Norio Hayashi
#159,149
Most Influential Person Now
Norio Hayashi's AcademicInfluence.com Rankings
Norio Hayashimedical Degrees
Medical
#3170
World Rank
#3625
Historical Rank
Oncology
#220
World Rank
#228
Historical Rank

Norio Hayashiphilosophy Degrees
Philosophy
#9116
World Rank
#12625
Historical Rank
Logic
#6109
World Rank
#7592
Historical Rank

Download Badge
Medical Philosophy
Norio Hayashi's Degrees
- PhD Medical Science University of Tokyo
- Doctorate Medicine University of Tokyo
Why Is Norio Hayashi Influential?
(Suggest an Edit or Addition)Norio Hayashi's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Phase III study of sorafenib after transarterial chemoembolisation in Japanese and Korean patients with unresectable hepatocellular carcinoma. (2011) (485)
- Risk factors for hepatocellular carcinoma and its incidence after interferon treatment in patients with chronic hepatitis C (1998) (476)
- Quantitative analysis of hepatitis C virus RNA in serum during interferon alfa therapy. (1993) (389)
- Impaired allostimulatory capacity of peripheral blood dendritic cells recovered from hepatitis C virus-infected individuals. (1999) (383)
- Immunohistochemical detection of Fas antigen in liver tissue of patients with chronic hepatitis C (1993) (367)
- The let-7 family of microRNAs inhibits Bcl-xL expression and potentiates sorafenib-induced apoptosis in human hepatocellular carcinoma. (2010) (324)
- Activation of mitogen‐activated protein kinases/extracellular signal‐regulated kinases in human hepatocellular carcinoma (1998) (293)
- Telaprevir with peginterferon and ribavirin for treatment-naive patients chronically infected with HCV of genotype 1 in Japan. (2012) (259)
- Expression and role of MICA and MICB in human hepatocellular carcinomas and their regulation by retinoic acid (2003) (258)
- Critical Role of MHC Class I-Related Chain A and B Expression on IFN-α-Stimulated Dendritic Cells in NK Cell Activation: Impairment in Chronic Hepatitis C Virus Infection 1 (2003) (255)
- Gd-EOB-DTPA-enhanced magnetic resonance images of hepatocellular carcinoma: correlation with histological grading and portal blood flow (2010) (238)
- Reduced numbers and impaired ability of myeloid and plasmacytoid dendritic cells to polarize T helper cells in chronic hepatitis C virus infection. (2004) (231)
- Inhibition of autophagy potentiates the antitumor effect of the multikinase inhibitor sorafenib in hepatocellular carcinoma (2012) (228)
- Negative Regulation of NK Cell Activities by Inhibitory Receptor CD94/NKG2A Leads to Altered NK Cell-Induced Modulation of Dendritic Cell Functions in Chronic Hepatitis C Virus Infection1 (2004) (228)
- Expression of vascular permeability factor/vascular endothelial growth factor in human hepatocellular carcinoma. (1996) (227)
- Impairment of natural killer cell and dendritic cell functions by the soluble form of MHC class I-related chain A in advanced human hepatocellular carcinomas. (2005) (218)
- Hepatocyte-specific disruption of Bcl-xL leads to continuous hepatocyte apoptosis and liver fibrotic responses. (2004) (207)
- Detection of hepatitis C virus RNA in serum of patients with chronic hepatitis C treated with interferon‐α (1992) (197)
- Efficacy of lamivudine for preventing hepatocellular carcinoma in chronic hepatitis B: A multicenter retrospective study of 2795 patients. (2005) (193)
- Autocrine/Paracrine IL-15 That Is Required for Type I IFN-Mediated Dendritic Cell Expression of MHC Class I-Related Chain A and B Is Impaired in Hepatitis C Virus Infection 1 (2003) (185)
- Role of Fas ligand in apoptosis induced by hepatitis C virus infection. (1994) (180)
- Hepatitis C Virus Nonstructural Protein 5A Modulates the Toll-Like Receptor-MyD88-Dependent Signaling Pathway in Macrophage Cell Lines (2007) (179)
- Hypoadiponectinemia accelerates hepatic tumor formation in a nonalcoholic steatohepatitis mouse model. (2007) (174)
- Ability of prolonged interferon treatment to suppress relapse after cessation of therapy in patients with chronic hepatitis C: A multicenter randomized controlled trial (1995) (170)
- Influence of HLA haplotypes on the clinical courses of individuals infected with hepatitis C virus (1998) (166)
- Involvement of the p38 mitogen‐activated protein kinase cascade in hepatocellular carcinoma (2003) (160)
- Oral Glucose Tolerance Test Predicts Prognosis of Patients with Liver Cirrhosis (2006) (159)
- Serum hepatitis C virus RNA quantity and histological features of hepatitis C virus carriers with persistently normal ALT levels (1994) (155)
- Increases in p53 expression induce CTGF synthesis by mouse and human hepatocytes and result in liver fibrosis in mice. (2011) (149)
- Adipocytokines and liver disease (2008) (147)
- Antiviral therapy for chronic hepatitis C: past, present, and future (2005) (145)
- Simeprevir with peginterferon/ribavirin for treatment-naïve hepatitis C genotype 1 patients in Japan: CONCERTO-1, a phase III trial. (2014) (145)
- Characteristics of patients with chronic hepatitis C who develop hepatocellular carcinoma after a sustained response to interferon therapy (2004) (140)
- Fas antigen expression in liver tissues of patients with chronic hepatitis B. (1996) (139)
- Report of the 18th follow‐up survey of primary liver cancer in Japan (2010) (136)
- Clinical characteristics, treatment, and prognosis of non-B, non-C hepatocellular carcinoma: a large retrospective multicenter cohort study (2014) (134)
- The Bcl‐xL inhibitor, ABT‐737, efficiently induces apoptosis and suppresses growth of hepatoma cells in combination with sorafenib (2010) (133)
- Influence of viral quasispecies on effectiveness of interferon therapy in chronic hepatitis C patients (1994) (132)
- Topical Implantation of Mesenchymal Stem Cells Has Beneficial Effects on Healing of Experimental Colitis in Rats (2008) (127)
- Sorafenib inhibits the shedding of major histocompatibility complex class I–related chain A on hepatocellular carcinoma cells by down‐regulating a disintegrin and metalloproteinase 9 (2010) (126)
- Declining Incidence of Hepatocellular Carcinoma in Osaka, Japan, from 1990 to 2003 (2008) (126)
- Expression of the c‐met protooncogene in human hepatocellular carcinoma (1994) (125)
- SHORT‐TERM OUTCOMES OF ENDOSCOPIC SUBMUCOSAL DISSECTION (ESD) FOR EARLY GASTRIC NEOPLASM: MULTICENTER SURVEY BY OSAKA UNIVERSITY ESD STUDY GROUP (2011) (122)
- Estrogen deficiency worsens steatohepatitis in mice fed high-fat and high-cholesterol diet. (2011) (118)
- TIE2‐expressing monocytes as a diagnostic marker for hepatocellular carcinoma correlates with angiogenesis (2013) (118)
- Relationship between elevated FX expression and increased production of GDP-L-fucose, a common donor substrate for fucosylation in human hepatocellular carcinoma and hepatoma cell lines. (2003) (117)
- Efficacy and safety of telaprevir, a new protease inhibitor, for difficult-to-treat patients with genotype 1 chronic hepatitis C (2012) (115)
- Gene expression of α1‐6 fucosyltransferase in human hepatoma tissues: A possible implication for increased fucosylation of α‐fetoprotein (1998) (114)
- CagA mediates epigenetic regulation to attenuate let-7 expression in Helicobacter pylori-related carcinogenesis (2012) (114)
- Effect of interferon therapy on the incidence of hepatocellular carcinoma and mortality of patients with chronic hepatitis C: A retrospective cohort study of 738 patients (2000) (113)
- Long-term use of entecavir in nucleoside-naïve Japanese patients with chronic hepatitis B infection. (2010) (112)
- Improvement of liver fibrosis in chronic hepatitis C patients treated with natural interferon alpha. (1995) (112)
- Cyclooxygenase-2 activity altered the cell-surface carbohydrate antigens on colon cancer cells and enhanced liver metastasis. (2002) (109)
- Hepatoma-Derived Growth Factor Is a Novel Prognostic Factor for Patients with Pancreatic Cancer (2006) (104)
- Once-daily simeprevir with peginterferon and ribavirin for treatment-experienced HCV genotype 1-infected patients in Japan: the CONCERTO-2 and CONCERTO-3 studies (2014) (103)
- Thrombocytopenia exacerbates cholestasis-induced liver fibrosis in mice. (2010) (100)
- Fas system and apoptosis in viral hepatitis (1997) (100)
- Alterations in microRNA expression profile in HCV-infected hepatoma cells: involvement of miR-491 in regulation of HCV replication via the PI3 kinase/Akt pathway. (2011) (97)
- N-acetylglucosaminyltransferase III and V messenger RNA levels in LEC rats during hepatocarcinogenesis. (1993) (97)
- Endoscopic submucosal dissection as a treatment for gastric noninvasive neoplasia: a multicenter study by Osaka University ESD Study Group (2011) (96)
- Expression of costimulatory molecules B7‐1 (CD80) and B7‐2 (CD86) on human hepatocellular carcinoma (1997) (96)
- Immunopathogenesis of hepatitis C virus infection: multifaceted strategies subverting innate and adaptive immunity. (2006) (95)
- Hammerhead ribozyme-mediated inhibition of telomerase activity in extracts of human hepatocellular carcinoma cells. (1996) (94)
- Human blood dendritic cell antigen 3 (BDCA3)+ dendritic cells are a potent producer of interferon‐λ in response to hepatitis C virus (2013) (93)
- Hepatitis C virus genotype and RNA titer in the progression of type C chronic liver disease. (1994) (93)
- Post-treatment levels of α-fetoprotein predict incidence of hepatocellular carcinoma after interferon therapy. (2014) (90)
- Expression of CD133 confers malignant potential by regulating metalloproteinases in human hepatocellular carcinoma. (2010) (86)
- Once-daily simeprevir (TMC435) with peginterferon/ribavirin for treatment-naïve hepatitis C genotype 1-infected patients in Japan: the DRAGON study (2013) (85)
- Involvement of Fas system‐mediated apoptosis in pathogenesis of viral hepatitis (1999) (85)
- JSH Guidelines for the Management of Hepatitis C Virus Infection: A 2016 update for genotype 1 and 2 (2016) (85)
- Progression of type C chronic hepatitis to liver cirrhosis and hepatocellular carcinoma--its relationship to alcohol drinking and the age of transfusion. (1996) (85)
- The tetraspanin CD9 modulates epidermal growth factor receptor signaling in cancer cells (2008) (84)
- Adiponectin prevents progression of steatohepatitis in mice by regulating oxidative stress and Kupffer cell phenotype polarization (2009) (84)
- Replication-Competent Recombinant Vesicular Stomatitis Virus Encoding Hepatitis C Virus Envelope Proteins (2007) (83)
- Novel Image Analysis Method Using Ultrasound Elastography for Noninvasive Evaluation of Hepatic Fibrosis in Patients with Chronic Hepatitis C (2013) (83)
- Hepatitis C virus antibody and hepatitis C virus replication in chronic hepatitis B patients. (1994) (82)
- Administration of interleukin-12 enhances the therapeutic efficacy of dendritic cell-based tumor vaccines in mouse hepatocellular carcinoma. (2001) (82)
- Inhibition of angiotensin II activity enhanced the antitumor effect of cyclooxygenase-2 inhibitors via insulin-like growth factor I receptor pathway. (2003) (80)
- Anticancer chemotherapy inhibits MHC class I-related chain a ectodomain shedding by downregulating ADAM10 expression in hepatocellular carcinoma. (2009) (79)
- Natural killer cell and hepatic cell interaction via NKG2A leads to dendritic cell‐mediated induction of CD4+ CD25+ T cells with PD‐1‐dependent regulatory activities (2007) (79)
- BH3-only Activator Proteins Bid and Bim Are Dispensable for Bak/Bax-dependent Thrombocyte Apoptosis Induced by Bcl-xL Deficiency (2011) (78)
- Severe hepatitis caused by Epstein-Barr virus without infection of hepatocytes. (2001) (75)
- Density analysis of hepatitis C virus particle population in the circulation of infected hosts: implications for virus neutralization or persistence. (1995) (74)
- Interferon treatment improves survival in chronic hepatitis C patients showing biochemical as well as virological responses by preventing liver‐related death (2004) (73)
- Overexpression of alpha1-6 fucosyltransferase in hepatoma cells suppresses intrahepatic metastasis after splenic injection in athymic mice. (1999) (72)
- Peretinoin after curative therapy of hepatitis C-related hepatocellular carcinoma: a randomized double-blind placebo-controlled study (2014) (72)
- A high expression of GDP-fucose transporter in hepatocellular carcinoma is a key factor for increases in fucosylation. (2007) (72)
- Ribavirin dose reduction raises relapse rate dose‐dependently in genotype 1 patients with hepatitis C responding to pegylated interferon alpha‐2b plus ribavirin (2009) (72)
- Effect of acute and chronic ethanol consumption on hepatic tissue oxygen tension in rats (1983) (72)
- Detection of hepatitis C virus RNA in chronic non-A, non-B liver disease. (1992) (70)
- Detection of hepatitis C virus RNA in liver tissues by an in situ hybridization technique. (1993) (68)
- Glycomic analysis of alpha-fetoprotein L3 in hepatoma cell lines and hepatocellular carcinoma patients. (2008) (67)
- Suppressor of cytokine signaling-1 ameliorates dextran sulfate sodium-induced colitis in mice. (2008) (67)
- Signal transducer and activator of transcription 3 signaling within hepatocytes attenuates systemic inflammatory response and lethality in septic mice (2007) (66)
- CD1d‐mediated stimulation of natural killer T cells selectively activates hepatic natural killer cells to eliminate experimentally disseminated hepatoma cells in murine liver (2003) (65)
- Disturbed gastrointestinal motility and decreased interstitial cells of Cajal in diabetic db/db mice (2008) (65)
- Concanavalin a injection activates intrahepatic innate immune cells to provoke an antitumor effect in murine liver (2004) (64)
- Expression of Rab5a in hepatocellular carcinoma: Possible involvement in epidermal growth factor signaling (2007) (63)
- A large-scale, multicentre, double-blind trial of ursodeoxycholic acid in patients with chronic hepatitis C (2007) (63)
- High expression of α‐1‐6 fucosyltransferase during rat hepatocarcinogenesis (1998) (62)
- Serum levels of soluble major histocompatibility complex (MHC) class I‐related chain A in patients with chronic liver diseases and changes during transcatheter arterial embolization for hepatocellular carcinoma (2008) (62)
- Mcl-1 and Bcl-xL regulate Bak/Bax-dependent apoptosis of the megakaryocytic lineage at multistages (2012) (61)
- Long-term effect of lamivudine treatment on the incidence of hepatocellular carcinoma in patients with hepatitis B virus infection (2012) (61)
- Clinical evaluation of plasma des-γ-carboxy prothrombin as a marker protein of hepatocellular carcinoma in patients with tumors of various sizes (1993) (61)
- Long‐term follow‐up of hepatitis B virus and hepatitis C virus replicative levels in chronic hepatitis patients coinfected with both viruses (1995) (61)
- Peginterferon α‐2a (40 KD) plus ribavirin for the treatment of chronic hepatitis C in Japanese patients (2007) (60)
- Adiponectin deficiency exacerbates lipopolysaccharide/D-galactosamine-induced liver injury in mice. (2006) (60)
- IgG Oligosaccharide Alterations Are a Novel Diagnostic Marker for Disease Activity and the Clinical Course of Inflammatory Bowel Disease (2008) (60)
- Altered interferon-alpha-signaling in natural killer cells from patients with chronic hepatitis C virus infection. (2010) (59)
- LINE-1 Hypomethylation Is Associated with Increased CpG Island Methylation in Helicobacter pylori–Related Enlarged-Fold Gastritis (2008) (59)
- Expression of α1‐6 fucosyltransferase in rat tissues and human cancer cell lines (1997) (59)
- Hepatitis C Virus Core Protein Differently Regulates the JAK-STAT Signaling Pathway under Interleukin-6 and Interferon-γ Stimuli* (2003) (59)
- Bak deficiency inhibits liver carcinogenesis: a causal link between apoptosis and carcinogenesis. (2012) (58)
- Delayed fas‐mediated hepatocyte apoptosis during liver regeneration in mice: hepatoprotective role of TNFα (1998) (57)
- Impaired Function of Dendritic Cells Circulating in Patients Infected with Hepatitis C Virus Who Have Persistently Normal Alanine Aminotransferase Levels (2005) (57)
- Simeprevir (TMC435) once daily with peginterferon‐α‐2b and ribavirin in patients with genotype 1 hepatitis C virus infection: The CONCERTO‐4 study (2015) (56)
- High levels of serum interleukin-10 are associated with a poor response to interferon treatment in patients with chronic hepatitis C. (1997) (56)
- Mcl‐1 and Bcl‐xL cooperatively maintain integrity of hepatocytes in developing and adult murine liver (2009) (56)
- Association of vitamin K deficiency with bone metabolism and clinical disease activity in inflammatory bowel disease. (2011) (55)
- Serum levels of soluble Fas antigen in chronic hepatitis C patients (1998) (55)
- Adiponectin plays a protective role in caerulein-induced acute pancreatitis in mice fed a high-fat diet (2008) (54)
- Jejunal varices as a cause of massive gastrointestinal bleeding. (1992) (54)
- Pretreatment viral load and response to prolonged interferon-α course for chronic hepatitis C (1995) (53)
- Immunotherapy of murine colon cancer using receptor tyrosine kinase EphA2‐derived peptide‐pulsed dendritic cell vaccines (2007) (53)
- N-acetylglucosaminyltransferase III in human serum, and liver and hepatoma tissues: increased activity in liver cirrhosis and hepatoma patients. (1989) (52)
- Relation of disease activity during chronic hepatitis C infection to complexity of hypervariable region 1 quasispecies (1997) (52)
- Extrahepatic portal vein aneurysm associated with a tortuous portal vein. (1991) (52)
- A single nucleotide polymorphism of the low molecular mass polypeptide 7 gene influences the interferon response in patients with chronic hepatitis C (2002) (52)
- High expression of an N-acetylglucosaminyltransferase III in 3'-methyl DAB-induced hepatoma and ascites hepatoma. (1988) (51)
- Identification of Multiple Transcription Factors, HLF, FTF, and E4BP4, Controlling Hepatitis B Virus Enhancer II (2000) (51)
- Effectiveness of real‐time virtual sonography‐guided radiofrequency ablation treatment for patients with hepatocellular carcinomas (2008) (51)
- EphA2-derived peptide vaccine with amphiphilic poly(γ-glutamic acid) nanoparticles elicits an anti-tumor effect against mouse liver tumor (2010) (51)
- Deficiency of GMDS leads to escape from NK cell-mediated tumor surveillance through modulation of TRAIL signaling. (2009) (50)
- Interferon therapy for aged patients with chronic hepatitis C: improved survival in patients exhibiting a biochemical response (2004) (49)
- Injection of IL-12 gene-transduced dendritic cells into mouse liver tumor lesions activates both innate and acquired immunity (2007) (48)
- Topical transplantation of mesenchymal stem cells accelerates gastric ulcer healing in rats. (2008) (47)
- Innate immunity in hepatitis C virus infection: Interplay among dendritic cells, natural killer cells and natural killer T cells (2007) (46)
- A novel therapeutic strategy with anti-CD9 antibody in gastric cancers (2009) (46)
- Indications and limitations for aged patients with chronic hepatitis C in pegylated interferon alfa-2b plus ribavirin combination therapy. (2011) (45)
- Impaired expression of proteasome subunits and human leukocyte antigens class I in human colon cancer cells (2003) (44)
- Hepatic hemodynamics in patients with chronic hepatitis or cirrhosis as assessed by organ-reflectance spectrophotometry (1983) (44)
- Oxygen supply to the liver in patients with alcoholic liver disease assessed by organ-reflectance spectrophotometry. (1985) (43)
- Prevalence of hepatitis C virus in family members of patients with Hepatitis C (1993) (43)
- α‐Fetoprotein impairs activation of natural killer cells by inhibiting the function of dendritic cells (2011) (43)
- Adiponectin deficiency enhances colorectal carcinogenesis and liver tumor formation induced by azoxymethane in mice. (2008) (42)
- Gene expression of alpha1-6 fucosyltransferase in human hepatoma tissues: a possible implication for increased fucosylation of alpha-fetoprotein. (1998) (42)
- Management of hepatitis C; Report of the Consensus Meeting at the 45th Annual Meeting of the Japan Society of Hepatology (2009) (2010) (42)
- Virological Response in Patients with Hepatitis C Virus Genotype 1b and a High Viral Load (2008) (42)
- STAT3 signaling within hepatocytes is required for anemia of inflammation in vivo (2010) (41)
- Should aged patients with chronic hepatitis C be treated with interferon and ribavirin combination therapy? (2006) (40)
- Caldesmon suppresses cancer cell invasion by regulating podosome/invadopodium formation. (2008) (40)
- HCV viraemia and liver injury in symptom-free blood donors (1993) (40)
- Involvement of transporter associated with antigen processing 2 (TAP2) gene polymorphisms in hepatitis C virus infection. (1999) (39)
- Transplantation of basic fibroblast growth factor-pretreated adipose tissue-derived stromal cells enhances regression of liver fibrosis in mice. (2009) (38)
- Comprehensive immunological analyses of colorectal cancer patients in the phase I/II study of quickly matured dendritic cell vaccine pulsed with carcinoembryonic antigen peptide (2011) (37)
- Intracellular single‐chain antibody against hepatitis B virus core protein inhibits the replication of hepatitis B virus in cultured cells (1999) (37)
- A Randomized Trial of Daclatasvir with Peginterferon Alfa-2B and Ribavirin for HCV Genotype 1 Infection (2014) (37)
- Survey of survival among patients with hepatitis C virus-related hepatocellular carcinoma treated with peretinoin, an acyclic retinoid, after the completion of a randomized, placebo-controlled trial (2014) (37)
- Helicobacter pylori eradication to prevent gastric cancer: underlying molecular and cellular mechanisms. (2006) (37)
- Delayed liver regeneration after partial hepatectomy in adiponectin knockout mice. (2009) (37)
- Association of enhanced activity of indoleamine 2,3-dioxygenase in dendritic cells with the induction of regulatory T cells in chronic hepatitis C infection (2013) (36)
- Expression and prognostic role of RhoA GTPases in hepatocellular carcinoma (2006) (36)
- Reduced risk of hepatocellular carcinoma after interferon therapy in aged patients with chronic hepatitis C is limited to sustained virological responders (2010) (36)
- Hepatitis C Virus Core Functions as a Suppressor of Cyclin-dependent Kinase-activating Kinase and Impairs Cell Cycle Progression* (2004) (36)
- E‐cadherin Gene Promoter Hypermethylation in H. pylori‐Induced Enlarged Fold Gastritis (2007) (36)
- Involvement of p38 signaling pathway in interferon-alpha-mediated antiviral activity toward hepatitis C virus. (2004) (35)
- Natural killer cells in hepatitis C virus infection: from innate immunity to adaptive immunity. (2005) (35)
- Comparison between cytomegalovirus promoter and elongation factor-1 alpha promoter-driven constructs in the establishment of cell lines expressing hepatitis C virus core protein. (1997) (35)
- B7/BB‐1 expression and hepatitis activity in liver tissues of patients with chronic hepatitis C (1997) (35)
- Association of low serum adiponectin levels with erosive esophagitis in men: an analysis of 2405 subjects undergoing physical check-ups (2011) (35)
- Detection of hepatitis B virus X gene protein and antibody in type B chronic liver disease. (1989) (35)
- Reduced expression and functional impairment of Toll-like receptor 2 on dendritic cells in chronic hepatitis C virus infection. (2006) (35)
- Hepatitis C virus core protein differently regulates the JAK-STAT signaling pathway under interleukin-6 and interferon-gamma stimuli. (2003) (35)
- Effect of interferon α‐2b plus ribavirin therapy on incidence of hepatocellular carcinoma in patients with chronic hepatitis (2009) (34)
- Intrahepatic delivery of α‐galactosylceramide‐pulsed dendritic cells suppresses liver tumor (2007) (34)
- Synergistic antitumor effects of celecoxib with 5‐fluorouracil depend on IFN‐γ (2007) (34)
- Enhanced ability of regulatory T cells in chronic hepatitis C patients with persistently normal alanine aminotransferase levels than those with active hepatitis (2009) (33)
- Predicting interferon therapy efficacy from hepatitis C virus genotype and RNA titer (1994) (33)
- Factors affecting efficacy in patients with genotype 2 chronic hepatitis C treated by pegylated interferon alpha‐2b and ribavirin: reducing drug doses has no impact on rapid and sustained virological responses (2010) (32)
- Pamidronate induced anti-proliferative, apoptotic, and anti-migratory effects in hepatocellular carcinoma. (2006) (32)
- Absence of invariant natural killer T cells deteriorates liver inflammation and fibrosis in mice fed high-fat diet (2010) (32)
- Successful treatment of a hepatic cyst by one-shot instillation of minocycline chloride. (1992) (31)
- Changes in serum human hepatocyte growth factor levels after transcatheter arterial embolization and partial hepatectomy. (1992) (31)
- Expression of X protein and hepatitis B virus replication in chronic hepatitis (1991) (30)
- Pegylated interferon alpha‐2b (Peg‐IFN α‐2b) affects early virologic response dose‐dependently in patients with chronic hepatitis C genotype 1 during treatment with Peg‐IFN α‐2b plus ribavirin (2009) (30)
- Pseudotype hepatitis C virus enters immature myeloid dendritic cells through the interaction with lectin. (2004) (30)
- Clinical implications of coinfection with a novel DNA virus (TTV) in hepatitis C virus carriers on maintenance hemodialysis (1999) (30)
- Tumor necrosis factor α stimulates invasion of Src-activated intestinal cells (2002) (29)
- High prevalence of the hepatitis C virus infection among the inpatients of schizophrenia and psychoactive substance abuse in Japan (2004) (29)
- Comparison of enhancement patterns of histologically confirmed hepatocellular carcinoma between gadoxetate‐ and ferucarbotran‐enhanced magnetic resonance imaging (2010) (29)
- Reappraisal of biochemical hepatitis C activity in hemodialysis patients. (2000) (29)
- Vogt-Koyanagi-Harada disease occurring during interferon alpha therapy for chronic hepatitis C (2004) (29)
- Local Resection by Combined Laparoendoscopic Surgery for Duodenal Gastrointestinal Stromal Tumor (2011) (28)
- A clinical study of acute gastrointestinal hemorrhage associated with various shock states. (1991) (28)
- Impaired cytokine response in myeloid dendritic cells in chronic hepatitis C virus infection regardless of enhanced expression of Toll‐like receptors and retinoic acid inducible gene‐I (2008) (28)
- Use of a metallic‐wall stent in the magnet compression anastomosis technique for bile duct obstruction after liver transplantation (2008) (28)
- Probability of hepatocellular carcinoma of small hepatocellular nodules undetectable by computed tomography during arterial portography (2000) (28)
- Detection of hepatitis C virus in the bile and bile duct epithelial cells of hepatitis C virus–Infected patients (2001) (28)
- Dependence of ultrasonic attenuation of liver on pathologic fat and fibrosis: examination with experimental fatty liver and liver fibrosis models. (1992) (28)
- Incidence and risk factors of hepatocellular carcinoma change over time in patients with hepatitis C virus infection who achieved sustained virologic response (2019) (27)
- Quantitative analysis of antibody to hepatitis C virus envelope 2 glycoprotein in patients with chronic hepatitis C virus infection (1996) (27)
- Interleukin 1beta protects mice from Fas-mediated hepatocyte apoptosis and death. (1999) (27)
- Altered oligosaccharide structures reduce colitis induction in mice defective in β-1,4-galactosyltransferase. (2012) (27)
- Comparative analyses of regulatory T cell subsets in patients with hepatocellular carcinoma: A crucial role of CD25−FOXP3− T cells (2012) (26)
- Intrahepatic delivery of alpha-galactosylceramide-pulsed dendritic cells suppresses liver tumor. (2007) (26)
- Quantitative analysis of antibodies to hepatitis C virus during interferon‐α therapy (1993) (26)
- Influence of ethanol on insulin receptor substrate-1-mediated signal transduction during rat liver regeneration. (1994) (26)
- In vivo gene transfer and expression in rat stomach by submucosal injection of plasmid DNA. (1996) (26)
- Delayed‐onset caspase‐dependent massive hepatocyte apoptosis upon fas activation in bak/bax‐deficient mice (2011) (26)
- Geranylgeranylacetone Induces Cyclooxygenase-2 Expression in Cultured Rat Gastric Epithelial Cells Through NF-κB (2007) (26)
- BH3‐only protein bid participates in the Bcl‐2 network in healthy liver cells (2009) (25)
- Viral covalently closed circular DNA in a non-transgenic mouse model for chronic hepatitis B virus replication. (2006) (25)
- Expression of the c-met/hepatocyte growth factor receptor gene during rat liver regeneration induced by carbon tetrachloride. (1993) (25)
- Expression of MBP-HCV NS1/E2 fusion protein in E. coli and detection of anti-NS1/E2 antibody in type C chronic liver disease. (1992) (25)
- B7‐1 (CD80)‐gene transfer combined with interleukin‐12 administration elicits protective and therapeutic immunity against mouse hepatocellular carcinoma (1999) (25)
- The significance of immunoglobulin M antibody response to hepatitis C virus core protein in patients with chronic hepatitis C (1995) (25)
- Enhanced ability of peripheral invariant natural killer T cells to produce IL-13 in chronic hepatitis C virus infection. (2006) (24)
- Early decline of hemoglobin correlates with progression of ribavirin-induced hemolytic anemia during interferon plus ribavirin combination therapy in patients with chronic hepatitis C (2006) (24)
- Functional analysis of agalactosyl IgG in inflammatory bowel disease patients (2011) (24)
- Impact of alpha-fetoprotein on hepatocellular carcinoma development during entecavir treatment of chronic hepatitis B virus infection (2015) (24)
- Vaniprevir plus peginterferon alfa-2a and ribavirin in treatment-experienced Japanese patients with hepatitis C virus genotype 1 infection: a randomized phase II study (2014) (24)
- Early decline of hemoglobin can predict progression of hemolytic anemia during pegylated interferon and ribavirin combination therapy in patients with chronic hepatitis C (2008) (24)
- Tumor necrosis factor alpha stimulates invasion of Src-activated intestinal cells. (2002) (24)
- Natural killer cell‐mediated ablation of metastatic liver tumors by hydrodynamic injection of IFNα gene to mice (2007) (24)
- Helicobacter Pylori Infection Induces Candidate Stem Cell Marker Musashi-1 in the Human Gastric Epithelium (2008) (23)
- Intravenous injection of naked plasmid DNA encoding hepatitis B virus (HBV) produces HBV and induces humoral immune response in mice. (2003) (23)
- Two cases of development of entecavir resistance during entecavir treatment for nucleoside-naive chronic hepatitis B (2009) (23)
- Serodiagnosis of chronic hepatitis C in Japan by second-generation recombinant immunoblot assay. (1993) (23)
- Detection of hepatitis C virus RNA in serum of patients with chronic hepatitis C treated with interferon-alpha. (1992) (23)
- Endothelin-1, an ulcer inducer, promotes gastric ulcer healing via mobilizing gastric myofibroblasts and stimulates production of stroma-derived factors. (2006) (22)
- Protective role of adiponectin against ethanol-induced gastric injury in mice. (2012) (22)
- Visceral Obesity and Hypoadiponectinemia are Significant Determinants of Hepatic Dysfunction: An Epidemiologic Study of 3827 Japanese Subjects (2009) (22)
- Serum hepatitis C virus RNA levels and liver injury in volunteer blood donors. (1994) (22)
- Impact of branched‐chain amino acid supplementation on survival in patients with advanced hepatocellular carcinoma treated with sorafenib: A multicenter retrospective cohort study (2016) (22)
- Dendritic cell-based vaccines suppress metastatic liver tumor via activation of local innate and acquired immunity (2008) (22)
- Natural killer cell is a major producer of interferon γ that is critical for the IL-12-induced anti-tumor effect in mice (2010) (22)
- MRTF-A/B suppress the oncogenic properties of v-ras- and v-src-mediated transformants. (2010) (21)
- High expression of alpha-1-6 fucosyltransferase during rat hepatocarcinogenesis. (1998) (21)
- Chronic Hepatitis: Metabolic Cholestatic, Viral and Autoimmune (2007) (21)
- Gastroprotective Agent Rebamipide Induces Cyclooxygenase-2 (COX-2) in Gastric Epithelial Cells (2005) (20)
- Expression of alpha1-6 fucosyltransferase in rat tissues and human cancer cell lines. (1997) (20)
- Adiponectin deficiency enhanced the severity of cerulein-induced chronic pancreatitis in mice (2010) (20)
- Prediction of treatment outcome with daily high-dose IFN alpha-2b plus ribavirin in patients with chronic hepatitis C with genotype 1b and high HCV RNA levels: relationship of baseline viral levels and viral dynamics during and after therapy. (2004) (20)
- Lower Serum Level of Adiponectin Is Associated with Increased Risk of Endoscopic Erosive Gastritis (2011) (20)
- Impaired ability of interferon‐alpha‐primed dendritic cells to stimulate Th1‐type CD4 T‐cell response in chronic hepatitis C virus infection (2007) (20)
- Antiviral activity, dose–response relationship, and safety of entecavir following 24-week oral dosing in nucleoside-naive Japanese adult patients with chronic hepatitis B: a randomized, double-blind, phase II clinical trial (2009) (20)
- The efficacy of extended treatment with pegylated interferon plus ribavirin in patients with HCV genotype 1 and slow virologic response in Japan (2011) (20)
- Hepatic hemodynamics in patients with chronic hepatitis or cirrhosis as assessed by organ-reflectance spectrophotometry. (1983) (20)
- Heterogeneous activation of protein kinase C during rat liver regeneration induced by carbon tetrachloride administration (1989) (20)
- Roles of double-balloon endoscopy in the diagnosis and treatment of Crohn’s disease: a multicenter experience (2010) (20)
- Fibroblast growth factor‐2 enhances NK sensitivity of hepatocellular carcinoma cells (2012) (19)
- Pretreatment viral load and response to prolonged interferon-alpha course for chronic hepatitis C. (1995) (19)
- Juvenile hepatocellular carcinoma with congestive liver cirrhosis (2005) (19)
- Significance of liver stiffness measurement by acoustic radiation force impulse (ARFI) among hepatitis C patients (2014) (19)
- Renal impairment during the treatment of telaprevir with peginterferon and ribavirin in patients with chronic hepatitis C (2014) (19)
- Neutralization of Transforming Growth Factor β1 Augments Hepatitis C Virus-Specific Cytotoxic T Lymphocyte Induction in Vitro (1997) (19)
- Sequential protooncogene expression during regeneration in rat stomach. (1990) (19)
- Expression and phosphorylation of rat c-met/hepatocyte growth factor receptor during rat liver regeneration. (1995) (19)
- Involvement of STAT3-regulated hepatic soluble factors in attenuation of stellate cell activity and liver fibrogenesis in mice. (2011) (19)
- The Enzymatic Basis for the Conversion of Nonfucosylated to Fucosylated α-Fetoprotein by Acyclic Retinoid Treatment in Human Hepatoma Cells: Activation of α1-6 Fucosyltransferase (2002) (19)
- Effect of glycyrrhizin on viral replication and quasispecies in patients with type C chronic hepatitis (1997) (18)
- Vaniprevir plus peginterferon alfa-2b and ribavirin in treatment-naive Japanese patients with hepatitis C virus genotype 1 infection: a randomized phase III study (2015) (18)
- NON-DESTRUCTIVE MEASUREMENT OF TISSUE OXIDATIVE FUNCTIONS : MEASUREMENT OF CONCENTRATIONS OF RESPIRATORY ENZYMES AND THE RATE OF OXYGEN CONSUMPTION IN LIVING LIVER TISSUE BY REFLECTANCE SPECTROPHOTOMETRY (1978) (18)
- GBV‐C/HGV infection in chronic hepatitis C patients: Its effect on clinical features and interferon therapy (1998) (17)
- Ultrasonic tissue characterization of chronic liver disease using cepstral analysis. (1991) (17)
- Obesity and liver disease: evaluation of fatty infiltration of the liver using ultrasonic attenuation. (1991) (17)
- Serial quantitative analysis of serum hepatitis C virus RNA level in patients with acute and chronic hepatitis C. (1994) (17)
- Cleavage of viral RNA and inhibition of viral translation by hepatitis C virus RNA-specific hammerhead ribozyme in vitro. (1997) (17)
- [Antiviral therapy for patients with chronic hepatitis C]. (2001) (17)
- Hypervascular hepatocellular carcinoma: Combined dynamic MDCT and SPIO‐enhanced MRI versus combined CTHA and CTAP (2007) (17)
- Quick Generation of Fully Mature Dendritic Cells From Monocytes With OK432, Low-Dose Prostanoid, and Interferon-α as Potent Immune Enhancers (2006) (16)
- Lamivudine-to-entecavir switching treatment in type B chronic hepatitis patients without evidence of lamivudine resistance (2009) (16)
- A New Prognostic System for Hepatocellular Carcinoma Including Recurrent Cases: A Study of 861 Patients in a Single Institution (2008) (16)
- Restoration of gut motility in Kit-deficient mice by bone marrow transplantation (2009) (16)
- Survey of Hepatitis B Virus Co‐infection in Hepatitis C Virus‐infected Patients Suffering from Chronic Hepatitis and Hepatocellular Carcinoma in Japan (1999) (16)
- Expression of the hepatitis c virus genome in rat liver after cationic liposome-mediated in vivo gene transfer (1995) (16)
- Tumor necrosis factor‐α and interferon‐γ inhibit synergistically viral replication in hepatitis B virus‐replicating cells (1995) (16)
- Gastro-protective agent rebamipide induces cyclooxygenease-2 (COX-2) in gastric epithelial cells. (2005) (15)
- Risk factors for hepatocellular carcinoma in hepatitis C patients with normal alanine aminotransferase treated with pegylated interferon and ribavirin (2014) (15)
- LEC rats: An overview of recent findings (1997) (15)
- Supportive role played by precore and preS2 genomic changes in the establishment of lamivudine-resistant hepatitis B virus. (2008) (15)
- Interleukin-1β enhances the production of soluble MICA in human hepatocellular carcinoma (2012) (15)
- Generation of hepatitis C virus‐specific cytotoxic T lymphocytes from healthy individuals with peptide‐pulsed dendritic cells (2001) (15)
- Suppression of signal transducers and activators of transcription 1 in hepatocellular carcinoma is associated with tumor progression (2012) (15)
- Comparative analysis of the effects of anti‐IL‐6 receptor mAb and anti‐TNF mAb treatment on CD4+ T‐cell responses in murine colitis (2011) (15)
- Quantitative analysis of antibodies to hepatitis C virus during interferon-alpha therapy. (1993) (14)
- Conditional knockout of heparin‐binding epidermal growth factor‐like growth factor in the liver accelerates carbon tetrachloride‐induced liver injury in mice (2013) (14)
- Evaluation of long-term entecavir treatment in stable chronic hepatitis B patients switched from lamivudine therapy (2010) (14)
- Influence of transfusion‐transmitted virus infection on the clinical features and response to interferon therapy in Japanese patients with chronic hepatitis C (1999) (14)
- Low expression of erythrocyte complement receptor type 1 in chronic hepatitis C patients (1996) (13)
- Involvement of dendritic cell frequency and function in virological relapse in pegylated interferon‐α and ribavirin therapy for chronic hepatitis C patients (2007) (13)
- Pitavastatin ameliorated the progression of steatohepatitis in ovariectomized mice fed a high fat and high cholesterol diet (2013) (13)
- Changes in gene expression profile by HCV core protein in cultured liver cells: analysis by DNA array assay. (2003) (13)
- Hepatic circulation and hepatic oxygen consumption in alcoholic and nonalcoholic fatty liver. (1988) (13)
- Characterization of tyrosine kinase I domain c-kit gene mutation Asn655Lys newly found in primary jejunal gastrointestinal stromal tumor. (2007) (13)
- Interferon-α suppresses hepatitis B virus enhancer II activity via the protein kinase C pathway. (2012) (13)
- Ninjurin1 increases p21 expression and induces cellular senescence in human hepatoma cells. (2004) (12)
- Upregulation of GRAIL is associated with remission of ulcerative colitis. (2008) (12)
- An enzymatic method of analysis for GDP-L-fucose in biological samples, involving high-performance liquid chromatography. (2002) (12)
- The combination therapy of α‐galactosylceramide and 5‐fluorouracil showed antitumor effect synergistically against liver tumor in mice (2013) (12)
- The impact of an inosine triphosphate pyrophosphatase genotype on bilirubin increase in chronic hepatitis C patients treated with simeprevir, pegylated interferon plus ribavirin (2016) (12)
- Type B Fulminant Hepatitis Is Closely Associated with a Highly Mutated Hepatitis B Virus Strain (2007) (12)
- Cultured bone marrow cell local implantation accelerates healing of ulcers in mice (2008) (12)
- Efficacy of re-treatment with pegylated interferon plus ribavirin combination therapy for patients with chronic hepatitis C in Japan (2011) (12)
- A multicenter survey of re‐treatment with pegylated interferon plus ribavirin combination therapy for patients with chronic hepatitis C in Japan (2013) (12)
- Adiponectin negatively correlates with alcoholic and non‐alcoholic liver dysfunction: Health check‐up study of Japanese men (2013) (12)
- Hepatitis C virus‐specific CD8+ T cell frequencies are associated with the responses of pegylated interferon‐α and ribavirin combination therapy in patients with chronic hepatitis C virus infection (2011) (12)
- Two types of drug-resistant hepatitis B viral strains emerging alternately and their susceptibility to combination therapy with entecavir and adefovir (2009) (11)
- Natural killer cell-mediated ablation of metastatic liver tumors by hydrodynamic injection of IFNalpha gene to mice. (2007) (11)
- Factors contributing to antiviral effect of adefovir dipivoxil therapy added to ongoing lamivudine treatment in patients with lamivudine-resistant chronic hepatitis B (2009) (11)
- Manifestations of temporary symptoms during endoscopic variceal sclerotherapy using thrombin as a sclerosant. (1991) (11)
- Initial viral response is the most powerful predictor of the emergence of YMDD mutant virus in chronic hepatitis B patients treated with lamivudine (2008) (11)
- Hepatitis C Virus Antibodies and Virus Replication in Asymptomatic Blood Donors (1994) (11)
- Hepatitis B core antigen-specific interferon gamma production of peripheral blood mononuclear cells during acute exacerbation of chronic hepatitis B. (1992) (11)
- Antibodies to a putative hepatitis C virus polyprotein in Japanese patients with chronic liver disease (1992) (11)
- Changes in antibodies to specific hepatitis C virus antigens with interferon-alpha therapy: analysis by recombinant immunoblot assay. (1993) (11)
- Dynamics of regulatory T cells and plasmacytoid dendritic cells as immune markers for virological response in pegylated interferon-α and ribavirin therapy for chronic hepatitis C patients (2012) (11)
- Efficacy of pegylated interferon and ribavirin combination therapy for patients with hepatitis C virus infection after curative resection or ablation for hepatocellular carcinoma—A retrospective multicenter study (2015) (10)
- A novel strategy for cancer therapy by mutated mammalian degenerin gene transfer (2000) (10)
- Enhanced expression of HLA class I by inhibited replication of hepatitis B virus. (1992) (10)
- Expression of DNA methyltransferase in LEC rats during hepatocarcinogenesis. (1993) (10)
- Selective suppression of N-acetylglucosaminyltransferase III activity in a human hepatoblastoma cell line transfected with hepatitis B virus. (1994) (10)
- Hepatitis B virus markers and antibodies to hepatitis C virus in Japanese patients with hepatocellular carcinoma (2005) (10)
- Fas and Fas ligand in human hepatocellular carcinoma (2001) (9)
- Lack of adiponectin promotes formation of cholesterol gallstones in mice. (2010) (9)
- Clinical characteristics of patients with chronic hepatitis C showing biochemical remission, without hepatitis C virus eradication, as a result of interferon therapy. The Osaka Liver Disease Study Group. (2000) (9)
- Immunological response to interferon-gamma priming prior to interferon-alpha treatment in refractory chronic hepatitis C in relation to viral clearance. (2001) (9)
- Suppressive effect on hepatocyte differentiation of hepatitis C virus core protein. (2006) (9)
- Valine, the branched-chain amino acid, suppresses hepatitis C virus RNA replication but promotes infectious particle formation. (2013) (9)
- [A patient who developed diaphragmatic hernia 20 months after percutaneous radiofrequency ablation for hepatocellular carcinoma]. (2010) (8)
- Significance of serum soluble Fas antigen level in chronic hepatitis C patients treated with interferon: Relationship to the therapeutic response (2001) (8)
- Efficacy of pegylated interferon plus ribavirin combination therapy for hepatitis C patients with normal ALT levels: a matched case–control study (2011) (8)
- The prospective randomized study on telaprevir at 1500 or 2250 mg with pegylated interferon plus ribavirin in Japanese patients with HCV genotype 1 (2015) (8)
- The significance of interferon and ribavirin combination therapy followed by interferon monotherapy for patients with chronic hepatitis C in Japan. (2004) (8)
- Alteration in Gene Expression Profile by Full-Length Hepatitis B Virus Genome (2005) (8)
- IgG and IgM core antibodies and viral replication in hepatitis C virus carriers. (1994) (7)
- The real impact of telaprevir dosage on the antiviral and side effects of telaprevir, pegylated interferon and ribavirin therapy for chronic hepatitis C patients with HCV genotype 1 (2015) (7)
- Impact of daily high-dose IFNalpha-2b plus ribavirin combination therapy on reduction of ALT levels in patients with chronic hepatitis C with genotype 1 and high HCV RNA levels. (2005) (7)
- Esophageal intramural pseudodiverticulosis: a rare cause of esophageal stricture. (2010) (7)
- Fibrosis score consisting of four serum markers successfully predicts pathological fibrotic stages of chronic hepatitis B (2013) (7)
- [A case report of autoimmune hepatitis with myasthenia gravis]. (1988) (6)
- Activated liver dendritic cells generate strong acquired immunity in alpha-galactosylceramide treatment. (2009) (6)
- Involvement of bone marrow‐derived stromal cells in gastrointestinal cancer development and metastasis (2008) (6)
- Association between transforming growth factor-β1 -509 C>T variants and hepatocellular carcinoma susceptibility: a meta-analysis. (2016) (6)
- Interferon for Decreasing the Incidence of Hepatocellular Carcinoma in Patients with Chronic Hepatitis C (2002) (6)
- Estimated hepatic oxygen consumption in patients with chronic liver diseases as assessed by organ reflectance spectrophotometry (1986) (5)
- Hepatitis C virus replication and antibodies to structural and nonstructural viral proteins in chronic hepatitis C. (1994) (5)
- Amino acid substitution in the core protein has no impact on relapse in hepatitis C genotype 1 patients treated with peginterferon and ribavirin (2011) (5)
- Hepatitis C virus replicative levels and efficiency of genotyping by specific PCR and antibody assay (1997) (5)
- Alpha-2a (40KD) (PEGASYS®) plus ribavirin (COPEGUS®) in treatment naive japanese chronic hepatitis C patients: A randomised, double-blind, multicentre, phase iii trial (2006) (5)
- Disease stage of chronic hepatitis C assessed by both peritoneoscopic and histologic findings and its relationship with response to interferon therapy. (1997) (5)
- Tumor necrosis factor-alpha and interferon-gamma inhibit synergistically viral replication in hepatitis B virus-replicating cells. (1995) (5)
- Immunopathogenesis of type C hepatitis: dendritic cell in HCV infection (2004) (5)
- [Apoptosis in human diseases: role of Fas system in liver cell injury by viral hepatitis]. (1997) (5)
- Detection of HCV infection with second-generation assays (1993) (5)
- A case of malignant lymphoma presenting as fulminant hepatic failure. (1988) (5)
- Discrimination of fibrotic staging of chronic hepatitis C using multiple fibrotic markers (2014) (4)
- [Molecular biology of Fas antigen-Fas ligand system]. (1996) (4)
- Decreased expressions of CD1d molecule on liver dendritic cells in subcutaneous tumor bearing mice. (2008) (4)
- Inhibition of cytochrome P-450-dependent mixed function oxidation by ethanol (1985) (4)
- Measuring immunity in viral hepatitis (2004) (4)
- Little expression of proto-oncogene Bcl-2 in tumourous cells of hepatocellular carcinoma with chronic hepatitis C virus infection (1996) (4)
- Differential alteration of CD56bright and CD56dim natural killer cells in frequency, phenotype, and cytokine response in chronic hepatitis C virus infection (2011) (4)
- Blood Screening for Asymptomatic Hepatitis C Virus Carriers with Second-generation Hepatitis C Virus Antibody Assays (1994) (4)
- Asian Pacific Association for Study of the Liver (APASL) (2003) (4)
- Heterogeneous activation of protein kinase C during rat liver regeneration. (1990) (4)
- Risk Factors for Hepatocellular Carcinoma Among Chronic Hepatitis C Patients Treated with Interferon (1999) (4)
- Successful hepatic arterial infusion chemotherapy of cisplatin in advanced hepatocellular carcinoma (2004) (4)
- Serum HCV RNA levels during early phase of recombinant interferon alfa-2a (Roferon A) therapy for chronic hepatitis C and efficacy of short-term therapy with earlier loss of viremia. (2002) (4)
- Efficacy and safety of treatment with peginterferon alfa-2a for chronic hepatitis B patients (2012) (4)
- JNJ-4178 (adafosbuvir, odalasvir, and simeprevir) in Japanese patients with chronic hepatitis C virus genotype 1 or 2 infection with or without compensated cirrhosis: the Phase IIa OMEGA-3 study (2020) (4)
- Signal transduction pathways in the induction of HLA class I antigen expression on Huh 6 cells by interferon-gamma. (1991) (4)
- [Evaluation of usefulness of Tc-99m-GSA liver scintigraphy in chronic liver diseases]. (1991) (4)
- Distinct susceptibility of dendritic cell subsets to hepatitis C virus infection: a plausible mechanism of dendritic cell dysfunction (2004) (4)
- Triple therapy of initial high‐dose interferon with ribavirin and amantadine for patients with chronic hepatitis C (2007) (3)
- Usefulness of Sparfloxacin against Chlamydia pneumoniae Infection in Patients with Bronchial Asthma (2005) (3)
- α‐Galactosylceramide activates antitumor immunity against liver tumor (2011) (3)
- [Bronchogenic cyst in the abdomen--a case report]. (2011) (3)
- Two-dimensional flow cytometric analysis of intrahepatic lymphocyte subsets from patients with chronic hepatitis (2005) (3)
- Using early viral kinetics to predict antiviral outcome in response-guided pegylated interferon plus ribavirin therapy among patients with hepatitis C virus genotype 1 (2014) (3)
- Renal kinin and kallikrein excretion in cirrhotic patients. (1991) (3)
- New chemotherapy for patients with advanced hepatocellular carcinoma: Pilot study of β‐interferon and doxorubicin one‐shot intra‐arterial chemotherapy (2007) (3)
- Innate Immunity in Type C Hepatitis (2008) (3)
- Quantitative analysis of hepatitis C viras RNA: relationship between the replicative level and the various stages of the carrier states or the response to interferon therapy (1993) (3)
- Effects of alpha-interferon on gamma-interferon production of peripheral blood mononuclear cells in hepatitis B virus carriers (1992) (3)
- Early emergence of entecavir‐resistant hepatitis B virus in a patient with hepatitis B virus/human immunodeficiency virus coinfection (2008) (3)
- [Coinfection of hepatitis C virus and hepatitis G virus in patients with chronic hepatitis]. (1997) (3)
- Incidence of hepatocellular carcinoma in HCV-infected patients with normal alanine aminotransferase levels categorized by Japanese treatment guidelines (2013) (3)
- HERPETIC ESOPHAGITIS IN A RENAL TRANSPLANT PATIENT (1990) (3)
- Serum pre-S1 and pre-S2 antigens as prognostic markers in interferon therapy for chronic hepatitis B. (1992) (3)
- Alterations in hepatitis B virus nucleotide sequences in a chronic virus carrier from immunotolerant to immunoactive phase. (2010) (3)
- [A case with goblet cell carcinoid of the appendix presenting as unilateral Krukenberg tumor]. (1991) (2)
- Long-term biochemical and virological response to natural interferon-α in patients with chronic hepatitis C (1996) (2)
- Three cases of posttransfusion hepatitis C treated with interferon-α (1992) (2)
- Impact of ribavirin dosage in chronic hepatitis C patients treated with simeprevir, pegylated interferon plus ribavirin combination therapy (2016) (2)
- S1179 IgG Oligosaccharide Alterations Are a Novel Diagnostic Marker for Disease Activity and the Clinical Course of Inflammatory Bowel Disease (2008) (2)
- HCV evolutionary genetics of SVR versus virologic failure assessed from the vaniprevir phase III registration trials. (2016) (2)
- Elevated serum levels of IL-10 in patients with acute and chronic HCV infection (1995) (2)
- Multi-center clinical studies for strategies to improve patients' accessibility to peginterferon therapy: Consideration based on both prospective study and retrospective study (2010) (2)
- Detection of hepatitis C virus RNA in serum in chronic liver disease. (1991) (2)
- Low-dose oral interferon-α in the treatment of chronic viral hepatitis type B: A double-blind, randomized, placebo-controlled, clinical trial (2000) (2)
- Latent autoimmune hepatitis in non-B non-C chronic liver diseases. (1996) (2)
- Lowering effect of branched chain amono acid and arginine on blood ammonia level in patients with liver cirrhosis (1995) (2)
- 380 IFN-γ or IL-15 restores the impaired helper T-cell polarizing ability of blood dendritic cell subsets in chronic hepatitis C (2003) (2)
- Treatment Guidelines of Hepatitis C (2012) (2)
- Mutations associated with the therapeutic efficacy of adefovir dipivoxil added to lamivudine in patients resistant to lamivudine with type B chronic hepatitis (2009) (2)
- 680 CLINICAL CHARACTERISTICS, TREATMENT AND PROGNOSIS OF NON-B NON-C HEPATOCELLULAR CARCINOMA: A LARGE RETROSPECTIVE MULTICENTER COHORT STUDY (2013) (2)
- [New therapeutic agents for chronic hepatitis C]. (2004) (2)
- [A case of ventricular tachycardia occurred during interferon therapy in chronic hepatitis C]. (1995) (2)
- Reducing Peg-IFN doses causes later virologic response or no response in HCV genotype 1 patients treated with Peg-IFN alfa-2b plus ribavirin (2012) (2)
- [Mechanism of liver cell injury in type C hepatitis]. (1996) (2)
- P.109 Efficacy and safety of entecavir and lamivudine in japanese adult patients with chronic hepatitis B infection: a phase 2 clinical trial (2006) (2)
- [Collision tumor of a carcinoid and carcinoma in the rectum]. (2010) (2)
- 703 LONG TERM EFFICACY, SAFETY AND RESISTANCE ANALYSES OF ENTECAVIR (ETV) TREATMENT IN JAPANESE NUCLEOSIDE-NAIVE PATIENTS WITH CHRONIC HEPATITIS B (CHB) (2008) (2)
- [Hepatitis C viral quasispecies in patients with type C chronic liver disease]. (1995) (2)
- IS HELICOBACTER PYLORI‐INDUCED ENLARGED FOLD GASTRITIS A HIGH‐RISK FACTOR FOR GASTRIC CARCINOMA? (2006) (2)
- Retreatment with 24-week course of interferon-α for patients with chronic hepatitis C (1996) (2)
- Changes in virus loads and precore mutations in chronic hepatitis B patients treated with 4 weeks of daily interferon alfa-2a therapy (2004) (2)
- Ultra‐deep sequencing analysis of resistance‐associated variants during retreatment with simeprevir‐based triple therapy after failure of telaprevir‐based triple therapy in patients with genotype 1 hepatitis C virus infection (2017) (2)
- Effects of hepatitis B virus antigens on interferon-gamma production of peripheral blood mononuclear cells from hepatitis B virus carriers and healthy individuals. (1994) (1)
- [Development of antiviral therapy for patients with chronic hepatitis C]. (2008) (1)
- P572 INSULIN USE IS RELATED TO THE DEVELOPMENT OF HEPATOCELLULAR CARCINOMA AT YOUNGER AGE WITH NON-VIRAL ETIOLOGY (2014) (1)
- Binding cells of125I-iodoamphetamine in rat liver (1997) (1)
- In vivo transfection of rat liver with hepatitis C virus cDNA using cationic liposome-mediated gene delivery. (1995) (1)
- A CASE OF GASTRIC CANDIDIASIS COMPLICATING LEIOMYOMA OF THE STOMACH : SUCCESSFUL TREATMENT BY ENDOSCOPIC INJECTION THERAPY WITH MICONAZOLE (1991) (1)
- Clearance of hepatitis C virus with the optimal cyclic and periodic interferon treatment regimen consisting of induction treatment with natural interferon beta followed by maintenance treatment with interferon alpha in interferonresistant patients (2003) (1)
- Comparison of the effectiveness of oral and subcutaneous glucose treatment on energy metabolism in the liver of rats with galactosamine induced acute liver injury. (1985) (1)
- [Involvement of dendritic cell dysfunction in the persistence of hepatitis C virus infection]. (2004) (1)
- [Expression of the protein kinase C genes during liver regeneration]. (1993) (1)
- Phase I Trial of Gemcitabine Dose Escalation with Concurrent Radiotherapy for Patients with Locally Advanced Pancreatic Cancer (2010) (1)
- Interferon therapy and new antiviral drugs for chronic hepatitis C. (2010) (1)
- [Clinical study and pathology of subacute hepatitis]. (1969) (1)
- A case of well-differentiated hepatocellular carcinoma whose size was 35mm in diameter (1999) (1)
- Alpha-interferon enhances gamma-interferon production of peripheral blood mononuclear cells pre-activated with phytohemagglutinin (1993) (1)
- [A case of hypovascular acinar cell carcinoma of pancreas, liver metastatic lesions of which showed hypervascular]. (1998) (1)
- Chemokine gene expression in liver tissue with chronic viral hepatitis (1998) (1)
- Effects of non-steroidal anti-inflammatory drugs (NSAIDs) with 5-fluorouracil in colon cancer (2003) (1)
- Treatment with recombinant interferon-alpha 2a for patients with chronic hepatitis C: predictive factors for biochemical and virologic response. Osaka Liver Disease Study Group. (1996) (1)
- 382 Autocrine IL-15 is required for MHC class I-related chain A and B expression on monocyte-derived dendritic cells in response to interferon A/B: impairment of interferon-induced IL-15 production in hepatitis C virus infection (2003) (1)
- 582 High response rates with peginter-feron α-2a (40KD) (PEGASYS®) plus ribavirin (COPEGUS®) in Japanese non-responders or relapsers to conventional interferon (2006) (1)
- 333 THE USEFULLNESS OF VS/PLT: A NEW MARKER OF LIVER FIBROSIS (2011) (1)
- [18F-fluorodeoxyglucose-positron emission tomography (FDG-PET) was useful tool for detecting tuberculous peritonitis: report of a case]. (2008) (1)
- [Ultrasonic measurement system for tissue characterization]. (1991) (1)
- Oxygen delivery and utilization in liver in alcoholic liver disease. (1985) (1)
- Effects of cytokines on HLA class I antigen expression on Huh6 and HB611 cells (1993) (1)
- [Investigation of simplified international diagnostic criteria for autoimmune hepatitis]. (2010) (1)
- 1268 CD1D-mediated stimulation of natural killer T cells selectively activates hepatic natural killer cells in interferon-gamma independent manner and induces the activation of acquired immunity against murine hepatocellular carcinoma (2003) (1)
- M1153 Correlation Between Vitamin K Deficiency and Clinical Activity Index in Patients with Inflammatory Bowel Disease (2009) (1)
- Timing of withdrawal of lamivudine treatment for HBeAg-negative chronic hepatitis B patients (2006) (1)
- A Crucial Role of Hepatocyte p53 in Liver Fibrogenesis (2011) (1)
- A study of combination therapy with IFN-.BETA. (twice a day) followed by rIFN-.ALPHA. 2b administered three times a week for 20 weeks in refractory chronic hepatitis C (2003) (1)
- S1666 Involvement of DNA Methyltransferase Expression in H. pylori cagA Induces Hypermethylation of Let-7 and Upregulation of RAS in Gastric Epithelial Cells (2010) (1)
- Intravenous injection of recombinat hepatitis B virus (HBV) DNA achieves high-level expression of HBV as well as humoral immune response in mice (2002) (1)
- [Expression of hepatitis B virus (HBV) markers in chronic liver disease positive for antibody to hepatitis C virus (HCV)]. (1990) (1)
- A case of acute fulminant hepatitis B who showed deep coma 15 hours after onset and died (2004) (1)
- Protective Role of Adiponectin Against Ethanol Induced Gastric Injury in Mice (2011) (1)
- [A case of fistula of the colon in non-Hodgkin's lymphoma of the spleen]. (1990) (1)
- Correlation Between Peritoneoscopic Findings and Response to Interferon in Patients with Chronic Hepatitis C (1995) (1)
- Pretreatment viral load and response to interferon therapy for liver cirrhosis caused by hepatitis C virus: a multicenter controlled study (2000) (1)
- Involvement of GBV-C/HGV in liver diseases in Japan (1999) (1)
- Influence of ranitidine on hepatic blood flow assessed by organ-reflectance spectrophotometer and pulse-doppler ultrasonic flowmeter (1985) (1)
- Fatal exacerbation of type B chronic hepatitis triggered by changes in relaxed circular viral DNA synthesis and virion secretion. (2010) (1)
- Effects of endoscopic variceal sclerotherapy using GT XIII on blood coagulation tests and the renal kallikrein-kinin system (1990) (1)
- [Variation in quasispecies population of blood HCV-RNA in each stage of type C chronic liver disease]. (2004) (0)
- Expression of proto-oncogenes during liver regeneration (1988) (0)
- Forthcoming papers (2006) (0)
- [Role of Fas system in apoptosis induced by hepatitis C virus infection]. (1995) (0)
- [The strategy for hepatitis control in Japan]. (2011) (0)
- [Expression of pre-S1 antigen and pre-S1 antibody in sera obtained from HBV infected patients]. (1989) (0)
- Analysis of liver surface structure using 2-dimensional Fourier transform. (1990) (0)
- Cyclooxygenase-2 activity alters the chemokine receptors expressions in colon cancer cells and enhances metastatic potentials (2003) (0)
- T1236 Agalactosyl IgG Observed in Inflammatory Bowel Disease Is Associated with Enhancement of Antibody-Dependent Phagocytosis in Human Monocytic Cell Line (2008) (0)
- Correlation between hepatic hemodynamics and abnormality of liver morphology in patients with alcoholic liver disease (1986) (0)
- Long-term use of entecavir in nucleoside-naïve Japanese patients with chronic hepatitis B infection q (2010) (0)
- Contents Vol. 50, 2007 (2007) (0)
- [Topics on type C chronic hepatitis]. (2000) (0)
- [A case of intestinal obstruction due to food]. (1999) (0)
- Immune response toward HBV-related DNA polymerase in the course of hepatitis B virus infection. (1989) (0)
- Replicative level of hepatitis C virus (HCV) in chronic hepatitis C. (1993) (0)
- Oncogene Expression in Liver Injury (1997) (0)
- 1173 Surveillance Strategy After Endoscopic Submucosal Dissection for Early Gastric Cancer: A Multicenter Study by Osaka University ESD Study Group (2011) (0)
- A Novel Potential of Cyclooxygenase-2 Specific Inhibitors to Prevent Intricate Epigenetic Dysregulation and Aberrant Cancer Stem Cell Biology (2011) (0)
- Signal Transduction Involved in Cell Cycle Regulation of Normal Hepatocyte and Hepatoma Cells (2002) (0)
- Hepatoma Cell Lines Fucosylation in Human Hepatocellular Carcinoma and forProduction of GDP-l-Fucose , a Common Donor Substrate Relationship between Elevated FX Expression and Increased Updated (2003) (0)
- Present condition and problems of interferon therapy for chronic hepatitis C. (1996) (0)
- [Detection of hepatitis C virus RNA in serum during treatment of chronic hepatitis C with interferon alpha]. (1991) (0)
- Infection and B Is Impaired in Hepatitis C Virus Expression of MHC Class I-Related Chain A for Type I IFN-Mediated Dendritic Cell Autocrine / Paracrine IL-15 That Is Required (2003) (0)
- Sequencing analysis of the terminal protein region in patients showing persistent remission of chronic hepatitis B (1995) (0)
- Islet Cell Carcionoma With High Levels of Carcinoembryonic Antigen and Glucagon (2009) (0)
- Changes in calcium response to hormones in single hepatocytes during culture (1990) (0)
- Peginterferon Alfa-2a in Japanese HBeAg-Positive Patients is Not Inferior to Conventional Interferon Therapy (2011) (0)
- Effectiveness of retreatment with 10-month course of rIFN .ALPHA.-2a for patients with chronic hepatitis C that relapsed after initial IFN therapy. (2000) (0)
- Impairment in Chronic Hepatitis C Virus Dendritic Cells in NK Cell Activation :-Stimulated α A and B Expression on IFN-Critical Role of MHC Class I-Related Chain Miyagi (2003) (0)
- Role of endothelium-derived hyperpolarizing factor in ethanol-induced vasoconstriction (1995) (0)
- Abstracts of selected papers presented at the 34th annual meeting of the japanese society of gastroenterology (1993) (0)
- Staging of hepatitis B virus carriers based on HBV markers and cancer risk-A system to assist in the selection of appropriate antiviral treatment- (2004) (0)
- Clinical efficacy and immunological effects of weekly administration of interferon-β in patients with type B chronic hepatitis (1999) (0)
- Morphological analysis for gene expression of γ-glutamyltranspeptidase in rat liver during carcinogenesis induced by diethylnitrosamine (1989) (0)
- Abstracts of Selected Papers Presented at the 31st Annual Meeting of the Japanese Society of Gastroenterology (1991) (0)
- [The progress of antiviral therapy for chronic hepatitis B]. (2011) (0)
- CORRELATION BETWEEN THE EFFICACY OF INTERFERON AND HCV GENE (1999) (0)
- S1685 Oligosaccharide Alterations in IgG in Inflammatory Bowel Disease Is Not Associated with MBL Lectin Complement Pathway But with Enhancement of Antibody-Dependent Phagocytosis (2009) (0)
- In vivo ultrasonic tissue characterization for the fatty infiltration in the liver using the frequency-dependent attenuation coefficient (1991) (0)
- Endothelial Growth Factor in Human Hepatocellular Carcinoma Expression of Vascular Permeability Factor / Vascular Updated (2006) (0)
- Dissemination of clinical practice guidelines for hepatocellular carcinoma among Japanese hepatologists and liver surgeons (2007) (0)
- 712 Bone-Marrow Cells Are Able to Develop Interstitial Cells of Cajal: Morphologic Evidences in W/WV Mice (2008) (0)
- Intractable liver diseases. Advances in diagnosis and treatment IV. Topics 1. Hepatocyte failure and apoptosis. (1999) (0)
- Incidence and risk factors of hepatocellular carcinoma in patients with hepatitis C who achieved a sustained virological response through direct‐acting antiviral agents among the working population in Japan (2022) (0)
- W1088 Chemical Intervention Reverses Oxidative Stress-Induced Epigenetic Alterations in Colon Cancer Cells: Clues for New Chemopreventive Measures Against Aging and Carcinogenesis (2008) (0)
- Molecular pathogenesis of viral hepatitis. (2003) (0)
- Antibodies to hepatitis C virus and hepatitis C virus infection (1993) (0)
- T1157 Potential of IL-6 Antibody as Promising Anti-Cancer Agent Targeting Colon Cancer Stem Cells (2010) (0)
- Abstracts of selected papers presented at the 79th general meeting of the Japanese Society of Gastroenterology March 29–31, 1993, Kyoto, Japan (1991) (0)
- H. pylori CagA Induces Hypermethylation of Let-7 Promoter CpG Islands and Lymphomagenesis (2011) (0)
- Correlation between biochemical response, HCV genome subtype and HCV RNA levels in chronic hepatitis C patients treated with interferon beta: A multicenter, randomized trial with different therapeutic regimens. (1995) (0)
- [Serodiagnosis of hepatitis C by a recombinant hepatitis C virus protein]. (1993) (0)
- Immune responses toward HCV core NS3, and NS4 proteins in HCV RNA-positive chronic hepatitis C patients (1994) (0)
- [Two-step interferon rebound therapy]. (2004) (0)
- P1049 RISK FACTORS FOR HEPATOCELLULAR CARCINOMA AMONG PATIENTS WITH CHRONIC HEPATITIS B TREATED WITH ENTECAVIR (2014) (0)
- Usefulness of Contrast Ultraharmonic Real-time Perfusion Imaging in The diagnosis of Abdominal Neoplastic Lesions (2001) (0)
- S1660 Deficiency of Galactosyltransferase, Indispensable Enzyme for IgG Galactosylation, Ameliorates Murine Dextran Sodium Sulfate (DSS)-Induced Colitis (2009) (0)
- THE CLINICAL AND ENDOSCOPIC CHARACTERISTICS OF ACUTE DUODENAL ULCER (1983) (0)
- Tu1563 Usefulness of Double-Balloon Endoscopy in the Diagnosis and Treatment of Small Bowel Tumors (2011) (0)
- 428 Possible Roles of Let-7 MicroRNA Expression in the Cytotoxin-Associated Gene A (CagA) Associated Pathogenesis (2008) (0)
- Significance of α1-6 Fucosylation in Hepatocellular Carcinoma (2001) (0)
- Transfiguration of infectious diseases.7 Liver lesion from the viewpoint of the proliferation kinetics of hepatitis C virus.Mechanisms of progression and effectiveness of interferon therapy. (1993) (0)
- Fourth International Symposium of the Japanese Society of Gastroenterology October 12–14, 1992, Utsunomiya, Japan (2007) (0)
- Proceedings of the 25th annual meeting From October 13–15, 1983-Yamaguchi, Japan (2007) (0)
- Abstracts of selected papers presented at the 76th General Meeting of the Japanese Society of Gastroenterology March 29–31, 1990, Tokyo, Japan (2007) (0)
- [Etiological mechanism of hepatitis C]. (1994) (0)
- [Cationic liposome-mediated expression of hepatitis C virus genome in adult rat liver]. (1995) (0)
- [Proliferation mechanism of hepatitis C virus and effectiveness of interferon therapy]. (1993) (0)
- [Interferon treatment for aged patients with hepatitis C]. (2004) (0)
- [A case of long-term survival with TAE resistant multiple recurrence HCC successfully treated by hepatic resection]. (2003) (0)
- HCV RNA levels measured with anamplicore HCV monitor kit: In relation to interferon therapy (1995) (0)
- 395 Protective Role in Deficiency of Galactosyltransferase for Murine Colitis With Upregulation of IL-10 by Communication of B Cells and Macrophages (2010) (0)
- HBV- and HCV-related chronic liver disease and hepatocellular carcinoma (2002) (0)
- [Hepatocyte dysfunction and apoptosis]. (1999) (0)
- Studies on the mitochondrial and microsomal cytochromes in alcoholics liver (1977) (0)
- Replicative Level of HCV Determined by the Competitive Reverse Transcription and Polymerase Chain Reaction Assay in Various Stages of Chronic HCV Infection (1994) (0)
- [A case of hepatocellular carcinoma detected by dynamic CT and MRI but not digital subtraction angiography]. (1997) (0)
- Serum levels of IL-10 and s-ICAM-1 in patients with chronic hepatitis C treated with interferon-alpha (1995) (0)
- Gastro-esophageal reflux disease related to diabetes: Analysis of 283 cases with type 2 diabetes mellitus or chronic hepatitis C (2003) (0)
- [A case of hepatocellular carcinoma with invasion into gastric and esophageal varices]. (1991) (0)
- Detection of antibodies to hepatitis C virus in patients with non-A, non-B liver disease. (1991) (0)
- Inactivation of p38 MAPK and JNK contribute to hepatocarcinogenesis (2001) (0)
- [Expression of Pre-S2 antigen and antibody in patients with hepatitis B virus infection]. (1989) (0)
- Fas system and apoptosis in viral hepatitis : Molecular biology, pathogenesis and clinics (1997) (0)
- Special issue : Chronic hepatitis - advances on diagnosis and treatments.1.Surrounding the origin and disease state.5 Occurrence mechanism of hepatitis C. (1994) (0)
- [Modified FOLFOX6 was effective for advanced adenocarcinoma with unknown origin in a patient with Crohn's disease]. (2009) (0)
- The hemoperfusion and oxygen saturation in the liver in situ analyzed by reflectance spectrophotometry (II) (1980) (0)
- T1212 Upregulation of E3 Ubiquitin Ligases Related to T Cell Anergy in CD4+ T Cells Isolated from Patients with Ulcerative Colitis in Remission (2008) (0)
- Results Serum IgG of B 4 galt 1 / Mice Has an Agalactosyl Pattern Similar to That of Patients With CD B (2012) (0)
- Abstracts of Selected Papers Presented at the 77th General Meeting of the Japanese Society of Gastroenterology (1992) (0)
- Cytoskeletal Alteration and Resultant Atypical EMT-Phenotype as Novel Target to Chemoresistant-Associated Metastasis (2011) (0)
- Hepatocyte failure and apoptosis in the viral hepatitis. (1999) (0)
- Gene transfer of mutated sodium-ion channel burst gastric cancer in vivo (2001) (0)
- 1087 Hypermethylation of Let-7 Promoter Is Involved in cagA-Induced RAS Upregulation in Gastric Epithelial Cells (2009) (0)
- T1150 Role of Cyclooxygenase-2 in Cancer Stem Cell Biology and Effect of COX-2 Inhibitors in Anti-Cancer Therapy Targeting Cancer Stem Cells (2010) (0)
- AASLD AbstractDifference in activatio of RAF/MEK/ERKI1 pathways between normal liver cell growth and hepatocellular carcinoma (1995) (0)
- Postoperative Pneumonia Associated with ESD Is Increased in Elderly Patients with Upper Gastrointestinal Neoplasm: Multicenter Survey By Osaka University Study Group for ESD (2009) (0)
- M1155 Bone Mineral Density and Biochemical Markers of Bone Turnover in Patients with Inflammatory Bowel Disease (2008) (0)
- Delayed Onset of Caspase-Dependent Liver Failure Induced by Fas Stimulation in Bak and BAX Double Knockout Mice (2011) (0)
- Clinical superiority of contrast ultrasonography in hepatocellular carcinoma after introduction of multidetector CT (2003) (0)
- Indications and Diagnostic Yield of Double Balloon Enteroscopy in a Tertiary Care Setting: An Analysis of 527 Cases with Suspected Small Bowel Diseases (2008) (0)
- [HCV gene transfected animal using receptor mediated gene delivery]. (1995) (0)
- Intracellular signal transduction for HLA class I antigen expression induced by interferon (1991) (0)
- S1945 Novel PKA-Targeting Therapy Based On Cancer Stem Cell Biology (2009) (0)
- [Molecular physiopathology of viral hepatitis]. (2002) (0)
- Title Page / Table of Contents / Editorial Committee (2002) (0)
- Two-color flow cytometry of intraepatic lymphocyte subsets from patients with chronic hepatitis (1990) (0)
- [Transactivation function of X gene-cellular gene fusion product or 3' truncated pre S2/S gene-cellular gene fusion product from integrated hepatitis B virus DNA]. (1995) (0)
- [Immune therapy against hepatocellular carcinoma using gene-modified tumor cells]. (2001) (0)
- B型慢性肝疾患におけるHBウイルス(HBV)X蛋白・X抗体の検討 (1988) (0)
- [Natural history and treatment of type C hepatitis]. (1993) (0)
- Bcl-xL as a Critical Apoptosis Antagonist in Hepatocytes and Hepatocellular Carcinoma (2004) (0)
- [Two-step interferon rebound therapy for refractory chronic hepatitis C]. (2001) (0)
- Clinical Factors Influence Accurate Endosonographic Assessment with Miniprobe for Early Gastric Cancer (2009) (0)
- [Fas antigen expression and apoptosis in liver tissues of patients with chronic hepatitis B]. (1995) (0)
- Mutations within hepatocyte nuclear factor-4 binding site exhibit poor response to interferon therapy in patients with type B chronic hepatitis (1998) (0)
- Long-term follow up of HBeAg positive chronic hepatitis B treated with gamma and beta (1998) (0)
- Pretreatment viral load and response to prolonged chronic hepatitis C interferon-a course for (1995) (0)
- PARAQUAT-INDUCED DERANGEMENT OF THE UPPER GASTROINTESTINAL TRACTS-ENDOSCOPIC AND CLINICAL STUDY- (1987) (0)
- Involvement of Fas system-mediated cytotoxicity to liver cell injury by hepatitis virus B or C (1994) (0)
- Retinoic acid enhances susceptibility of human hepatoma cells to NK cell-mediated cytolysis via up-regulation of MICA (2002) (0)
- Lower Serum Adiponectin Increases the Risk of Endoscopic Gastritis Relevant to Excess Gastric Acid: An Epidemiologic Study of 2400 Japanese Subjects (2011) (0)
- Pretreatment serum HCV RNA levels with a branched DNA assay predict the efficacy of interferon treatment in genotype 1B patients with chronic hepatitis C, but not in 2A and 2B (1995) (0)
- Subject Index Vol. 50, 2007 (2007) (0)
- Interferon Treatment Not Only Reduces the Risk of Hepatocellular Carcinoma But Also Improves Mortality in Patients with Chronic Hepatitis C Showing Biochemical Response, Especially in Patients with Advanced Liver Fibrosis (2004) (0)
- [Progression of hepatic fibrosis observed by repeated liver biopsies in an adult case of COACH syndrome]. (2012) (0)
- Hepatitis C Virus Core Protein Differently Regulates the JAK-STAT Signaling Pathway under Interleukin-6 and Interferon-γ Stimuli Running title: HCV Core-Mediated Modulation of JAK-STAT Signaling Pathway (2003) (0)
- The polymorphism of HLA associates with the progression in type C chronic liver disease (1996) (0)
- [Perspective for the research of liver disease - from basic research to clinical research]. (2011) (0)
- T1424: Does Obesity Have an Adverse Impact on the Short-Term Outcomes and the Technical Difficulty of Endoscopic Submucosal Dissection (ESD) for the Patients With Early Gastric Cancer? (2010) (0)
- HCV RNA and antibody to HCV core protein in Japanese patients with chronic liver disease (1992) (0)
- 217 Hepatocyte-specific disruption of BCL-X leads to spontaneous and persistent hepatocyte apoptosis and liver fibrogenic response: in vivo evidence for the link between apoptosis and fibrosis (2003) (0)
- Expression of proto-oncogenes in liver tissue using Northern blotting (1987) (0)
- Apoptosis in Liver Disease 5. Apoptosis in Liver Disease (2007) (0)
- Cepstral analysis of ultrasound in chronic liver disease--a preliminary study in the non-invasive evaluation of structural change. (1991) (0)
- S1270 Plasma Adiponectin Levels in Patients with Infliximab Treatment for Steroid-Refractory Gastrointestinal Acute Graft-Versus-Host Disease (2008) (0)
- [Development of anti viral therapy for chronic hepatitis type C]. (2011) (0)
- Abstracts of Selected Papers Presented at the 76th General Meeting of the Japanese Society of Gastroenterology (1992) (0)
- 932 Long-term productive replication of hepatitis B virus (HBV) in the liver by single intravenous injection of naked HBV DNA in immunocompromised mice (2003) (0)
- Fourth International Symposium of the Japanese Society of Gastroenterology October 12–13, 1992, Utsunomiya, Japan (2007) (0)
- Hepatitis C Virus Core-Mediated Alteration of Gene Expression and Signal Transduction in the Host Cell (2003) (0)
- Expression of CD80 (B7/BB-1) in liver tissues of patients with chronic hepatitis C (1995) (0)
- Activation of phosphatidylinositol 3-kinase in hepatocyte growth and hepatocellular transformation (1995) (0)
- Apoptosis and internal medicine diseases. Liver diseases and apoptosis. (1997) (0)
- Cancer Vaccination by B7-1-Transfected Hepatocellular Carcinoma Cells (2000) (0)
- TGTAAAACGACGGCCAGTCCTCCTTCCTCTTCCCTGAG CAGGAAACAGCTATGACCGAGAGGGCTGTTCCTGGAG TGTAAAACGACGGCCAGTCTCAAAACTCTTCATCTAGACC CAGGAAACAGCTATGACCGTTTCAGTGGAAAACACACTC TGTAAAACGACGGCCAGTTGGGGAGAAAGTAAGCAGTG CAGGAAACAGCTATGACCTTATCTGAACATAGGAACATCTG TGTAAAACGACGGCCAGTCTCCAGAACCATCAGTACAGC CAGGAAACAGCTATGACCTAC (0)
- A CASE OF MULTIPLE FOCAL FATTY INFILTRATION SHOWING MULTIPLE TUMOROUS LESIONS OF THE LIVER ON COMPUTED TOMOGRAPHY (1993) (0)
- 877 IL-12 and IFNα gene therapy for hepatic metastasis of colon cancer: difference in generation of innate and adaptive immune responses (2003) (0)
- T1785 Restoration of Gut Motility in Kit-Deficient Mice By Bone Marrow Transplantation (2009) (0)
- [Impact of HLA polymorphism on asymptomatic HCV carriers]. (2004) (0)
- Study on the mechanism of liver cell injury in type B hepatitis. (1990) (0)
- Symposium on clinical aspects in hepatitis virus infection. 4. Topics of type C chronic liver disease. (2001) (0)
- F1-4 Fas system-mediated liver cell death in type C hepatitis (1995) (0)
- Abstracts of selected papers presented at the 29th annual meeting of the Japanese society of gastroenterology Kofu, Japan, November 5–7, 1987 (1988) (0)
- Selective Suppression of JV-Acetylglucosaminyltransferase III Activity in a Human Hepatoblastoma Cell Line Transfected with Hepatitis B Virus1 (2006) (0)
- Therapeutic Strategies for Hepatocellular Carcinoma Based on Analyses for Resistance to Apoptosis Mediated by Activation of Intracellular Signal Pathways (2001) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Norio Hayashi?
Norio Hayashi is affiliated with the following schools: