- group. (1996) (173)
- Preparation and characterization of hydrophobic polymeric films that are thromboresistant via nitric oxide release. (2000) (167)
- Progress toward clinical application of the nitric oxide-releasing diazeniumdiolates. (2003) (166)
- The preparation and properties of some nitrosamino acids. (1970) (154)
- JS-K, a glutathione/glutathione S-transferase-activated nitric oxide donor of the diazeniumdiolate class with potent antineoplastic activity. (2003) (154)
- Nitric oxide/nucleophile complexes inhibit the in vitro proliferation of A375 melanoma cells via nitric oxide release. (1993) (147)
- JS-K, a GST-activated nitric oxide generator, induces DNA double-strand breaks, activates DNA damage response pathways, and induces apoptosis in vitro and in vivo in human multiple myeloma cells. (2007) (143)
- Fifty Years of Diazeniumdiolate Research. From Laboratory Curiosity to Broad-Spectrum Biomedical Advances (2011) (138)
- Differential effects of nonselective nitric oxide synthase (NOS) and selective inducible NOS inhibition on hepatic necrosis, apoptosis, ICAM-1 expression, and neutrophil accumulation during endotoxemia. (1997) (132)
- Nitric Oxide/Nucleophile Complexes: A Unique Class of Nitric Oxide‐Based Vasodilators (1993) (130)
- Nitric oxide and nanotechnology: a novel approach to inhibit neointimal hyperplasia. (2008) (125)
- Localizing antithrombotic and vasodilatory activity with a novel, ultrafast nitric oxide donor. (1996) (125)
- Nitrosation of tertiary amines and some biologic implications. (1972) (121)
- Tumor cell responses to a novel glutathione S-transferase-activated nitric oxide-releasing prodrug. (2004) (117)
- Diazeniumdiolates: pro- and antioxidant applications of the "NONOates". (2000) (115)
- Comparison of the NO and HNO donating properties of diazeniumdiolates: primary amine adducts release HNO in Vivo. (2005) (115)
- Induction of proliferative lesions of the uterus, testes, and liver in swiss mice given repeated injections of sodium arsenate: possible estrogenic mode of action. (2000) (114)
- Esterase-sensitive nitric oxide donors of the diazeniumdiolate family: in vitro antileukemic activity. (2000) (111)
- Antitumor activity of JS-K [O2-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate] and related O2-aryl diazeniumdiolates in vitro and in vivo. (2006) (103)
- A Glutathione S-Transferase π-Activated Prodrug Causes Kinase Activation Concurrent with S-Glutathionylation of Proteins (2006) (103)
- Nitric oxide (NO)- and nitroxyl (HNO)-generating diazeniumdiolates (NONOates): emerging commercial opportunities. (2005) (99)
- Mutations induced by saturated aqueous nitric oxide in the pSP189 supF gene in human Ad293 and E. coli MBM7070 cells. (1993) (97)
- Comparison of Liquid Chromatography-Tandem Mass Spectrometry, RIA, and ELISA Methods for Measurement of Urinary Estrogens (2010) (93)
- Macrophage-dependent nitric oxide expression regulates tumor cell detachment and metastasis after IL-2/anti-CD40 immunotherapy (2010) (89)
- Stabilization of the nitric oxide (NO) prodrugs and anticancer leads, PABA/NO and Double JS-K, through incorporation into PEG-protected nanoparticles. (2010) (89)
- DNA sequence changes induced by two nitric oxide donor drugs in the supF assay. (1994) (87)
- PABA/NO as an anticancer lead: analogue synthesis, structure revision, solution chemistry, reactivity toward glutathione, and in vitro activity. (2006) (83)
- The secondary amine/nitric oxide complex ion R(2)N[N(O)NO](-) as nucleophile and leaving group in S9N)Ar reactions. (2001) (82)
- Mechanism of vascular relaxation induced by the nitric oxide (NO)/nucleophile complexes, a new class of NO-based vasodilators. (1993) (81)
- Nitric oxide releasing polyurethanes with covalently linked diazeniumdiolated secondary amines. (2006) (78)
- Deuterium isotope effect on the carcinogenicity of dimethylnitrosamine in rat liver. (1973) (77)
- The nitric oxide donor, V‐PYRRO/NO, protects against acetaminophen‐induced hepatotoxicity in mice (2003) (77)
- A liquid chromatography–mass spectrometry method for the quantitative analysis of urinary endogenous estrogen metabolites (2007) (76)
- Structure mechanism insights and the role of nitric oxide donation guide the development of oxadiazole-2-oxides as therapeutic agents against schistosomiasis. (2009) (74)
- Beneficial effect of a short-acting NO donor for the prevention of neointimal hyperplasia. (2008) (72)
- Chemistry of the diazeniumdiolates. I. Structural and spectral characteristics of the [N(O)NO]- functional group. (2001) (70)
- Inhibition of Oxidized Low-density Lipoprotein-induced Apoptosis in Endothelial Cells by Nitric Oxide (2001) (68)
- Nitric Oxide Inhibits Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia by Increasing the Ubiquitination and Degradation of UbcH10 (2011) (67)
- The Nitric Oxide Prodrug JS-K Is Effective against Non–Small-Cell Lung Cancer Cells In Vitro and In Vivo: Involvement of Reactive Oxygen Species (2011) (66)
- O2-acetoxymethyl-protected diazeniumdiolate-based NSAIDs (NONO-NSAIDs): synthesis, nitric oxide release, and biological evaluation studies. (2007) (66)
- HNO and NO release from a primary amine-based diazeniumdiolate as a function of pH. (2011) (65)
- A Liquid Chromatography-Mass Spectrometry Method for the Simultaneous Measurement of 15 Urinary Estrogens and Estrogen Metabolites: Assay Reproducibility and Interindividual Variability (2008) (64)
- Nitric oxide prodrugs and metallochemotherapeutics: JS-K and CB-3-100 enhance arsenic and cisplatin cytolethality by increasing cellular accumulation. (2004) (64)
- The nitric oxide donor, V-PYRRO/NO, protects against acetaminophen-induced nephrotoxicity in mice. (2003) (61)
- Secondary amine/nitric oxide complex ions, R2N[N(O)NO]-. O-functionalization chemistry (1992) (61)
- Augmentation of Intrapericardial Nitric Oxide Level by a Prolonged-Release Nitric Oxide Donor Reduces Luminal Narrowing After Porcine Coronary Angioplasty (2002) (61)
- Complexes of Nitric Oxide with Nucleophiles as Agents for the Controlled Biological Release of Nitric Oxide: Antiplatelet Effect (1993) (60)
- TIMP-2 mediates the anti-invasive effects of the nitric oxide-releasing prodrug JS-K in breast cancer cells (2008) (57)
- Nitric oxide prodrug JS-K inhibits ubiquitin E1 and kills tumor cells retaining wild-type p53 (2009) (57)
- Synthesis and solvolysis of methyl(acetoxymethyl)nitrosamine. Solution chemistry of the presumed carcinogenic metabolite ofdimethylnitrosamine (1975) (57)
- Thwarting thrombus (2003) (57)
- Second-generation aspirin and indomethacin prodrugs possessing an O(2)-(acetoxymethyl)-1-(2-carboxypyrrolidin-1-yl)diazenium-1,2-diolate nitric oxide donor moiety: design, synthesis, biological evaluation, and nitric oxide release studies. (2008) (56)
- Carcinogenesis and alkylation of rat liver nucleic acids by nitrosomethylurea and nitrosoethylurea administered by intraportal injection. (1972) (55)
- Urinary estrogens and estrogen metabolites and subsequent risk of breast cancer among premenopausal women. (2012) (55)
- Nickel-aluminum alloy as a reducing agent (1989) (54)
- Selective opening of the blood-tumor barrier by a nitric oxide donor and long-term survival in rats with C6 gliomas. (2003) (54)
- Deuterium isotope effect on denitrosation and demethylation of N-nitrosodimethylamine by rat liver microsomes. (1987) (54)
- Isopropylamine NONOate (IPA/NO) moderates neointimal hyperplasia following vascular injury. (2010) (53)
- Nitric oxide induces metallothionein (MT) gene expression apparently by displacing zinc bound to MT. (2001) (53)
- In vivo radiation protection by nitric oxide modulation. (1994) (52)
- Mutagenicity of glyceryl trinitrate (nitroglycerin) in Salmonella typhimurium. (1993) (51)
- Dual Mechanisms of HNO Generation by a Nitroxyl Prodrug of the Diazeniumdiolate (NONOate) Class (2010) (50)
- Transition mutation in codon 248 of the p53 tumor suppressor gene induced by reactive oxygen species and a nitric oxide-releasing compound. (2000) (48)
- Synthesis, mechanistic studies, and anti-proliferative activity of glutathione/glutathione S-transferase-activated nitric oxide prodrugs. (2008) (48)
- Nitric oxide does not mediate but inhibits transformation and tumor phenotype. (2003) (47)
- A new approach to measuring estrogen exposure and metabolism in epidemiologic studies (2010) (47)
- Constitutive expression of inducible nitric oxide synthase in human bronchial epithelial cells induces c-fos and stimulates the cGMP pathway. (1994) (46)
- FACILE HYDROGEN ISOTOPE EXCHANGE AS EVIDENCE FOR AN $alpha$-NITROSAMINO CARBANION. (1970) (46)
- Growth‐inhibitory and chemosensitizing effects of the glutathione‐S‐transferase‐π‐activated nitric oxide donor PABA/NO in malignant gliomas (2012) (46)
- O(2)-Vinyl 1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate protection against D-galactosamine/endotoxin-induced hepatotoxicity in mice: genomic analysis using microarrays. (2002) (46)
- Piperazine as a Linker for Incorporating the Nitric Oxide-Releasing Diazeniumdiolate Group into Other Biomedically Relevant Functional Molecules. (1999) (45)
- Concurrent generation of methylamine and nitrite during denitrosation of N-nitrosodimethylamine by rat liver microsomes. (1987) (44)
- A kinetic investigation of intermediates formed during the Fenton reagent mediated degradation of N-nitrosodimethylamine: evidence for an oxidative pathway not involving hydroxyl radical. (1991) (44)
- Nitric oxide donors: a continuing opportunity in drug design. (1995) (44)
- Nitric oxide-releasing fabrics and other acrylonitrile-based diazeniumdiolates. (2007) (43)
- Nitric oxide-releasing prodrug triggers cancer cell death through deregulation of cellular redox balance☆ (2013) (43)
- Nitric Oxide‐Releasing Compounds: From Basic Research to Promising Drugs (1998) (43)
- Reduction of Rat Liver Carcinogenicity of α-Nitrosomorpholine by a-Deuterium Substitution (1976) (43)
- V-PYRRO/NO: AN HEPATO-SELECTIVE NITRIC OXIDE DONOR IMPROVES PORCINE LIVER HEMODYNAMICS AND FUNCTION AFTER ISCHEMIA REPERFUSION1 (2001) (42)
- JS-K, a Glutathione S-Transferase–Activated Nitric Oxide Donor With Antineoplastic Activity in Malignant Gliomas (2012) (41)
- Pulmonary vasodilation by nitric oxide gas and prodrug aerosols in acute pulmonary hypertension. (1998) (40)
- Reduction of nitrosamines with aqueous titanium trichloride: convenient preparation of aliphatic hydrazines (1984) (39)
- JS-K, a nitric oxide-releasing prodrug, induces breast cancer cell death while sparing normal mammary epithelial cells. (2011) (38)
- Studies of alkylation of nucleic acids in rats by cyclic nitrosamines. (1973) (38)
- Chemistry of the diazeniumdiolates. 3. Photoreactivity. (2001) (38)
- Differential effects of nitric oxide on blood-brain barrier integrity and cerebral blood flow in intracerebral C6 gliomas. (2011) (37)
- Diethylamine/Nitric Oxide (NO) Adduct, an NO Donor, Produces Potent Pulmonary and Systemic Vasodilation in Intact Newborn Lambs (1994) (37)
- Alkylation of nucleic acids of rat liver and lung by deuterated N-nitrosodiethylamine in vivo. (1971) (36)
- Liver tumorigenesis by Helicobacter hepaticus: considerations of mechanism. (1996) (36)
- Nitrite-induced mutations in a forward mutation assay: influence of nitrite concentration and pH. (1994) (36)
- An evaluation of the roles of metabolic denitrosation and alpha-hydroxylation in the hepatotoxicity of N-Nitrosodimethylamine. (1996) (36)
- JS-K, a nitric oxide-releasing prodrug, modulates ß-catenin/TCF signaling in leukemic Jurkat cells: evidence of an S-nitrosylated mechanism. (2010) (35)
- Nitric oxide and ethylnitrosourea: relative mutagenicity in the p53 tumor suppressor and hypoxanthine-phosphoribosyltransferase genes. (1995) (34)
- Nitric Oxide (NO) Releasing Poly ADP-ribose Polymerase 1 (PARP-1) Inhibitors Targeted to Glutathione S-Transferase P1-Overexpressing Cancer Cells (2014) (34)
- The liver-selective NO donor, V-PYRRO/NO, protects against liver steatosis and improves postprandial glucose tolerance in mice fed high fat diet. (2015) (34)
- JS‐K has potent anti‐angiogenic activity in vitro and inhibits tumour angiogenesis in a multiple myeloma model in vivo (2010) (33)
- Metabolic denitrosation of N-nitrosodimethylamine in vivo in the rat. (1990) (32)
- Stable isotope dilution high-performance liquid chromatography-electrospray ionization mass spectrometry method for endogenous 2- and 4-hydroxyestrones in human urine. (2002) (32)
- DNA damage and nitric oxide. (1996) (32)
- Deuterium isotope effect on metabolism of N-nitrosodimethylamine in vivo in rat. (1983) (32)
- Assay Reproducibility and Interindividual Variation for 15 Serum Estrogens and Estrogen Metabolites Measured by Liquid Chromatography–Tandem Mass Spectrometry (2014) (32)
- Correlation of DNA methylation by methyl(acetoxymethyl)nitrosamine with organ-specific carcinogenicity in rats. (1979) (32)
- Heightened efficacy of nitric oxide-based therapies in type II diabetes mellitus and metabolic syndrome. (2008) (32)
- Boundary layer infusion of nitric oxide reduces early smooth muscle cell proliferation in the endarterectomized canine artery. (1997) (31)
- Inactivity of fecapentaene-12 as a rodent carcinogen or tumor initiator. (1988) (31)
- Nuclear Magnetic Resonance Study of Oxiranes from Ephedrine Salts1a (1966) (31)
- Pharmacokinetics and consistency of pericardial delivery directed to coronary arteries: Direct comparison with endoluminal delivery (1999) (31)
- Comparison of responses to novel nitric oxide donors in the feline pulmonary vascular bed. (2001) (31)
- Chemistry of the Nitric Oxide-Releasing Diazeniumdiolate (“Nitrosohydroxylamine”) Functional Group and Its Oxygen-Substituted Derivatives (2002) (30)
- Hydrolytic Reactivity Trends among Potential Prodrugs of the O2-Glycosylated Diazeniumdiolate Family. Targeting Nitric Oxide to Macrophages for Antileishmanial Activity (2008) (30)
- JS-K, an arylating nitric oxide (NO) donor, has synergistic anti-leukemic activity with cytarabine (ARA-C). (2009) (30)
- Histogenesis and the role of p53 and K-ras mutations in hepatocarcinogenesis by glyceryl trinitrate (nitroglycerin) in male F344 rats. (1996) (30)
- V-PROLI/NO, a prodrug of the nitric oxide donor, PROLI/NO. (2007) (29)
- Poly(diol-co-citrate)s as novel elastomeric perivascular wraps for the reduction of neointimal hyperplasia. (2011) (29)
- Synthesis, nitric oxide release, and anti-leukemic activity of glutathione-activated nitric oxide prodrugs: Structural analogues of PABA/NO, an anti-cancer lead compound. (2008) (29)
- Nitrogen-Based Diazeniumdiolates: Versatile Nitric Oxide-Releasing Compounds for Biomedical Research and Potential Clinical Applications (2002) (29)
- The role of estrogen receptor α and β in regulating vascular smooth muscle cell proliferation is based on sex. (2012) (28)
- The Fenton degradation as a nonenzymatic model for microsomal denitrosation of N-nitrosodimethylamine. (1989) (28)
- Selective induction of intestinal tumors in rats by methyl(acetoxymethyl)nitrosamine, an ester of the presumed reactive metabolite of dimethylnitrosamine. (1977) (28)
- Pathophysiology of a Sickle Cell Trait Mouse Model: Human αβS Transgenes with One Mouse β-Globin Allele (2001) (28)
- Low-dose in vivo pharmacokinetic and deuterium isotope effect studies of N-nitrosodimethylamine in rats. (1985) (28)
- Comparison between 3-Nitrooxyphenyl acetylsalicylate (NO-ASA) and O2-(acetylsalicyloxymethyl)-1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate (NONO-ASA) as Safe Anti-Inflammatory, Analgesic, Antipyretic, Antioxidant Prodrugs (2010) (28)
- Chemistry of the Diazeniumdiolates (I)—(III). Part 2. Kinetics and Mechanism of Dissociation to Nitric Oxide in Aqueous Solution. (2001) (28)
- Acceleration of N-nitrosation reactions by electrophiles. (1991) (27)
- Chemistry of the diazeniumdiolates. O- versus N-alkylation of the RNH[N(O)NO](-) ion. (2004) (27)
- Tailored Synthesis of Nitric Oxide-Releasing Polyurethanes Using O-Protected Diazeniumdiolated Chain Extenders. (2010) (27)
- SYNTHESIS AND SOLVOLYSIS OF METHYL(ACETOXYMETHYL)NITROSAMINE, SOLUTION CHEMISTRY OF THE PRESUMED CARCINOGENIC METABOLITE OF DIMETHYLNITROSAMINE (1975) (26)
- Safe disposal of carcinogenic nitrosamines. (1983) (26)
- Diazeniumdiolated carbamates: a novel class of nitric oxide donors. (2012) (26)
- Nitrite, N-nitroso compounds, and other analytes in physiological fluids in relation to precancerous gastric lesions. (1996) (26)
- Deamination of single-stranded DNA cytosine residues in aerobic nitric oxide solution at micromolar total NO exposures. (1996) (25)
- Effect of nitric oxide on neointimal hyperplasia based on sex and hormone status. (2011) (24)
- Reaction of nitric oxide at the beta-carbon of enamines. A new method of preparing compounds containing the diazeniumdiolate functional group. (2000) (24)
- Nitric oxide reacts with methoxide. (2008) (24)
- Insights into the effect of nitric oxide and its metabolites nitrite and nitrate at inhibiting neointimal hyperplasia. (2011) (24)
- General Cleavage of N-N and N-O Bonds Using Nickel/Aluminum Alloy (1985) (24)
- Involvement of K+ATP channels in nitric oxide-induced inhibition of spontaneous contractile activity of the nonpregnant human myometrium. (1998) (23)
- Carcinogenicity of nitrosothiomorpholine and 1-nitrosopiperazine in rats (2004) (23)
- Plasma pharmacokinetics of a liver-selective nitric oxide-donating diazeniumdiolate in the male C57BL/6 mouse (2002) (23)
- The configurations at C-9 of the cinchona alkaloids (1967) (22)
- Diazeniumdiolate ions as leaving groups in anomeric displacement reactions: a protection-deprotection strategy for ionic diazeniumdiolates. (2005) (22)
- Cell-permeable esters of diazeniumdiolate-based nitric oxide prodrugs. (2008) (22)
- Aryl bis(diazeniumdiolates): potent inducers of S-glutathionylation of cellular proteins and their in vitro antiproliferative activities. (2008) (21)
- Nitric oxide prodrugs: diazeniumdiolate anions of hindered secondary amines. (2007) (21)
- Green tea intake is associated with urinary estrogen profiles in Japanese-American women (2013) (21)
- The nitric oxide prodrug, V-PYRRO/NO, protects against cadmium toxicity and apoptosis at the cellular level. (2005) (21)
- "Click" reaction in conjunction with diazeniumdiolate chemistry: developing high-load nitric oxide donors. (2010) (21)
- Methylation versus ethylation of DNA in target and nontarget tissues of Fischer 344 rats treated with N-nitrosomethylethylamine. (1986) (20)
- Analysis of the HNO and NO donating properties of alicyclic amine diazeniumdiolates. (2014) (19)
- Rapid formation of a potent nitrosating agent by solvolysis of ionic nitrite in dichloromethane (1987) (19)
- Soy Intake is Associated with Increased 2-Hydroxylation and Decreased 16α-Hydroxylation of Estrogens in Asian-American Women (2009) (19)
- Direct Reaction of Amides with Nitric Oxide To Form Diazeniumdiolates (2014) (19)
- Stability of 15 Estrogens and Estrogen Metabolites in Urine Samples under Processing and Storage Conditions Typically Used in Epidemiologic Studies (2010) (19)
- The Secondary Amine/Nitric Oxide Complex Ion R2N[N(O)NO]- as Nucleophile and Leaving Group in SNAr Reactions. (2001) (19)
- Experimental Tests of the Mutagenicity and Carcinogenicity of Nitric Oxide and Its Progenitors (1995) (19)
- Synthesis and in vitro anti-leukemic activity of structural analogues of JS-K, an anti-cancer lead compound. (2008) (19)
- Notes. Reductive destruction of hydrazines as an approach to hazard control. (1983) (19)
- Reducing nitrosamine contamination in cutting fluids. (1983) (18)
- Activation of the c-Jun N-terminal kinase/activating transcription factor 3 (ATF3) pathway characterizes effective arylated diazeniumdiolate-based nitric oxide-releasing anticancer prodrugs. (2011) (18)
- Insulin enhances the effect of nitric oxide at inhibiting neointimal hyperplasia in a rat model of type 1 diabetes. (2010) (18)
- Structure-based design of anticancer prodrug PABA/NO (2008) (18)
- Conversion of proteins to diazeniumdiolate-based nitric oxide donors. (1999) (18)
- Conversion of a polysaccharide to nitric oxide-releasing form. Dual-mechanism anticoagulant activity of diazeniumdiolated heparin. (2000) (17)
- Laboratory decontamination and destruction of carcinogens in laboratory wastes: some N-nitrosamines. (1982) (17)
- Effects of the nitric oxide donor JS-K on the blood-tumor barrier and on orthotopic U87 rat gliomas assessed by MRI. (2013) (17)
- Inhibition of N-nitrosodimethylamine metabolism in rats by ether anesthesia. (1985) (17)
- Gene expression profiling for nitric oxide prodrug JS-K to kill HL-60 myeloid leukemia cells. (2009) (16)
- Induction of penile erection by intracavernosal and transurethral administration of novel nitric oxide donors in the cat. (1999) (16)
- Selective Pulmonary Vasodilation by Intravenous Infusion of an Ultrashort Half‐life Nucleophile/Nitric Oxide Adduct (1998) (16)
- REACTION OF NITRIC OXIDE WITH THE IMINE DOUBLE BOND OF CERTAIN SCHIFF BASES (1998) (16)
- Chemistry of the Diazeniumdiolates: Z ⇌ E Isomerism (2005) (16)
- An unusual Bi–Tri–binuclear sandwich complex formed in the reaction of CuCl2 with the Et2N–N2O2– ion (1993) (16)
- Novel protection-deprotection strategies in diazeniumdiolate chemistry: synthesis of V-IPA/NO. (2011) (16)
- Displacement of O- versus N-substituents from nitrosamine-derived diazenium ions by three divergent mechanisms (1988) (16)
- Pathophysiology of a sickle cell trait mouse model: human alpha(beta)(S) transgenes with one mouse beta-globin allele. (2001) (15)
- Metabolism of a liver-selective nitric oxide-releasing agent, V-PYRRO/NO, by human microsomal cytochromes P450. (2006) (15)
- Hepatoselective Nitric Oxide (NO) Donors, V-PYRRO/NO and V-PROLI/NO, in Nonalcoholic Fatty Liver Disease: A Comparison of Antisteatotic Effects with the Biotransformation and Pharmacokinetics (2015) (15)
- Preparation of Osmium Hydrazido Complexes by Interception of an Osmium(IV) Imido Intermediate (1994) (15)
- Measuring seven endogenous ketolic estrogens simultaneously in human urine by high-performance liquid chromatography-mass spectrometry. (2004) (15)
- Carcinogenesis and aging. II. Modifying effect of aging on metabolism of methyl(acetoxymethyl)nitrosamine and its interaction with DNA of various tissues in rats. (1983) (15)
- Persistence of N-nitrosodiethanolamine contamination in American metal-working lubricants. (1990) (14)
- Synthesis and evaluation of piperazine and homopiperazine analogues of JS-K, an anti-cancer lead compound. (2009) (14)
- Structural modifications modulate stability of glutathione-activated arylated diazeniumdiolate prodrugs. (2012) (14)
- Pharmacokinetic and deuterium isotope effect studies on the metabolism of formaldehyde and formate to carbon dioxide in rats in vivo. (1987) (14)
- Nitrogen protonation of N-nitrosodimethylamine (1988) (14)
- Mechanism of action for the cytotoxic effects of the nitric oxide prodrug JS-K in murine erythroleukemia cells. (2014) (13)
- Spectral and other properties of some oxygenated derivatives of benzo[a]pyrene (1973) (13)
- Extent of DNA 2-hydroxyethylation by N-nitrosomethylethylamine and N-nitrosodiethylamine in vivo. (1986) (13)
- Carcinogen chemistry. I. Reactions of protonated dialkylnitrosamines leading to alkylating and aminoalkylating agents of potential metabolic significance. (1975) (13)
- N-nitrosothialdine. Synthesis, X-ray crystallography, and N-N rotational barrier (1981) (13)
- Carcinogenesis in rats by cyclic N-nitrosamines containing sulphur. (1988) (12)
- Reaction of nitric oxide with benzyl cyanide to yield a bis-diazeniumdiolated imidate (2000) (12)
- Carcinogenicity of deuterium-labeled 1,2-dimethylhydrazine in mice. (1988) (12)
- Hepatic cytochrome P450 2B-type induction by ethyl/phenyl-substituted congeners of phenobarbital in the rat. (1993) (12)
- A nitric oxide-releasing polydiazeniumdiolate derived from acetonitrile. (2002) (11)
- Enzymatic generation of the NO/HNO-releasing IPA/NO anion at controlled rates in physiological media using β-galactosidase. (2013) (11)
- Oncogenic activity of N‐nitrosododecamethyleneimine in liver, glandular stomach and other tissues of NZO/B1 mice (1973) (11)
- Injectable formulation of disodium 1-[2-(carboxylato)pyrrolidin-1-yl]diazen-1-ium-1,2-diolate (PROLI/NO), an ultrafast nitric oxide donor prodrug. (2006) (11)
- Etiological research on gastric cancer and its precursor lesions in Shandong, China. (1991) (11)
- Reduction of rat liver carcinogenicity of 4-nitrosomorpholine by alpha-deuterium substitution. (1976) (11)
- V‐PROLI/NO, a nitric oxide donor prodrug, protects liver cells from arsenic‐induced toxicity (2009) (10)
- Decontamination and disposal of nitrosoureas and related N-nitroso compounds. (1988) (10)
- Preparation of a thallium(I) diazotate. Structure, physicochemical characterization, and conversion to novel N-nitroso compounds (1988) (10)
- Carbon-bound diazeniumdiolates from the reaction of nitric oxide with amidines. (2005) (9)
- Broad-Spectrum Anti-Cancer Activity of O-Arylated Diazeniumdiolates. (2010) (9)
- Analysis of Vasodilator Responses to Novel Nitric Oxide Donors in the Hindquarters Vascular Bed of the Cat (2001) (9)
- Formation of complexed nitrosamines by oxidation of coordinated ammonia in the presence of secondary amines (1988) (9)
- Structure of the Fe(salen)ONO2 dimer, a ferric complex with a unidentate nitrate ligand (1987) (9)
- Preparation of 2'-deoxyxanthosine by nitrosative deamination of 2'-deoxyguanosine under alkaline aqueous conditions (1989) (9)
- The nitric oxide prodrug, V-PYRRO/NO, mitigates arsenic-induced liver cell toxicity and apoptosis. (2007) (9)
- Analysis of mixtures of isomeric polynuclear hydrocarbons by nuclear magnetic resonance spectrometry methylated derivatives of anthracene, benz(a)anthracene, benzo(c)phenanthrene, and pyrene. (1971) (9)
- Relative mutagenicities of gaseous nitrogen oxides in the supF gene of pSP189. (1997) (9)
- N-Nitrosated N-hydroxyguanidines are nitric oxide-releasing diazeniumdiolates (1998) (9)
- O2-functionalized methylamine diazeniumdiolates: evidence for E ⇄ Z equilibration in an acyclic system. (2012) (8)
- PABA/NO lead optimization: Improved targeting of cytotoxicity to glutathione S-transferase P1-overexpressing cancer cells. (2015) (8)
- Inhibition of microsomal N-nitrosodimethylamine demethylase by diethyl ether and other anesthetics. (1987) (8)
- Glycosylated PROLI/NO derivatives as nitric oxide prodrugs. (2010) (8)
- Potential for metabolic deactivation of carcinogenic N-nitrosodimethylamine in vivo. (1987) (8)
- Magnesium hydroxide as a thin-layer chromatographic adsorbent. 3. Application to separations of vitamin A and related carotenoids. (1972) (8)
- Magnesium hydroxide as a thin-layer chromatographic adsorbent. A new system for the separation of polynuclear hydrocarbons. (1967) (8)
- Catalytic hydrogenation of polynuclear hydrocarbons. Products of partial hydrogenation of dibenz(a,j)anthracene, benzo(ghi)perylene, dibenz(a,c)anthracene, 3-methylcholanthrene, 7,12-dimethylbenz(a)anthracene, and anthanthrene (1972) (8)
- Nitric oxide donor, V-PROLI/NO, provides protection against arsenical induced toxicity in rat liver cells: requirement for Cyp1a1. (2011) (7)
- Measuring Fifteen Simultaneously in High-Performance Spectrometry Endogenous Estrogens Human Urine by Liquid Chromatography-Mass (2005) (7)
- Stereochemistry of thialdine (1982) (7)
- Protection of human keratinocyte mtDNA by low-level nitric oxide. (2001) (7)
- Reductive destruction of N-nitrosodimethylamine as an approach to hazard control in the carcinogenesis laboratory. (1981) (7)
- Sex differences in the single-dose toxicokinetics of N-nitrosomethyl(2-hydroxyethyl)amine in the rat. (1989) (7)
- Pharmacokinetics of agent distribution from the pericardial space: effects of agent size and validation of a mathematical model for epicardial penetration (1998) (7)
- The Nitric Oxide Prodrug V-PROLI/NO Inhibits Cellular Uptake of Proline. (2010) (7)
- Improved synthesis of V-PYRRO/NO, a liver-selective nitric oxide prodrug, and analogues (2009) (6)
- Decomposition and quality control considerations in biological work with fecapentaene preparations. (1989) (6)
- Deamidation of peptides in aerobic nitric oxide solution by a nitrosative pathway. (2006) (6)
- Chronic oral administration of 1-nitrosopiperazine at high doses to MRC rats (1977) (6)
- Decoding nitric oxide release rates of amine-based diazeniumdiolates. (2013) (6)
- A symmetrically hydrogen-bonded binitrosamine cation produced on protonation of N-nitrosopyrrolidine (1988) (6)
- Deuterium isotope effect on the toxicokinetics of monomethylamine in the rat. (1990) (5)
- Nitrogen-bound diazeniumdiolated amidines. (2010) (5)
- Chemical models for possible nitrosamine artifact formation in environmental analysis. (1978) (5)
- Preparation and reactivity of O2-sulfonated diazeniumdiolates. (2003) (5)
- Magnesium hydroxide as a thin-layer chromatographic adsorbent. II. A unique system for separating polynuclear azaaromatic compounds. (1970) (5)
- Adducts of Piperazine with Nitric Oxide (1999) (5)
- Cross-linking protein glutathionylation mediated by O2-arylated bis-diazeniumdiolate "Double JS-K". (2012) (5)
- Organ specificity, metabolism and reaction with DNA of aliphatic nitrosomethylalkylamines. (1987) (5)
- JS-K, a Novel Nitric Oxide (NO) Generator, Shows Potent Anti-Angiogenic Activity. (2004) (4)
- Secondary Amine/Nitric Oxide Complex Ions, R2N(N(O)NO)-. O- Functionalization Chemistry. (1993) (4)
- Isolation of stable 1:1 and 2:1 salts of nitrosamines with protic acids (1989) (4)
- N-nitrosation of secondary amines by nitric oxide via the 'Drago complex'. (1982) (4)
- Stereoselectivity in the microsomal conversion of N-nitrosodimethylamine to formaldehyde. (1990) (4)
- Chiroptical properties of nitrosamino acids and their relationship to the nitrosamine sector rule (1972) (4)
- α-Amino Nitrite Esters and Their Analogues: Possible Reactive Intermediates inN-Nitrosamine Formation? (1979) (4)
- Quantification of diazeniumdiolate mutagenicity in four different in vitro assays. (1997) (4)
- L-tyrosine and nitric oxide synergize to prevent cytotoxic effects of superoxide. (2001) (4)
- Mechanistic insight into exclusive nitric oxide recovery from a carbon-bound diazeniumdiolate. (2002) (4)
- Carcinogenicity study of fecapentaene-12 diacetate on skin painting in SENCAR mice. (1991) (3)
- Metal complexes as promoters of N-nitrosation reactions: a progress report. (1980) (3)
- Comparison between NO-ASA and NONO-ASA as safe anti-inflammatory , analgesic , antipyretic , anti-oxidant prodrugs (2010) (3)
- Beta-deuteration of N-nitrosoethylmethylamine causes a shift in DNA methylation from rat liver to esophagus. (1991) (3)
- Primary amine diazeniumdiolate ions of structure {RNN(O)NOR'}- as ambident nucleophiles (2009) (3)
- Arylation of Sensitive 1-(Pyrrolidin-1-yl)-diazen-1-ium-diolate in Ionic Liquids (2010) (3)
- Diazeniumdiolates (Formerly NONOates) in Cardiovascular Research and Potential Clinical Applications (2000) (3)
- Single-dose toxicokinetics ofN-nitrosomethylethylamine andN-nitrosomethyl (2,2,2-trideuterioethyl)amine in the rat (2005) (3)
- Mixed-Ligand, Non-Nitrosyl Cu(II) Complexes as Potential Pharmacological Agents via NO Release (1993) (3)
- An improved synthesis of V-PROLI/NO, a cytochrome P450-activated nitric oxide prodrug (2009) (3)
- SYNTHESIS OF THE SELECTIVE BLADDER CARCINOGEN, N-(n-BUTYL)-N-(3-CARBOXYPROPYL)NITROSAMINE (BCPN) (1977) (2)
- Synthesis, analysis, and stability studies of 14C-methyl(acetoxymethyl)nitrosamine (1981) (2)
- Nitric Oxide Donors (1999) (2)
- Chemistry of the "NONOates": UnusualN-Nitroso Compounds Formed by Reacting Nitric Oxide with Nucleophiles (1994) (2)
- Ion-Pairing Systems for Separation of N-Nitrosodimethylamine and its Metabolites in Reversed-Phase High-Performance Liquid Chromatography (1992) (2)
- Nitric oxide radiosensitizes hypoxic cells in vitro and increases tumor pO2 (1994) (2)
- SPECTRAL AND OTHER PROPERTIES OF SOME OXYGENATED DERIVATIVES OF BENZO(A)PYRENE (1973) (2)
- Use of 3,4-dichlorobenzenethiol as a trapping agent for alkylating intermediates during in vitro metabolism of nitrosamines. (1985) (2)
- Destruction of carcinogenic and mutagenic N-nitrosamides in laboratory wastes. (1984) (2)
- Photochemical perturbation of Z⇌E equilibria in nitrosamines (1976) (2)
- JS-K, a GST-Activated Nitric Oxide Generator, Induces DNA-Double Strand Breaks and Inhibits Growth and Survival of Multiple Myeloma Cells In Vitro and In Vivo. (2006) (2)
- Abstract 2784: Urinary estrogen metabolites in the luteal phase and subsequent risk of breast cancer among premenopausal women (2010) (1)
- Approaches to hazard control in the carcinogenesis laboratory: N-nitroso compounds. (1982) (1)
- JS-K, a GST-Activated Nitric Oxide Generator, Induces Apoptosis and Overcomes In Vitro Drug Resistance in Multiple Myeloma Cells. (2005) (1)
- Faculty Opinions recommendation of Endogenous nitric oxide regulates the recovery of the radiation-resistant bacterium Deinococcus radiodurans from exposure to UV light. (2009) (1)
- 1 JSK , a GST-activated nitric oxide generator , induces DNA double strand breaks , activates DNA damage response pathways , and induces apoptosis in vitro and in vivo in human multiple myeloma cells (2007) (1)
- Kinetic isotope effect on the demethylation and denitrosation of N-nitrosodimethylamine in vitro. (1987) (1)
- Denitrosation of N-nitrosodimethylamine in the rat in vivo. (1991) (1)
- Primary amine use and other strategies for preventing human exposure to N nitroso compounds: application to cutting fluids. (1982) (1)
- Promotion of N-nitrosation reactions by metal complexes. (1976) (1)
- Unexpected Incorporation of Bromine at a Non-anomeric Position during the Synthesis of an O2-Glycosylated Diazeniumdiolate (2009) (1)
- Thiol Modification By Pharmacologically Active Agents of the Diazeniumdiolate Class. (2012) (1)
- Relationships between body mass index, endogenous estrogen levels, and patterns of estrogen metabolism in Asian‐American women (2009) (1)
- Nitrous oxide as a primary product in base-mediated β-elimination reactions of diazeniumdiolated benzylamine derivatives. (2012) (1)
- Novel Protection—Deprotection Strategies in Diazeniumdiolate Chemistry: Synthesis of V‐IPA/NO. (2011) (1)
- The sequential determination of nitrite, N-nitroso compounds and nitrate and its application. (1980) (1)
- Tritium gas exposure as an alternative to base-catalyzed exchange for the one-step tritiation of nitrosamines (1978) (1)
- Isolation of Stable 1:1 and 2:1 Salts of Nitrosamines with Protic Acids. (1989) (0)
- Patent Number : 5 , 650 . 447 45 Date of Patent : Jul . 22 , 1997 (2017) (0)
- Abstract 4547: Diazeniumdiolate-based nitric oxide-releasing prodrugs kill lung adenocarcinoma cells in culture and in vivo through alterations in cellular redox balance leading to mitochondrially-mediated apoptosis (2010) (0)
- Synthesis and antineoplastic activity of bis-diazeniumdiolate analogues of the nitric oxide-generating prodrug JS-K (2008) (0)
- Chemistry of the diazeniumdiolates: Z right harpoon over left harpoon E isomerism. (2005) (0)
- Synergy Studies between the Nitric Oxide (NO) Donor JS-K and Other Anti-Leukemic Agents. (2006) (0)
- In Asian-American Women, Westernization Influences Estrogen Metabolism, but Not Total Endogenous Estrogen Production. (2009) (0)
- Drugs for the treatment of restenosis comprising polymers nitrogenoxidfrigivende (1995) (0)
- Abstract 2651: Cellular uptake and stability studies of the nitric oxide-generating pro-drug JS-K (2010) (0)
- PABA-NO, a nitric oxide releasing prodrug, is a potent inducer of protein glutathionylation (2004) (0)
- N-NITROSOTHIALDINE. SYNTHESIS, X-RAY CRYSTALLOGRAPHY, AND NITROGEN-NITROGEN ROTATIONAL BARRIER (1982) (0)
- Abstract 2662: Pharmacokinetics, metabolism and tissue distribution of the nitric oxide-donating prodrug JS-K following administration in liposomes (2010) (0)
- Abstract 2922: Stoichiometric depletion of glutathione by anticancer agent JS-K. (2013) (0)
- Mixed ligand, non-nitrosyl Cu(II) complexes as potential cardiovascular agents via no release. (1992) (0)
- Patent Number : 45 Date of Patent : 5 , 405 , 919 Apr . 11 , 1995 cleophiles as Agents for the Controlled Biological Re lease of Nitric Oxide (2017) (0)
- Cancer Cell-Directed Drug Delivery and Chemopotentiating Effects by GSTP1-Activated Nitric Oxide (NO)-Releasing Prodrug (2016) (0)
- Faculty Opinions recommendation of Proteomic and mass spectroscopic quantitation of protein S-nitrosation differentiates NO-donors. (2010) (0)
- Abstract B126: Does adult soy intake influence total estrogen levels and estrogen metabolism patterns? (2008) (0)
- Possible Mechanisms of Nitrosamine Formation in Pesticides (1981) (0)
- Nitric Oxide—Nucleophile Complexes as Ligands: Structural Aspects of the Coordinated "NONOate" Functional Group in Novel Mixed-Ligand, Non-Nitrosyl Metal Complexes (1994) (0)
- THE STEREOCHEMISTRY OF THE CINCHONA ALKALOIDS (1966) (0)
- 1-(2-carboxylato)-pyrrolidin-1-yl diazen-1-ium-1,2-diolates O2-substitués (1997) (0)
- Preparation of a Thallium(I) Diazotate. Structure, Physicochemical Characterization, and Conversion to Novel N‐Nitroso Compounds. (1988) (0)
- Unexpected Incorporation of Bromine at a Non‐anomeric Position During the Synthesis of an O2‐Glycosylated Diazeniumdiolate. (2009) (0)
- Preparation of 2′-Deoxyxanthosine by Nitrosative Deamination of 2′-Deoxyguanosine Under Alkaline Aqueous Conditions. (1989) (0)
- Oxygen-substituted derivatives of nitric oxide-nucleophile adducts and their use as nitric oxide-donor prodrugs (1992) (0)
- Chemistry of the Diazeniumdiolates (I)—(IV). Part 3. Photoreactivity. (2001) (0)
- Proliferation of A 375 Melanoma Cells via Nitric Oxide Release in Vitro Nitric Oxide / Nucleophile Complexes Inhibit the Updated (2006) (0)
- HYPOXIC MAMMALIAN CELL RADIOSENSITIZATION BY NO To study the effects of NO and radiation in hypoxic cells (2006) (0)
- Abstract 3580: The role of CDNB in understanding the mechanism of action of JS-K, a promising anti-leukemia compound (2010) (0)
- Inhibition of ribonucleoside diphosphate reductase from rabbit bone marrow by nitric oxide/nucleophile complexes (1993) (0)
- Effect of JS-K, a novel anti-cancer nitric oxide prodrug, on gene expression in human myeloid leukemia cells (2008) (0)
- Aminolysis of an N-Diazeniumdiolated Amidine as an Approach to Diazeniumdiolated Ammonia (2014) (0)
- Faculty Opinions recommendation of Manganese(III) complexes of bis(hydroxyphenyl)dipyrromethenes are potent orally active peroxynitrite scavengers. (2011) (0)
- aerosols in acute pulmonary hypertension Pulmonary vasodilation by nitric oxide gas and prodrug (2015) (0)
- QS359. The Diazeniumdiolate IPA/NO Moderates Neointimal Hyperplasia Following Vascular Interventions Via a Mechanism Distinct from Nitric Oxide (2008) (0)
- Abstract 4392: Protein Interaction and Binding Studies of the Nitric Oxide-Generating Antineoplastic Agent JS-K (2011) (0)
- Metabolism of n nitrosomethylethylamine in vivo results in 2 hydroxyethylation of dna (1986) (0)
- CAAGAGGCATACCA CCGAAGAGGCCACAACACTT CCCGCCTGACAGA TCAGAATGTGGGAGCGAATG TGCCTGCAACGT GTACTTCCCATCCTTGAACAAATACAG TACTGGAAGTTTGA TCGGCACAGCCAAAGAAGT AAAGAAGAAACCA CAGCTCTCGGAACATCTCGAA GGTCCCAGATA GTGGGAACAGGGTGGACACT CTGTGACTTCATCGT CCATCTGGTACCTGTGGTTCAG GTGAAGGCTGAGTGT CCTCACCAAGGCCTAACAGATG CTCTTC (2009) (0)
- Faculty Opinions recommendation of A nitric oxide/cysteine interaction mediates the activation of soluble guanylate cyclase. (2010) (0)
- PNAS Plus Significance Statements (2015) (0)
- Arylation of Sensitive 1‐(Pyrrolidin‐1‐yl)‐diazen‐1‐ium‐diolate in Ionic Liquids. (2010) (0)
- Abstract A42: Comparison between NO‐ASA and NONO‐ASA as safe anti‐inflammatory, analgesic, antipyretic, antioxidant chemopreventive prodrugs (2010) (0)
- Determination of 3-methyl-4,5-dihydro-1,2,3-oxadiazolium ion, a putative nitrosamine metabolite, by ion-pair chromatography with electrochemical detection (1990) (0)
- Faculty Opinions recommendation of Thionitroxides, RSNHO*: the structure of the SNO moiety in "S-Nitrosohemoglobin", a possible NO reservoir and transporter. (2006) (0)
- Qualitative thin-layer and high-performance liquid chromatographic analysis of 1-substituted diazen-1-ium-1,2-diolates on aminopropyl-bonded silica gel. (2002) (0)
- A Pluronic® micelle formulation increases the anti-leukemic activity of the novel anti-cancer nitric oxide prodrug JS-K. (2008) (0)
- Inhibitory agents and chemical and mechanisms in the dihalomethane-mediated nitrosation of amines with solid nitrite. (1980) (0)
- Nitrogen oxide freistetzende amidine- and enaminverwandte diazeniumdiolates preparations and uses thereof, and methods for their production (1998) (0)
- O53. Development of arylated nitric oxide-releasing prodrugs as anticancer agents (2006) (0)
- Toxicokinetic studies of N-nitrosamine carcinogenesis. (1991) (0)
- Erratum: Nitric oxide delivery via a permeable balloon catheter inhibits neointimal growth after arterial injury (Journal of Surgical Research (2013) 180:1 (35-42)) (2013) (0)
- Diazen-1-ium-1,2-diolates 1-substitutes o2-aryles ou o2-glycosyles et 1-[(2-carboxylato)pyrrolidin-1-yl]diazen-1-ium-1,2-diolates o2-subtitutes (1997) (0)
- Mutagenesis of nitric oxide (NO) versus ethylnitrosurea (ENU): Phenotypic and genotypic approaches in human cells (1994) (0)
- Abstract 5594: Immunotherapy of metastastic renal cell carcinoma reveals a critical role for nitric oxide expression in the control of lung metastases but not primary tumors (2010) (0)
- In memoriam: Christopher J. Michejda (December 19, 1937-January 9, 2007). (2007) (0)
- Displacement of O- versus N-Substituents from Nitrosamine-Derived Diazenium Ions by Three Divergent Mechanisms. (1988) (0)
- Abstract C102: Reactive oxygen species‐related killing of lung adenocarcinoma cells in culture and in vivo by diazeniumdiolate‐based nitric oxide‐releasing prodrugs (2009) (0)
- Abstract A35: JS-K, a nitric oxide-donating prodrug, inhibits the growth of leukemic jurkat cells and modulates β-catenin/TCF signaling (2008) (0)
- Complexes of nitrogen oxides with polyamines (1991) (0)
- Nitric Oxide: More than a Sum of Its Parts (2010) (0)
- United States Patent ( 19 ) Smith et al . 54 POLYSACCHARIDE-BOUND NITRIC OXDE NUCLEOPHILE ADDUCTS (2017) (0)
- Reaction of Nitric Oxide with Benzyl Cyanide to Yield a Bis‐diazeniumdiolated Imidate. (2001) (0)
- Obituary for Rolf Preussmann (1928–2012) (2013) (0)
- Focal suppression and induction of hyperplasia by the bladder carcinogens butyl(4-hydroxybutyl)nitrosamine and buty(3-carboxypropyl)nitrosamine in organ-cultured rat bladder epithelium. (1978) (0)
- P286 EFFECTS OF LIVER-SPECIFIC NO-DONOR, V-PYRRO/NO ON LIVER STEATOSIS IN MICE FED HIGH FAT DIET (2014) (0)
- Correction: Soy Intake Is Associated with Increased 2-Hydroxylation and Decreased 16-Hydroxylation of Estrogens in Asian-American Women (2009) (0)
- Abstract C175: JS-K, a nitric oxide-releasing anticancer prodrug with a broad spectrum of action. (2011) (0)
- Nitric oxide delivery agents: Metal complexes of R1R2N-N2O2- ligands with pharmacological activity. (1993) (0)
- Rapid Formation of a Potent Nitrosating Agent by Solvolysis of Ionic Nitrite in Dichloromethane. (1988) (0)
- Richard Loeppky (1937-2012). (2012) (0)
- Abstract B86: JS‐K, a nitric oxide‐donating prodrug, modulates β‐catenin/TCF signaling in leukemic Jurkat cells through S‐nitrosylation (2010) (0)
- A Symmetrically Hydrogen‐Bonded “Binitrosamine Cation” Produced on Protonation of N‐Nitrosopyrrolidine (1988) (0)
- Stereochemical Origins of Chromophore Extension in O2-Substituted Diazeniumdiolates, Prodrugs of Nitric Oxide (2013) (0)
- Electrophilic Addition to "AminoNONOate" (R1R2NN(O)NO-) Ions (1994) (0)
- Antihypertensive preparations and their use (1990) (0)
- Prevention and Epidemiology UrinaryEstrogensandEstrogenMetabolites andSubsequent Risk of Breast Cancer among Premenopausal Women (2012) (0)
- Relationship between nitrogen conformation and spectral properties in nitric oxide prodrugs (2008) (0)
- Improved efficacy of a nitric oxide‐eluting therapy in diabetes (2007) (0)
- General Cleavage of N-N and N-O Bonds Using Nickel/Aluminium Alloy. (1986) (0)
- Formation of Complexed Nitrosamines by Oxidation of Coordinated Ammonia in the Presence of Secondary Amines. (1989) (0)
- VPYRRO/NO, A SELECTIVE NITRIC OXIDE DONOR TO THE LIVER, IMPROVES HEPATIC HEMODYNAMICS AND FUNCTION. (1999) (0)
- P103. Targeting nitric oxide to macrophages with prodrugs of the O2-glycosylated diazeniumdiolate family (2006) (0)
- COMPLEX CONSISTS OF nitric oxide-nucleophile adducts AND OTHER LIGANDS FOR USE AS cardiovascular drugs (1993) (0)
- List of Contributors and Discussants (1981) (0)
- JS-K, a Novel Nitric Oxide (NO) Generator, Induces Cytochrome c Release and Caspase Activation in HL-60 Myeloid Leukemia Cells. (2004) (0)
- Abstract 3334: GSTP1-activated nitric oxide-releasing/PARP inhibitor hybrid prodrugs induce cancer cell death through ROS/RNS, DNA damage, ER stress, and apoptosis. (2013) (0)
- Anti‐proliferative properties of IPA/NO: a novel use of an HNO‐eluting compound (2007) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Larry Kay Keefer?
Larry Kay Keefer is affiliated with the following schools:
