Makiya Nishikawa
#165,867
Most Influential Person Now
Researcher
Makiya Nishikawa's AcademicInfluence.com Rankings
Makiya Nishikawacomputer-science Degrees
Computer Science
#9936
World Rank
#10424
Historical Rank
Machine Learning
#4481
World Rank
#4531
Historical Rank
Artificial Intelligence
#4839
World Rank
#4902
Historical Rank
Database
#6887
World Rank
#7128
Historical Rank
Download Badge
Computer Science
Makiya Nishikawa's Degrees
- PhD Computer Science University of Tokyo
- Masters Computer Science University of Tokyo
- Bachelors Computer Science University of Tokyo
Similar Degrees You Can Earn
Why Is Makiya Nishikawa Influential?
(Suggest an Edit or Addition)Makiya Nishikawa's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Nonviral vectors in the new millennium: delivery barriers in gene transfer. (2001) (590)
- Visualization and in vivo tracking of the exosomes of murine melanoma B16-BL6 cells in mice after intravenous injection. (2013) (503)
- Reactive oxygen species in tumor metastasis. (2008) (347)
- Macrophage-dependent clearance of systemically administered B16BL6-derived exosomes from the blood circulation in mice (2015) (334)
- Mannose receptor-mediated gene transfer into macrophages using novel mannosylated cationic liposomes (2000) (246)
- Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA. (2016) (212)
- Quantitative analysis of tissue distribution of the B16BL6-derived exosomes using a streptavidin-lactadherin fusion protein and iodine-125-labeled biotin derivative after intravenous injection in mice. (2015) (182)
- Catalase delivery for inhibiting ROS-mediated tissue injury and tumor metastasis. (2009) (173)
- Cell-specific delivery of genes with glycosylated carriers. (2001) (173)
- In Vivo Gene Delivery to the Liver Using Novel Galactosylated Cationic Liposomes (2000) (162)
- Molecular weight-dependent gene transfection activity of unmodified and galactosylated polyethyleneimine on hepatoma cells and mouse liver. (2003) (160)
- Biodegradable CpG DNA hydrogels for sustained delivery of doxorubicin and immunostimulatory signals in tumor-bearing mice. (2011) (159)
- Asialoglycoprotein receptor-mediated gene transfer using novel galactosylated cationic liposomes. (1998) (154)
- Hepatocyte-targeted in vivo gene expression by intravenous injection of plasmid DNA complexed with synthetic multi-functional gene delivery system (2000) (143)
- Cell type‐specific and common characteristics of exosomes derived from mouse cell lines: Yield, physicochemical properties, and pharmacokinetics (2017) (142)
- Design and development of nanosized DNA assemblies in polypod-like structures as efficient vehicles for immunostimulatory CpG motifs to immune cells. (2012) (142)
- Targeted delivery of plasmid DNA to hepatocytes in vivo: optimization of the pharmacokinetics of plasmid DNA/galactosylated poly(L-lysine) complexes by controlling their physicochemical properties. (1998) (136)
- Targeted delivery of plasmid DNA complexed with galactosylated poly(L-lysine). (1998) (136)
- Hepatic uptake of polystyrene microspheres in rats: effect of particle size on intrahepatic distribution. (1999) (134)
- Prevention of neutrophil-mediated hepatic ischemia/reperfusion injury by superoxide dismutase and catalase derivatives. (2001) (133)
- DNA nanotechnology-based composite-type gold nanoparticle-immunostimulatory DNA hydrogel for tumor photothermal immunotherapy. (2017) (132)
- Effect of exosome isolation methods on physicochemical properties of exosomes and clearance of exosomes from the blood circulation. (2016) (132)
- Pharmacokinetics of Exosomes-An Important Factor for Elucidating the Biological Roles of Exosomes and for the Development of Exosome-Based Therapeutics. (2017) (121)
- Role of Phosphatidylserine-Derived Negative Surface Charges in the Recognition and Uptake of Intravenously Injected B16BL6-Derived Exosomes by Macrophages. (2017) (118)
- Hydrodynamics‐based procedure involves transient hyperpermeability in the hepatic cellular membrane: implication of a nonspecific process in efficient intracellular gene delivery (2004) (117)
- Nonviral vector-mediated RNA interference: its gene silencing characteristics and important factors to achieve RNAi-based gene therapy. (2009) (114)
- Targeted delivery and improved therapeutic potential of catalase by chemical modification: combination with superoxide dismutase derivatives. (1999) (113)
- Targeted delivery of human recombinant superoxide dismutase by chemical modification with mono- and polysaccharide derivatives. (1992) (113)
- Factors affecting drug and gene delivery: effects of interaction with blood components. (2002) (107)
- Heat shock protein derivatives for delivery of antigens to antigen presenting cells. (2008) (107)
- Nonviral approaches satisfying various requirements for effective in vivo gene therapy. (2002) (106)
- Macrophage activation by a DNA/cationic liposome complex requires endosomal acidification and TLR9‐dependent and ‐independent pathways (2005) (104)
- Preservation of exosomes at room temperature using lyophilization (2018) (103)
- Injectable, self-gelling, biodegradable, and immunomodulatory DNA hydrogel for antigen delivery. (2014) (100)
- The assembly of a short linear natural cytosine-phosphate-guanine DNA into dendritic structures and its effect on immunostimulatory activity. (2009) (99)
- Enhanced immunostimulatory activity of oligodeoxynucleotides by Y‐shape formation (2008) (91)
- Physicochemical and disposition characteristics of antisense oligonucleotides complexed with glycosylated poly(L-lysine). (1997) (87)
- Accelerated growth of B16BL6 tumor in mice through efficient uptake of their own exosomes by B16BL6 cells (2017) (87)
- Click Chemistry as a Tool for Cell Engineering and Drug Delivery (2019) (80)
- Therapeutic effects of superoxide dismutase derivatives modified with mono- or polysaccharides on hepatic injury induced by ischemia/reperfusion. (1992) (77)
- Inhibition of Metastatic Tumor Growth in Mouse Lung by Repeated Administration of Polyethylene Glycol-Conjugated Catalase (2004) (76)
- Pharmacokinetics of receptor-mediated hepatic uptake of glycosylated albumin in mice (1992) (71)
- Restoration of dystrophin expression in mdx mice by intravascular injection of naked DNA containing full-length dystrophin cDNA (2004) (70)
- Galactosylated proteins are recognized by the liver according to the surface density of galactose moieties. (1995) (69)
- Induction of Potent Antitumor Immunity by Sustained Release of Cationic Antigen from a DNA‐Based Hydrogel with Adjuvant Activity (2015) (68)
- Effect of the content of unmethylated CpG dinucleotides in plasmid DNA on the sustainability of transgene expression (2009) (68)
- Inhibition of experimental pulmonary metastasis by controlling biodistribution of catalase in mice (2002) (68)
- Pharmacokinetic evaluation of polymeric carriers (1996) (68)
- Targeted and sustained drug delivery using PEGylated galactosylated liposomes. (2003) (66)
- Sustained Exogenous Expression of Therapeutic Levels of IFN-γ Ameliorates Atopic Dermatitis in NC/Nga Mice via Th1 Polarization (2010) (66)
- Inhibition of metastatic tumor growth by targeted delivery of antioxidant enzymes. (2005) (64)
- Vector-Based in Vivo RNA Interference: Dose- and Time-Dependent Suppression of Transgene Expression (2004) (64)
- Targeting Efficiency of Galactosylated Liposomes to Hepatocytes in Vivo: Effect of Lipid Composition (2002) (63)
- Inhibition of experimental hepatic metastasis by targeted delivery of catalase in mice (2004) (62)
- Pharmacokinetic analysis of in vivo disposition of succinylated proteins targeted to liver nonparenchymal cells via scavenger receptors: importance of molecular size and negative charge density for in vivo recognition by receptors. (2002) (61)
- PEGylated catalase prevents metastatic tumor growth aggravated by tumor removal. (2006) (59)
- The hydrodynamics-based procedure for controlling the pharmacokinetics of gene medicines at whole body, organ and cellular levels. (2005) (59)
- Transfer of full-length Dmd to the diaphragm muscle of Dmd(mdx/mdx) mice through systemic administration of plasmid DNA. (2001) (59)
- Cationic charge-dependent hepatic delivery of amidated serum albumin. (2005) (58)
- Role of Extracellular Vesicle Surface Proteins in the Pharmacokinetics of Extracellular Vesicles. (2018) (58)
- Significant Role of Liver Sinusoidal Endothelial Cells in Hepatic Uptake and Degradation of Naked Plasmid DNA After Intravenous Injection (2004) (56)
- Pharmacokinetics and targeted delivery of proteins and genes (1996) (56)
- Synthesis and pharmacokinetics of a novel macromolecular prodrug of Tacrolimus (FK506), FK506-dextran conjugate. (1999) (55)
- Inhibition of liver metastasis by targeting of immunomodulators using mannosylated liposome carriers. (2002) (55)
- Development of Polyethylene Glycol-Conjugated Poly-S-Nitrosated Serum Albumin, a Novel S-Nitrosothiol for Prolonged Delivery of Nitric Oxide in the Blood Circulation in Vivo (2005) (54)
- Self-assembling DNA dendrimer for effective delivery of immunostimulatory CpG DNA to immune cells. (2015) (53)
- Targeted delivery of drugs and proteins to the liver via receptor-mediated endocytosis (1997) (50)
- Enhanced Class I Tumor Antigen Presentation via Cytosolic Delivery of Exosomal Cargos by Tumor-Cell-Derived Exosomes Displaying a pH-Sensitive Fusogenic Peptide. (2017) (50)
- Hepatocyte-targeted gene transfer by combination of vascularly delivered plasmid DNA and in vivo electroporation (2005) (49)
- In vivo recognition of mannosylated proteins by hepatic mannose receptors and mannan-binding protein. (2001) (49)
- Characterization of Plasmid DNA Binding and Uptake by Peritoneal Macrophages from Class A Scavenger Receptor Knockout Mice (1999) (48)
- Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases. (2005) (47)
- Efficient scavenger receptor‐mediated uptake and cross‐presentation of negatively charged soluble antigens by dendritic cells (2004) (47)
- Control of pharmacokinetic profiles of drug—macromolecule conjugates (1996) (47)
- Influence of Physicochemical Properties on Pharmacokinetics of Non-viral Vectors for Gene Delivery (2002) (47)
- Corrigendum: Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion (2015) (47)
- Development of gene drug delivery systems based on pharmacokinetic studies. (2001) (46)
- Restricted cytokine production from mouse peritoneal macrophages in culture in spite of extensive uptake of plasmid DNA (2004) (45)
- Inhibition of peritoneal dissemination of tumor cells by single dosing of phosphodiester CpG oligonucleotide/cationic liposome complex. (2006) (45)
- Pharmacokinetics and In Vivo Gene Transfer of Plasmid DNA Complexed with Mannosylated Poly(L-Lysine) in Mice (2000) (45)
- Uptake characteristics of mannosylated and fucosylated bovine serum albumin in primary cultured rat sinusoidal endothelial cells and Kupffer cells. (2004) (45)
- Synthesis and Pharmacokinetics of a New Liver-Specific Carrier, Glycosylated Carboxymethyl-Dextran, and Its Application to Drug Targeting (2004) (45)
- Near-infrared fluorescence probes for enzymes based on binding affinity modulation of squarylium dye scaffold. (2012) (44)
- Inhibition of tumour metastasis by targeted delivery of antioxidant enzymes (2006) (44)
- Development of nitric oxide donors for the treatment of cardiovascular diseases. (2007) (43)
- Theoretical considerations involving the pharmacokinetics of plasmid DNA. (2005) (43)
- Design of polymeric prodrugs of prostaglandin E(1) having galactose residue for hepatocyte targeting. (1999) (42)
- Liver targeting of catalase by cationization for prevention of acute liver failure in mice. (2006) (42)
- Targeted delivery of superoxide dismutase to macrophages via mannose receptor-mediated mechanism. (1994) (42)
- Control of in vivo fate of albumin derivatives utilizing combined chemical modification. (1994) (42)
- Tissue-Specific Characteristics of in Vivo Electric Gene: Transfer by Tissue and Intravenous Injection of Plasmid DNA (2005) (41)
- Hepatocyte-specific distribution of catalase and its inhibitory effect on hepatic ischemia/reperfusion injury in mice. (1999) (41)
- Analysis of Hepatic Disposition of Galactosylated Cationic Liposome/Plasmid DNA Complexes in Perfused Rat Liver (2003) (40)
- Reactivation of silenced transgene expression in mouse liver by rapid, large-volume injection of isotonic solution. (2008) (39)
- Self-assembling DNA hydrogel-based delivery of immunoinhibitory nucleic acids to immune cells. (2016) (39)
- Pharmacokinetic evaluation of mannosylated bovine serum albumin as a liver cell-specific carrier: quantitative comparison with other hepatotropic ligands. (1999) (38)
- Development of cell-specific targeting systems for drugs and genes. (2005) (38)
- Involvement of serum mannan binding proteins and mannose receptors in uptake of mannosylated liposomes by macrophages. (2001) (37)
- Use of lipoplex‐induced nuclear factor‐κB activation to enhance transgene expression by lipoplex in mouse lung (2006) (36)
- Induction of tumor-specific immune response by gene transfer of Hsp70-cell-penetrating peptide fusion protein to tumors in mice. (2010) (35)
- Improved anti‐cancer effect of interferon gene transfer by sustained expression using CpG‐reduced plasmid DNA (2007) (35)
- Combining cisplatin with cationized catalase decreases nephrotoxicity while improving antitumor activity. (2007) (35)
- Targeting of superoxide dismutase to the liver results in anti-inflammatory effects in rats with fibrotic livers. (1999) (34)
- Gene silencing of β‐catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice (2008) (34)
- Depressive symptoms as a side effect of Interferon-α therapy induced by induction of indoleamine 2,3-dioxygenase 1 (2016) (34)
- SOD derivatives prevent metastatic tumor growth aggravated by tumor removal (2008) (34)
- Demonstration of the Receptor‐mediated Hepatic Uptake of Dextran in Mice (1992) (34)
- Sequence-Specific Suppression of mdr1a/1b Expression in Mice via RNA Interference (2005) (33)
- DNA-based nano-sized systems for pharmaceutical and biomedical applications. (2010) (33)
- Mechanisms of hepatic disposition of polystyrene microspheres in rats: effects of serum depend on the sizes of microspheres. (1999) (33)
- Optimization of Albumin Secretion and Metabolic Activity of Cytochrome P450 1A1 of Human Hepatoblastoma HepG2 Cells in Multicellular Spheroids by Controlling Spheroid Size. (2017) (33)
- Effects of inflammatory response on in vivo transgene expression by plasmid DNA in mice. (2008) (32)
- Efficient delivery of immunostimulatory DNA to mouse and human immune cells through the construction of polypod-like structured DNA. (2014) (32)
- Prevention of Hepatic Ischemia/Reperfusion Injury by Prolonged Delivery of Nitric Oxide to the Circulating Blood in Mice (2008) (31)
- Prevention of ischemia/reperfusion injury by hepatic targeting of nitric oxide in mice. (2009) (31)
- Improved sustained release of antigen from immunostimulatory DNA hydrogel by electrostatic interaction with chitosan. (2017) (30)
- Hepatic targeting of drugs and proteins by chemical modification (1995) (30)
- Development of a hepatocyte-specific prostaglandin E(1) polymeric prodrug and its potential for preventing carbon tetrachloride-induced fulminant hepatitis in mice. (1999) (29)
- Biodistribution Characteristics of Galactosylated Emulsions and Incorporated Probucol for Hepatocyte-Selective Targeting of Lipophilic Drugs in Mice (2004) (29)
- Inhibition of adhesion and proliferation of peritoneally disseminated tumor cells by pegylated catalase (2006) (29)
- Prevention of pulmonary metastasis from subcutaneous tumors by binary system-based sustained delivery of catalase. (2009) (29)
- Hydrogen peroxide‐mediated nuclear factor κB activation in both liver and tumor cells during initial stages of hepatic metastasis (2008) (28)
- Transplantation of insulin-secreting multicellular spheroids for the treatment of type 1 diabetes in mice. (2014) (28)
- DNA nanotechnology-based development of delivery systems for bioactive compounds. (2014) (28)
- Quantitative and temporal analysis of gene silencing in tumor cells induced by small interfering RNA or short hairpin RNA expressed from plasmid vectors. (2009) (28)
- Suppression of tumor growth by intratumoral injection of short hairpin RNA-expressing plasmid DNA targeting β-catenin or hypoxia-inducible factor 1α (2006) (28)
- Histogram analysis of pharmacokinetic parameters by bootstrap resampling from one-point sampling data in animal experiments. (2006) (27)
- Anticancer drug-loaded mesenchymal stem cells for targeted cancer therapy. (2020) (26)
- Inhibition of tumor cell growth in the liver by RNA interference-mediated suppression of HIF-1α expression in tumor cells and hepatocytes (2008) (26)
- Design for Cell-Specific Targeting of Proteins Utilizing Sugar-Recognition Mechanism: Effect of Molecular Weight of Proteins on Targeting Efficiency (1995) (26)
- Simultaneous delivery of doxorubicin and immunostimulatory CpG motif to tumors using a plasmid DNA/doxorubicin complex in mice. (2010) (26)
- Pharmacokinetic Analysis of Lectin-dependent Biodistribution of Fucosylated Bovine Serum Albumin: A Possible Carrier for Kupffer Cells (2001) (26)
- Design of PCR-amplified DNA fragments for in vivo gene delivery: size-dependency on stability and transgene expression. (2007) (25)
- Tissue and intrahepatic distribution and subcellular localization of a mannosylated lipoplex after intravenous administration in mice. (2004) (25)
- Structural and immunostimulatory properties of Y-shaped DNA consisting of phosphodiester and phosphorothioate oligodeoxynucleotides. (2010) (25)
- Poly(N-isopropylacrylamide)-coated microwell arrays for construction and recovery of multicellular spheroids. (2013) (25)
- Development and Pharmacokinetics of Galactosylated Poly-L-Glutamic Acid as a Biodegradable Carrier for Liver-Specific Drug Delivery (1996) (25)
- Disposition of radioactivity after injection of liver-targeted proteins labeled with 111In or 125I. Effect of labeling on distribution and excretion of radioactivity in rats. (1999) (25)
- Prolonged circulation half-life of interferon γ activity by gene delivery of interferon γ-serum albumin fusion protein in mice. (2011) (24)
- Synthesis and pharmacological activity of a novel water-soluble hepatocyte-specific polymeric prodrug of prostaglandin E(1) using lactosylated poly(L-glutamic hydrazide) as a carrier. (2001) (24)
- Pharmacokinetics of Plasmid DNA-Based Non-viral Gene Medicine. (2005) (24)
- Physicochemical, tissue distribution, and vasodilation characteristics of nitrosated serum albumin: delivery of nitric oxide in vivo. (2004) (23)
- Small-molecule-induced clustering of heparan sulfate promotes cell adhesion. (2013) (23)
- Residualizing indium-111-radiolabel for plasmid DNA and its application to tissue distribution study. (2003) (22)
- DNA and its cationic lipid complexes induce CpG motif‐dependent activation of murine dendritic cells (2007) (22)
- Electrical charge on protein regulates its absorption from the rat small intestine. (2002) (22)
- Disposition characteristics of glycosylated poly(amino acids) as liver cell-specific drug carrier. (1998) (22)
- Pharmacokinetics and Preventive Effects of Targeted Catalase Derivatives on Hydrogen Peroxide-Induced Injury in Perfused Rat Liver (2002) (22)
- Improvement of insulin resistance by removal of systemic hydrogen peroxide by PEGylated catalase in obese mice. (2010) (22)
- Increase in CpG DNA-induced inflammatory responses by DNA oxidation in macrophages and mice. (2011) (22)
- Development of PEGylated Cysteine-Modified Lysine Dendrimers with Multiple Reduced Thiols To Prevent Hepatic Ischemia/Reperfusion Injury. (2016) (21)
- Pharmacokinetic analysis of hepatic uptake of galactosylated bovine serum albumin in a perfused rat liver. (1998) (21)
- Combined encapsulation of a tumor antigen and immune cells using a self‐assembling immunostimulatory DNA hydrogel to enhance antigen‐specific tumor immunity (2018) (21)
- Pharmacokinetic and Tissue Distribution Mechanism of Mouse Recombinant Heat Shock Protein 70 in Mice (2005) (21)
- Pharmacokinetic considerations regarding non‐viral cancer gene therapy (2008) (20)
- Development of DNA-anchored assembly of small extracellular vesicle for efficient antigen delivery to antigen presenting cells. (2019) (20)
- In Vivo Tracking of Extracellular Vesicles in Mice Using Fusion Protein Comprising Lactadherin and Gaussia Luciferase. (2017) (20)
- Retardation of Antigen Release from DNA Hydrogel Using Cholesterol‐Modified DNA for Increased Antigen‐Specific Immune Response (2017) (20)
- Analysis of In Vivo Nuclear Factor-κB Activation during Liver Inflammation in Mice: Prevention by Catalase Delivery (2007) (20)
- Hepatic delivery of particulates in the submicron range by a hydrodynamics‐based procedure: implications for particulate gene delivery systems (2004) (19)
- Liver uptake and hepato-biliary transfer of galactosylated proteins in rats are determined by the extent of galactosylation. (1999) (18)
- Pivotal role of oxidative stress in tumor metastasis under diabetic conditions in mice. (2013) (18)
- Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion (2015) (18)
- Inhibition of peritoneal dissemination of tumor cells by cationized catalase in mice. (2007) (18)
- Hsp-based tumor vaccines: state-of-the-art and future directions. (2007) (17)
- Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene (2017) (17)
- Molecular Design of Bisphosphonate-Modified Proteins for Efficient Bone Targeting In Vivo (2015) (17)
- Constant and steady transgene expression of interferon‐γ by optimization of plasmid construct for safe and effective interferon‐γ gene therapy (2012) (17)
- Optimal Arrangement of Four Short DNA Strands for Delivery of Immunostimulatory Nucleic Acids to Immune Cells. (2015) (17)
- Synthetic molecules that protect cells from anoikis and their use in cell transplantation. (2014) (17)
- Comparison of the type of liposome involving cytokine production induced by non-CpG Lipoplex in macrophages. (2010) (17)
- Self-assembling CpG DNA nanoparticles for efficient antigen delivery and immunostimulation. (2012) (17)
- Increased Insulin Secretion from Insulin-Secreting Cells by Construction of Mixed Multicellular Spheroids (2015) (16)
- Nanostructured DNA for the delivery of therapeutic agents. (2019) (16)
- Amelioration of Experimental Autoimmune Encephalomyelitis in Mice by Interferon-Beta Gene Therapy, Using a Long-Term Expression Plasmid Vector. (2017) (16)
- Cationized catalase-loaded hydrogel for growth inhibition of peritoneally disseminated tumor cells. (2007) (16)
- Effects of Localization of Antigen Proteins in Antigen-Loaded Exosomes on Efficiency of Antigen Presentation. (2019) (16)
- Enhancement of antiproliferative activity of interferons by RNA interference‐mediated silencing of SOCS gene expression in tumor cells (2008) (16)
- TLR9‐dependent systemic interferon‐β production by intravenous injection of plasmid DNA/cationic liposome complex in mice (2009) (16)
- Enhanced generation of cytotoxic T lymphocytes by heat shock protein 70 fusion proteins harboring both CD8(+) T cell and CD4(+) T cell epitopes. (2010) (15)
- Effects of upregulated indoleamine 2, 3-dioxygenase 1 by interferon γ gene transfer on interferon γ-mediated antitumor activity (2014) (15)
- Development of a novel Hsp70-based DNA vaccine as a multifunctional antigen delivery system. (2010) (15)
- Development of safe and effective nonviral gene therapy by eliminating CpG motifs from plasmid DNA vector. (2012) (15)
- Cellular activation by plasmid DNA in various macrophages in primary culture. (2008) (14)
- Development of orally‐deliverable DNA hydrogel by microemulsification and chitosan coating (2018) (14)
- Development of RNA/DNA Hydrogel Targeting Toll-Like Receptor 7/8 for Sustained RNA Release and Potent Immune Activation (2020) (14)
- Serum mannan binding protein inhibits mannosylated liposome-mediated transfection to macrophages. (2002) (14)
- Cellular uptake and activation characteristics of naked plasmid DNA and its cationic liposome complex in human macrophages. (2005) (14)
- Inhibitory effects of safe and novel SOD derivatives, galactosylated-SOD, on hepatic warm ischemia/reperfusion injury in pigs. (2005) (14)
- Development of bone-targeted catalase derivatives for inhibition of bone metastasis of tumor cells in mice. (2012) (13)
- Enhanced generation of cytotoxic T lymphocytes by increased cytosolic delivery of MHC class I epitope fused to mouse heat shock protein 70 via polyhistidine conjugation. (2009) (13)
- Positive Correlation Between the Generation of Reactive Oxygen Species and Activation/Reactivation of Transgene Expression After Hydrodynamic Injections into Mice (2011) (13)
- Simultaneous detection of DsRed2‐tagged and EGFP‐tagged human β‐interferons in the same single cells (2004) (13)
- Glycosylated cationic liposomes for carbohydrate receptor-mediated gene transfer. (2003) (13)
- Increased immunostimulatory activity of polypod-like structured DNA by ligation of the terminal loop structures. (2012) (13)
- Using size-controlled multicellular spheroids of murine adenocarcinoma cells to efficiently establish pulmonary tumors in mice. (2017) (13)
- Control of polarization and tumoricidal activity of macrophages by multicellular spheroid formation (2018) (13)
- Plasmid DNA uptake and subsequent cellular activation characteristics in human monocyte-derived cells in primary culture. (2007) (12)
- Pharmacokinetic evaluation of biodistribution data obtained with radiolabeled proteins in mice. (1999) (12)
- Regulation of immunological balance by sustained interferon-γ gene transfer for acute phase of atopic dermatitis in mice (2012) (12)
- Targeting Delivery of Protein Drugs by Chemical Modification (1994) (12)
- Long-term drug modification to the surface of mesenchymal stem cells by the avidin-biotin complex method (2017) (12)
- Expression profile-dependent improvement of insulin sensitivity by gene delivery of interleukin-6 in a mouse model of type II diabetes. (2013) (12)
- Polypod-Shaped DNAs: Small-Angle X-ray Scattering and Immunostimulatory Activity. (2016) (11)
- Mesenchymal stem/stromal cells as next-generation drug delivery vehicles for cancer therapeutics (2021) (11)
- Enhanced antigen-specific antibody production following polyplex-based DNA vaccination via the intradermal route in mice. (2006) (11)
- Nasal delivery of Japanese cedar pollen Cryj1 by using self-gelling immunostimulatory DNA for effective induction of immune responses in mice. (2015) (11)
- Enhanced CTL response by controlled intracellular trafficking of antigen in dendritic cells following DNA vaccination. (2009) (11)
- Intracellular distribution of NFκB decoy and its inhibitory effect on TNFα production by LPS stimulated RAW 264.7 cells (2005) (11)
- Enhancement of anticancer effect of interferon-γ gene transfer against interferon-γ-resistant tumor by depletion of tumor-associated macrophages. (2014) (10)
- Development of PEGylated serum albumin with multiple reduced thiols as a long-circulating scavenger of reactive oxygen species for the treatment of fulminant hepatic failure in mice. (2014) (10)
- The uptake and degradation of DNA is impaired in macrophages and dendritic cells from NZB/W F(1) mice. (2005) (10)
- Moment analysis for kinetics of gene silencing by RNA interference. (2006) (10)
- Saturation of transgene protein synthesis from mRNA in cells producing a large number of transgene mRNA (2011) (10)
- Development of safe and effective nonviral gene therapy by eliminating CpG motifs from plasmid DNA vector (2012) (10)
- Analysis of hepatic disposition of native and galactosylated polyethylenimine complexed with plasmid DNA in perfused rat liver. (2003) (10)
- Injection site‐dependent induction of immune response by DNA vaccine: comparison of skin and spleen as a target for vaccination (2010) (10)
- Safe and effective interferon-beta gene therapy for the treatment of multiple sclerosis by regulating biological activity through the design of interferon-beta-galectin-9 fusion proteins. (2018) (10)
- Multifunctionalization of Cells with a Self-Assembling Molecule to Enhance Cell Engraftment. (2019) (9)
- Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice (2014) (9)
- Controlling the kinetics of interferon transgene expression for improved gene therapy (2012) (9)
- Evaluation of antiviral effect of type I, II, and III interferons on direct‐acting antiviral‐resistant hepatitis C virus (2017) (9)
- Removal of transgene‐expressing cells by a specific immune response induced by sustained transgene expression (2014) (9)
- Synthesis and biodistribution study of liver-specific prostaglandin E1 polymeric conjugate (1997) (9)
- Regulation of proliferation and functioning of transplanted cells by using herpes simplex virus thymidine kinase gene in mice (2018) (9)
- In Vitro and In Vivo Stimulation of Toll-Like Receptor 9 by CpG Oligodeoxynucleotides Incorporated Into Polypod-Like DNA Nanostructures. (2017) (9)
- Suppression of tumor growth by intratumoral injection of short hairpin RNA-expressing plasmid DNA targeting beta-catenin or hypoxia-inducible factor 1alpha. (2006) (9)
- Influence of cholesterol composition on the association of serum mannan-binding proteins with mannosylated liposomes. (2006) (8)
- Insertion of nuclear factor-kappaB binding sequence into plasmid DNA for increased transgene expression in colon carcinoma cells. (2008) (8)
- Interferon-Inducible Mx Promoter-Driven, Long-Term Transgene Expression System of Interferon-β for Cancer Gene Therapy. (2016) (8)
- Persistent interferon transgene expression by RNA interference‐mediated silencing of interferon receptors (2010) (8)
- Induction of antigen-specific cytotoxic T lymphocytes by immunization with negatively charged soluble antigen through scavenger receptor-mediated delivery. (2007) (8)
- Development of nanoparticles derived from corn as mass producible bionanoparticles with anticancer activity (2021) (8)
- Contribution of Epigenetic Modifications to the Decline in Transgene Expression from Plasmid DNA in Mouse Liver (2015) (8)
- X-ray scattering from immunostimulatory tetrapod-shaped DNA in aqueous solution to explore its biological activity-conformation relationship. (2014) (8)
- Design of polymeric prodrugs of PGE1 for cell-specific hepatic targeting. (2000) (8)
- Induction of cytotoxic T lymphocytes following immunization with cationized soluble antigen. (2004) (8)
- Application of Magnesium Pyrophosphate-Based Sponge-Like Microparticles to Enhance the Delivery Efficiency and Adjuvant Effects of Polyriboinosinic-Polyribocytidylic Acid in Immune Cells. (2016) (7)
- Stable Surface Modification of Mesenchymal Stem Cells Using the Avidin-Biotin Complex Technique. (2018) (7)
- Analysis of the molecular interaction between mannosylated proteins and serum mannan-binding lectins. (2006) (7)
- PS141. Depressive Symptoms, as a side effect of Interferon-α therapy induced by induction of indoleamine 2,3-dioxygenase 1 (2016) (7)
- [In vivo siRNA delivery to tumor cells and its application to cancer gene therapy]. (2007) (6)
- Development of CD40L-modified tumor small extracellular vesicles for effective induction of antitumor immune response. (2020) (6)
- Long-term elimination of hepatitis C virus from human hepatocyte chimeric mice after interferon-γ gene transfer. (2014) (6)
- SELEX-Based Screening of Exosome-Tropic RNA. (2017) (6)
- Inhibition of surgical trauma-enhanced peritoneal dissemination of tumor cells by human catalase derivatives in mice. (2011) (6)
- Cholesterol is required for the polarized secretion of erythropoietin in Madin-Darby canine kidney cells. (2005) (6)
- [Analysis and Control of in Vivo Kinetics of Exosomes for the Development of Exosome-based DDS]. (2016) (6)
- Rapid Regulation of Human Mesenchymal Stem Cell Proliferation Using Inducible Caspase-9 Suicide Gene for Safe Cell-Based Therapy (2019) (6)
- Analysis of the molecular interaction of glycosylated proteins with rabbit liver asialoglycoprotein receptors using surface plasmon resonance spectroscopy. (2006) (6)
- Erratum to 'Preservation of exosomes at room temperature using lyophilization' [International Journal of Pharmaceutics 553 (2018) 1-7]. (2019) (6)
- Gene delivery of albumin binding peptide-interferon-gamma fusion protein with improved pharmacokinetic properties and sustained biological activity. (2013) (6)
- Manipulation of local disposition and gene expression characteristics of plasmid DNA following intramuscular administration by complexation with cationic macromolecule. (2005) (6)
- Atomic force microscopy analysis of orientation and bending of oligodeoxynucleotides in polypod-like structured DNA (2015) (5)
- Elucidation of the Mechanism of Increased Activity of Immunostimulatory DNA by the Formation of Polypod-like Structure (2017) (5)
- Receptor-Mediated Cell Specific Delivery of Drugs to the Liver and Kidney (1996) (5)
- Subcellular trafficking of exogenously expressed interferon‐β in Madin–Darby canine kidney cells (2004) (5)
- Development of a Nanostructured RNA/DNA Assembly as an Adjuvant Targeting Toll-Like Receptor 7/8. (2019) (5)
- Intracellular Delivery of Antisense DNA and siRNA with Amino Groups Masked with Disulfide Units. (2020) (4)
- Gene Therapy and Gene Delivery (2005) (4)
- Effects of methyl-beta-cyclodextrin treatment on secretion profile of interferon-beta and zonula occuludin-1 architecture in Madin-Darby canine kidney cell monolayers. (2009) (4)
- Incorporation of Gelatin Microspheres into HepG2 Human Hepatocyte Spheroids for Functional Improvement through Improved Oxygen Supply to Spheroid Core. (2020) (4)
- Hepatic targeting of proteins utilizing carbohydrate recognition mechanism. (1991) (4)
- Effects of transgene expression level per cell in mice livers on induction of transgene-specific immune responses after hydrodynamic gene transfer (2016) (4)
- Effects of Methyl-β-cyclodextrin Treatment on Secretion Profile of Interferon-β and Zonula Occuludin-1 Architecture in Madin–Darby Canine Kidney Cell Monolayers (2009) (4)
- Intracellular distribution of NFkappaB decoy and its inhibitory effect on TNFalpha production by LPS stimulated RAW 264.7 cells. (2005) (4)
- DNA density-dependent uptake of DNA origami-based two-or three-dimensional nanostructures by immune cells. (2020) (4)
- Combined use of chemically modified nucleobases and nanostructured DNA for enhanced immunostimulatory activity of CpG oligodeoxynucleotide. (2020) (3)
- [Optimization of in-vivo gene transfer through regulating biological response to vectors]. (2006) (3)
- Critical contribution of macrophage scavenger receptor 1 to the uptake of nanostructured DNA by immune cells. (2021) (3)
- Folding of single-stranded circular DNA into rigid rectangular DNA accelerates its cellular uptake. (2019) (3)
- Pharmacokinetic Properties of Nanomaterials (2016) (3)
- Construction of Monomeric and Dimeric G-Quadruplex-Structured Cytosine-Phosphate-Guanine Oligodeoxynucleotides for Enhanced Uptake and Activation in Toll-Like Receptor 9-Positive Macrophages. (2020) (3)
- Control of hypoxia-induced tumor cell adhesion by cytophilic human catalase. (2009) (3)
- Enhanced Activity of Immunosuppressive Oligodeoxynucleotides by Incorporating Them into Hexapod-Like Nanostructured DNA. (2018) (3)
- Cell-based interferon gene therapy using proliferation-controllable, interferon-releasing mesenchymal stem cells (2019) (3)
- Fibronectin inhibits cytokine production induced by CpG DNA in macrophages without direct binding to DNA. (2012) (3)
- Basic pharmacokinetics of oligonucleotides and genes (2002) (2)
- Nutrient-Based Chemical Library as a Source of Energy Metabolism Modulators. (2019) (2)
- Nucleic Acid Drugs and DNA-based Delivery Systems. (2016) (2)
- 5′‐Phosphate oligodeoxynucleotides enhance the phosphodiester‐CpG DNA‐induced inflammatory response in macrophages (2011) (2)
- Targeted Delivery of Interferon Gamma Using a Recombinant Fusion Protein of a Fibrin Clot-Binding Peptide With Interferon Gamma for Cancer Gene Therapy. (2017) (2)
- Comparison of antigen expression from plasmid DNA in tumor-free and antigen-expressing tumor-bearing mice (2012) (2)
- Inhibition of nuclear delivery of plasmid DNA and transcription by interferon γ: hurdles to be overcome for sustained gene therapy (2011) (2)
- Bootstrap method-based estimation of the minimum sample number for obtaining pharmacokinetic parameters in preclinical experiments. (2010) (2)
- Chemoproteomic Profiling of a Pharmacophore-Focused Chemical Library. (2020) (2)
- Unique cytokine production profile following stimulation with DNA in macrophages from NZB/W F1 mice. (2008) (2)
- [Development of heat shock proteins with controlled distribution properties and their application to vaccine delivery]. (2007) (2)
- Secretion mode and subcellular localization of human interferon-beta exogenously expressed in porcine renal epithelial LLC-PK1 cells. (2004) (2)
- Role of tyrosine and tryptophan in chemically modified serum albumin on its tissue distribution. (2006) (2)
- Construction of nanostructured DNA harbouring phosphorodiamidate morpholino oligonucleotide for controlled tissue distribution in mice (2017) (2)
- Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization (2022) (1)
- [Optimization of gene therapy effect by spaciotemporal control of expressed proteins]. (2010) (1)
- Development of multicellular spheroid for cell-based therapy (2013) (1)
- Pharmacokinetics of polymer-plasmid DNA complex (2004) (1)
- Enhanced Immunostimulatory Activity of CpG Oligodeoxynucleotide by the Combination of Mannose Modification and Incorporation into Nanostructured DNA. (2020) (1)
- RNAi-based gene silencing in mice (2004) (1)
- Intravenous injection of mesenchymal stem cell spheroids improves the pulmonary delivery and prolongs in vivo survival (2021) (1)
- Calcium Peroxide-Containing Polydimethylsiloxane-Based Microwells for Inhibiting Cell Death in Spheroids through Improved Oxygen Supply. (2021) (1)
- [Control of spatiotemporal distribution of interferon γ by genetically fusing functional peptides]. (2012) (1)
- Development of Heat Shock Proteins with Controlled Distribution Properties and Their Application to Vaccine Delivery (2007) (1)
- Polypod-like structured guanine-rich oligonucleotide aptamer as a selective and cytotoxic nanostructured DNA to cancer cells (2020) (1)
- Interaction of drug carriers with blood components and their application to drug targeting (1999) (0)
- Calcium Peroxide-Containing Polydimethylsiloxane-Based Microwells for Inhibiting Cell Death in Multicellular Spheroids Through Improved Oxygen Supply (2020) (0)
- CACAGTCATCAGTA GACGTT GCAGTCAGTCTTTTGACTGACTGCAACG TCTACTGAAGCTGCTAGCAAGCTCAGTCAGTTTTCTGACTGAGCTTGC TAGCAGCTGCACAT GACGTT CCATGCATGCTTTTGCATGCATGGAACG TCATGTGCTGACTGTGACTGTCCAGTCAGTTTTTACTGACTGGACAGT GACAGTCACAGTCATCAGTA GACGTT GCAGTCAGTCTTTTGACTGACT GCAACGTCTACTGAAGCTGCTAGCAAGCTCAGTCAGTTTTCTGACTGA (2012) (0)
- Forthcoming papers (2006) (0)
- Intradermal delivery of Cryj1 loaded in CpG DNA hydrogel for inhibiting allergic reactions in mice. (2023) (0)
- Pharmacokinetic Analysis of the in Vivo Disposition of Chemically Modified Proteins in Rats : Effect of Radiolabeling Method (1998) (0)
- Drug-preloadable methacrylated gelatin microspheres fabricated using an aqueous two-phase system (2022) (0)
- Development of Corn-Derived Nanoparticles as Mass-Producible Bionanoparticles with Anticancer Activity (2021) (0)
- Making effective presentation slides (2022) (0)
- In vivo fate of exogenously-administered exosomes (2014) (0)
- Cell-specific targeting of drugs and genes with glycosylated liposomes: Comparison with glycosylated poly(amino acids) (2000) (0)
- Quantitative Model Analysis and Simulation of Pharmacokinetics and Metastasis-Associated Lung Adenocarcinoma 1 RNA Knockdown Effect After Systemic Administration of Cholesterol-Conjugated DNA/RNA Heteroduplex Oligonucleotide Crossing Blood–Brain Barrier of Mice (2022) (0)
- Quality evaluation of cell spheroids for transplantation by monitoring oxygen consumption using an on-chip electrochemical device (2022) (0)
- Control of disposition characteristics of catalase by chemical modification (1996) (0)
- Analysis of Tertiary Structural Features of Branched DNA Nanostructures with Partially Common Sequences Using Small-Angle X-ray Scattering. (2019) (0)
- Innovation on pharmaceutical modalities and DDS (2023) (0)
- Quality Evaluation of Cell Spheroids by Monitoring Oxygen Consumption Using an On-Chip Electrochemical Device (2022) (0)
- 2A2-C06 Alginate gel beads dispersed gold nanoparticles for hyperthermia therapy application (2015) (0)
- Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene (2017) (0)
- Development of oligonucleotide-based nano-sized DDS (2010) (0)
- 40. Increased Transgene Expression of Dystrophin in mdx Muscle by RNAi-Mediated Silencing of Calpain Expression (2006) (0)
- [FOREWORD]Issues on Nucleic Acid and Gene Medicines and DDS Development (2019) (0)
- Tissue-specific in vivo gene transfer characteristics following direct injection of plasmid DNA (2003) (0)
- Controlling the function of genes and biologically active nucleic acids. (2019) (0)
- Pharmacokinetics of plasmid DNA-based non-viral gene medicine. (2005) (0)
- Delivery of Corn-Derived Nanoparticles with Anticancer Activity to Tumor Tissues by Modification with Polyethylene Glycol for Cancer Therapy (2022) (0)
- Increased Insulin Secretion from Insulin-Secreting Cells by Construction of Mixed Multicellular Spheroids (2015) (0)
- Pharmacokinetic analysis of mannose receptor-mediated hepatic targeting of proteins: Capacity-limited hepatic uptake and saturable binding in plasma (1998) (0)
- DEVELOPMENT OF HEPATOCYTE-SPECIFIC GENE DELIVERY SYSTEMS BASED ON PHARMACOKINETIC STUDIES (2000) (0)
- Optimization of Gene Therapy Effect by Spaciotemporal Control of Expressed Proteins (2011) (0)
- Erratum to “Intracellular distribution of NFκB decoy and its inhibitory effect on TNFα production by LPS stimulated RAW 264.7 cells” [J. Control. Release 107(2005) 373–382] (2006) (0)
- Tissue Distribution of Exosomes and Other Extracellular Vesicles (2021) (0)
- DIFFERENTIAL ROLE OF SERUM MANNAN BINDING PROTEIN IN PHARMACOKINETICS OF MANNOSYLATED POLYMERIC AND PARTICULATE DRUG CARRIERS (2001) (0)
- Title Nasal delivery of Japanese cedar pollen Cryj1 by using self- gelling immunostimulatory DNA for effective induction of immune responses in mice (2017) (0)
- Cell therapeutics loaded with drug delivery system technology (2023) (0)
- The effect of the molecular weight of glycosylated proteins on their targeting efficiency to the liver. (1994) (0)
- 701. Enhanced Anti-Tumor Effect of Interferon Gene Transfer by Sustained Transgene Expression Using CpG-Reduced Plasmid DNA (2005) (0)
- Application of a sodium alginate hydrogel for clear preoperative endoscopic marking using India ink (2020) (0)
- Drug Metabolism and Pharmacokinetics of Antisense Oligonucleotide Therapeutics: Typical Profiles, Evaluation Approaches, and Points to Consider Compared with Small Molecule Drugs (2023) (0)
- Title Biodegradable CpG DNA hydrogels for sustained delivery of doxorubicin and immunostimulatory signals in tumor-bearing mice (2017) (0)
- Improved functioning and targeting of nucleic acid-based immune adjuvants in cancer therapy (2019) (0)
- In vivo siRNA Delivery to Tumor Cells and Its Application to Cancer Gene Therapy (2008) (0)
- Title Molecular Design of Bisphosphonate-Modified Proteins forEfficient Bone Targeting In Vivo (2018) (0)
- X-ray Scattering from Immunostimulatory Tetrapod-Shaped DNA in Aqueous Solution To Explore Its Biological Activity–Conformation Relationship B (2014) (0)
- Liver Cell-Selective Targeting Using Glycosylated Liposomes (1999) (0)
- 989. Induction of Antitumor Immunity by Cell- Penetrating Peptide-Coupled Hsp70 Gene Transfer to Tumor Cells (2006) (0)
- Optimization of in vivo Gene Transfer Through Regulating Biological Response to Vectors (2007) (0)
- Correction to "Nutrient-Based Chemical Library as a Source of Energy Metabolism Modulators". (2020) (0)
- [Development of cellular and gene therapy products for bioacitve protein-based therapy]. (2010) (0)
- In Situ Evaluation of Cellular Spheroid Stiffness by Pinching Device Composed of Piezoactuator and Strain Gauge (2023) (0)
- Characteristics of Exosomes and Development of Exosome-based Diagnosis and Therapy (2014) (0)
- This information is current as Polarization Atopic Dermatitis in NC / Nga Mice via Th 1 Ameliorates γ Therapeutic Levels of IFN-Sustained Exogenous Expression of Yoshinobu (2010) (0)
- CELL-SPECIFIC TARGETING OF DRUGS BY RECEPTOR-MEDIATED ENDOCYTOSIS BASED ON SUGAR RECOGNITION SYSTEMS (1993) (0)
- 71. Intratumoral Delivery of Small Interfering RNA for Inhibition of Tumor Progression in Mice (2005) (0)
- Development of Oligonucleotide Therapeutics: Tissue Distribution and Drug Delivery Systems (2021) (0)
- Elucidation of the Mechanism of Increased Activity of Immunostimulatory DNA by the Formation of Polypod-like Structure (2017) (0)
- Long-term drug modification to the surface of mesenchymal stem cells by the avidin-biotin complex method (2017) (0)
- Control of hepatic disposition of mannosylated liposomes by PEGylation: effect of the molecular weight of PEG and the density of PEG and mannose (2003) (0)
- mannose receptors and mannan-binding protein In vivo recognition of mannosylated proteins by hepatic (2016) (0)
- DDS TECHNOLOGY REQUIRED FOR EFFECTIVE IN VIVO GENE TRANSFER (2001) (0)
- 616. Enhancement of Antitumor Activity of Interferons by RNAi-Mediated Silencing of SOCS Genes in Tumor Cells (2006) (0)
- [FOREWORD]核酸・遺伝子医薬およびそのDDS開発研究の課題 (2019) (0)
- Development of Exosomes Eligible for DDS (2015) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Makiya Nishikawa?
Makiya Nishikawa is affiliated with the following schools:
