Mark Boguski
#92,180
Most Influential Person Now
American pathologist
Mark Boguski's AcademicInfluence.com Rankings
Mark Boguskibiology Degrees
Biology
#5476
World Rank
#7964
Historical Rank
Pathology
#170
World Rank
#297
Historical Rank
Download Badge
Biology
Mark Boguski's Degrees
- Doctorate Medicine Harvard University
- PhD Genetics Harvard University
Why Is Mark Boguski Influential?
(Suggest an Edit or Addition)According to Wikipedia, Mark S. Boguski was an American pathologist specializing in computational analysis and structural biology, He was elected in 2001 to the U.S. National Academy of Medicine, and was a Fellow of the American College of Medical Informatics .
Mark Boguski's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Genome-wide atlas of gene expression in the adult mouse brain (2007) (4708)
- Sequence diversity in CYP3A promoters and characterization of the genetic basis of polymorphic CYP3A5 expression (2001) (2153)
- The transcriptional program in the response of human fibroblasts to serum. (1999) (2092)
- Detecting subtle sequence signals: a Gibbs sampling strategy for multiple alignment. (1993) (2028)
- Proteins regulating Ras and its relatives (1993) (1922)
- Positional cloning of the gene for multiple endocrine neoplasia-type 1. (1997) (1906)
- The National Center for Biotechnology Information. (1990) (1440)
- dbEST — database for “expressed sequence tags” (1993) (1415)
- A Gene Map of the Human Genome (1996) (1080)
- Comparative genomics of the eukaryotes. (2000) (1031)
- Issues in searching molecular sequence databases (1994) (794)
- The NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins (1990) (749)
- A physical map of 30,000 human genes. (1998) (670)
- A repeating amino acid motif in CDC23 defines a family of proteins and a new relationship among genes required for mitosis and RNA synthesis (1990) (472)
- Experimental annotation of the human genome using microarray technology (2001) (465)
- Evolutionary parameters of the transcribed mammalian genome: an analysis of 2,820 orthologous rodent and human sequences. (1998) (455)
- Gene expression informatics —it's all in your mine (1999) (429)
- The A20 cDNA induced by tumor necrosis factor alpha encodes a novel type of zinc finger protein. (1990) (429)
- ESTablishing a human transcript map (1995) (404)
- cDNA cloning of the type 1 neurofibromatosis gene: complete sequence of the NF1 gene product. (1991) (388)
- A novel RING finger protein interacts with the cytoplasmic domain of CD40. (1994) (378)
- Functional genomics: it's all how you read it. (1997) (349)
- Mutations in the gene encoding KRIT1, a Krev-1/rap1a binding protein, cause cerebral cavernous malformations (CCM1). (1999) (348)
- Data management and analysis for gene expression arrays (1998) (320)
- The human pregnane X receptor: genomic structure and identification and functional characterization of natural allelic variants. (2001) (299)
- Threading analysis suggests that the obese gene product may be a helical cytokine (1995) (282)
- Frequent human genomic DNA transduction driven by LINE-1 retrotransposition. (2000) (270)
- Positionally cloned human disease genes: patterns of evolutionary conservation and functional motifs. (1997) (235)
- Comparative analysis of 1196 orthologous mouse and human full-length mRNA and protein sequences. (1996) (235)
- A Survey of Human Disease Gene Counterparts in the Drosophila Genome (2000) (223)
- Molecular archeology of L1 insertions in the human genome (2002) (208)
- Evolutionary conservation and somatic mutation hotspot maps of p53: correlation with p53 protein structural and functional features (1999) (197)
- GenBank (2018) (193)
- Biomedical informatics for proteomics (2003) (192)
- Repurposing with a Difference (2009) (190)
- Expression of rat apolipoprotein A-IV and A-I genes: mRNA induction during development and in response to glucocorticoids and insulin. (1985) (189)
- Genes, Themes, and Microarrays: Using Information Retrieval for Large-Scale Gene Analysis (2000) (189)
- Gene discovery in dbEST. (1994) (164)
- The turning point in genome research. (1995) (149)
- Influence of guanine nucleotides on complex formation between Ras and CDC25 proteins (1993) (148)
- Yeast genes and human disease (1996) (145)
- Neurofibromatosis type 1 gene product (neurofibromin) associates with microtubules (1993) (137)
- The nucleotide and derived amino acid sequence of human apolipoprotein A-IV mRNA and the close linkage of its gene to the genes of apolipoproteins A-I and C-III. (1986) (131)
- A transcript map for the 2.8-Mb region containing the multiple endocrine neoplasia type 1 locus. (1997) (126)
- GenBank (2007) (117)
- Structure and evolution of a human erythroid transcription factor (1990) (114)
- Structure and expression of the human apolipoprotein A-IV gene. (1987) (110)
- Is apolipoprotein D a mammalian bilin-binding protein? (1992) (107)
- Primary structure and comparative sequence analysis of an insect apolipoprotein. Apolipophorin-III from Manduca sexta. (1987) (94)
- Genome cross-referencing and XREFdb: Implications for the identification and analysis of genes mutated in human disease (1997) (90)
- A YAC-based physical map of the mouse genome (1999) (88)
- Comparative genomics: The mouse that roared (2002) (88)
- Genes conserved in yeast and humans. (1994) (79)
- Comparative genomics, genome cross-referencing and XREFdb. (1995) (79)
- Subcellular Biochemistry (1979) (78)
- Comparative analysis of the β transducin family with identification of several new members including PWP1, a nonessential gene of Saccharomyces cerevisiae that is divergently transcribed from NMT1 (1992) (77)
- Comparative analysis of repeated sequences in rat apolipoproteins A-I, A-IV, and E. (1985) (75)
- On computer-assisted analysis of biological sequences: proline punctuation, consensus sequences, and apolipoprotein repeats. (1986) (71)
- Rat apolipoprotein A-IV contains 13 tandem repetitions of a 22-amino acid segment with amphipathic helical potential. (1984) (69)
- TPR proteins as essential components of the yeast cell cycle. (1991) (67)
- Human liver fatty acid binding protein. Isolation of a full length cDNA and comparative sequence analyses of orthologous and paralogous proteins. (1985) (65)
- A call to action: training pathology residents in genomics and personalized medicine. (2010) (65)
- Primary structure of apolipophorin-III from the migratory locust, Locusta migratoria. Potential amphipathic structures and molecular evolution of an insect apolipoprotein. (1988) (65)
- A Whole-Genome Assembly of Drosophila (2000) (63)
- A national agenda for the future of pathology in personalized medicine: report of the proceedings of a meeting at the Banbury Conference Center on genome-era pathology, precision diagnostics, and preemptive care: a stakeholder summit. (2011) (61)
- Eighteen new polymorphic markers in the multiple endocrine neoplasia type 1 (MEN1) region (1997) (60)
- Analysis of the neurofibromatosis type 1 (NF1) GAP-related domain by site-directed mutagenesis. (1993) (58)
- Neurogenomics: at the intersection of neurobiology and genome sciences (2004) (58)
- The first lipocalin with enzymatic activity. (1991) (56)
- Evolution of the apolipoproteins. Structure of the rat apo-A-IV gene and its relationship to the human genes for apo-A-I, C-III, and E. (1986) (55)
- Database divisions and homology search files: a guide for the perplexed. (1997) (55)
- MRS6 — yeast homologue of the choroideraemia gene (1993) (54)
- Linking yeast genetics to mammalian genomes: identification and mapping of the human homolog of CDC27 via the expressed sequence tag (EST) data base. (1993) (52)
- sar1, a gene from Schizosaccharomyces pombe encoding a protein that regulates ras1. (1991) (52)
- Human and nematode orthologs--lessons from the analysis of 1800 human genes and the proteome of Caenorhabditis elegans. (1999) (52)
- Genome informatics: current status and future prospects. (2003) (48)
- Genome maps 7. The human transcript map. Wall chart. (1996) (45)
- Synonymous and Nonsynonymous Substitution Distances Are Correlated in Mouse and Rat Genes (1998) (45)
- A 2.8-Mb clone contig of the multiple endocrine neoplasia type 1 (MEN1) region at 11q13. (1997) (44)
- Identification of a cytidine-specific ribonuclease from chicken liver. (1980) (44)
- Development of a screening set for new (CAG/CTG)n dynamic mutations. (1996) (42)
- Biosequence exegesis. (1999) (40)
- Bioinformatics–a new era (1998) (37)
- Analysis of conserved domains and sequence motifs in cellular regulatory proteins and locus control regions using new software tools for multiple alignment and visualization. (1992) (35)
- Novel repetitive sequence motifs in the alpha and beta subunits of prenyl-protein transferases and homology of the alpha subunit to the MAD2 gene product of yeast. (1992) (35)
- Similarity and Homology (1991) (34)
- Expanding family (1990) (32)
- Possible sites of origin of human plasma ribonucleases as evidenced by isolation and partial characterization of ribonucleases from several human tissues. (1978) (32)
- Information Retrieval Meets Gene Analysis (2002) (31)
- Proto-vav and gene expression (1992) (31)
- PharmGKB Update: II. CYP3A5, Cytochrome P450, Family 3, Subfamily A, Polypeptide 5 (2004) (31)
- Customized care 2020: how medical sequencing and network biology will enable personalized medicine (2009) (30)
- Biosequence exegesis : Genome (1999) (30)
- Late-night thoughts on the sequence annotation problem. (1998) (26)
- GenBank (2006) (23)
- Computational sequence analysis revisited: new databases, software tools, and the research opportunities they engender. (1992) (21)
- The Evolution of Oncology Companion Diagnostics from Signal Transduction to Immuno-Oncology. (2017) (19)
- Structures, properties, and possible biologic functions of polyadenylic acid. (1979) (16)
- Hunting for genes in computer data bases. (1995) (15)
- Classical oncogenes and tumor suppressor genes: a comparative genomics perspective. (2000) (14)
- XREFdb: cross-referencing the genetics and genes of mammals and model organisms (2000) (14)
- The end of the beginning: the race to begin human genome sequencing. (1996) (12)
- Constructing Aligned Sequence Blocks (1994) (12)
- Personal genotypes are teachable moments (2013) (12)
- ENCODE and ChIP-chip in the genome era. (2004) (10)
- I think therefore I publish. (1994) (10)
- An effective approach for analyzing "prefinished" genomic sequence data. (1999) (9)
- Expanding family [12] (1990) (8)
- Rat apolipoprotein A-IV: application of computational methods for studying the structure, function, and evolution of a protein. (1986) (8)
- A Gibbs sampler for the detection of subtle motifs in multiple sequences (1994) (6)
- Primary Structure and Comparative Sequence Analysis of an Insect Apolipoprotein (1987) (6)
- CHAPTER 21 – Online Health Information Retrieval by Consumers and the Challenge of Personal Genomics (2008) (5)
- The only thing permanent is change (2003) (4)
- Sari , a gene from Schizosaccharomyces pombe encoding a protein that regulates rasl (2003) (4)
- Sequence Databases: Integrated Information Retrieval and Data Submission (2000) (3)
- Identifying human homologs of cell cycle genes using dbEST and XREFdb. (1997) (3)
- Pathologists and the third wave of medical genomics. (2012) (2)
- Online Health Information Retrieval by Consumers (2010) (2)
- Rat apolipoprotein AIV contains 13 tandem repetitions of a 22-amino acid segment with amphipathic helical potential ( full-length cDNA cloning / lipid-binding domains / lecithin : cholesterol acyltransferase activation / gene structure and evolution ) (1999) (2)
- Influence ofGuanine Nucleotides on ComplexFormation between RasandCDC25Proteins (1993) (1)
- Interpretation bottlenecks and annotation inversion in functional genomics (1999) (1)
- Trust it or trash it? a tool for evaluating the quality of genetic information. (2010) (1)
- BIOINFORMATICS BIOINFORMATICS : A NEW ERA (1998) (1)
- Personal genotypes are teachable moments (2013) (1)
- A note about computing all local alignments (1994) (1)
- STRUCTURE OF THE RAT APO-A-IV GENE AND ITS RELATIONSHIP TO THE HUMAN GENES FOR APO-A-I, C-111, AND E* (1986) (0)
- Repurposing for Neglected Diseases--Response (2009) (0)
- GATGAGC C CCAGTC CCAA TGGGA CAGGGTGAAGGA TTTCGCCA CTGTGTATGTGGA TGCAGTCAAGGACAGCGGCAGAGA CTATGTGTC CCAGTTTGA ATC CTCCA CTTTGGGCA AspG luProG lnSerG lnTrpAspArgVa lLysAspPheA laThrVa lTyrVa lAspA laVa lLysAspSerG lyA rgAspTyrVa lSerG lnPheG luSerSerThrLeuG lyL Amature amino (2003) (0)
- Sequence Databases: Integrated Information Retrieval and Data Submission (2000) (0)
- Are clinical genomes already becoming semi-routine for patient care? (2011) (0)
- Analysis of to Informatics: Current Status and Future Prospects of Genome Informatics Current Status and Future Prospects (2003) (0)
- CX3C CHEMOKNESUSING CX3C CHEMOKNEANTIBODES (2017) (0)
- Cross-referencing yeast genetics and mammalian genomes (1994) (0)
- Overcoming impediments to effective health and biomedical digital libraries (2002) (0)
- Current Status and Future Prospects (2003) (0)
- Adventures in Information Space: Biomedical Discoveries in a Molecular Sequence Milieu (1995) (0)
- n structure/gene family structure and evolution) (2017) (0)
- Abstracts of papers presented at the 1999 Meeting on Genome Sequencing & Biology, May 19-May 23, 1999 (1999) (0)
- "The third wave of medical genomics … may finally help us realize the benefits that genome science and technology have long promised." (2012) (0)
- formation between Ras and CDC25 proteins. Influence of guanine nucleotides on complex (2014) (0)
- Are clinical genomes already becoming semi-routine for patient care? (2011) (0)
- SHIELDING FOR CAPACTIVE CURRENT (2017) (0)
- 0 n co m p u te r-assisted analysis sequences : proline punctuation , consensus of biological sequences , and apolipoprotein repeats (2002) (0)
- Diagnosis by Genome Sequencing (2011) (0)
- The Goody-Gaga Effect: Health Communication at the Nexus of Social Media & Popular Culture (2011) (0)
- Abstracts of papers presented at the 1998 Meeting on Genome Mapping, Sequencing & Biology, May 13-May 17, 1998 (1998) (0)
This paper list is powered by the following services:
Other Resources About Mark Boguski
What Schools Are Affiliated With Mark Boguski?
Mark Boguski is affiliated with the following schools:
