Paolo Magni
#164,735
Most Influential Person Now
Researcher
Paolo Magni's AcademicInfluence.com Rankings
Paolo Magnicomputer-science Degrees
Computer Science
#9785
World Rank
#10265
Historical Rank
Algorithms
#401
World Rank
#406
Historical Rank
Computational Linguistics
#2406
World Rank
#2430
Historical Rank
Machine Learning
#4376
World Rank
#4426
Historical Rank

Download Badge
Computer Science
Paolo Magni's Degrees
- PhD Computer Science University of Milan
Similar Degrees You Can Earn
Why Is Paolo Magni Influential?
(Suggest an Edit or Addition)Paolo Magni's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Waist circumference as a vital sign in clinical practice: a Consensus Statement from the IAS and ICCR Working Group on Visceral Obesity (2020) (528)
- Characterization of the potent luteinizing hormone-releasing activity of KiSS-1 peptide, the natural ligand of GPR54. (2005) (451)
- Visceral and ectopic fat, atherosclerosis, and cardiometabolic disease: a position statement. (2019) (449)
- Predictive Pharmacokinetic-Pharmacodynamic Modeling of Tumor Growth Kinetics in Xenograft Models after Administration of Anticancer Agents (2004) (431)
- A stabilizing model-based predictive control algorithm for nonlinear systems (2001) (348)
- Organic carbon content of sediments as an indicator of stress in the marine benthos (2005) (321)
- Screen-printed electrodes for environmental monitoring of heavy metal ions: a review (2016) (194)
- 2 month evening and night closed-loop glucose control in patients with type 1 diabetes under free-living conditions: a randomised crossover trial. (2015) (189)
- Leptin:Adiponectin Ratio Is an Independent Predictor of Intima Media Thickness of the Common Carotid Artery (2007) (186)
- The use of benthic indicators in Europe: from the Water Framework Directive to the Marine Strategy Framework Directive. (2010) (186)
- Ontogeny and mechanisms of action for the stimulatory effect of kisspeptin on gonadotropin-releasing hormone system of the rat (2006) (185)
- A Review of Mixed-Effects Models of Tumor Growth and Effects of Anticancer Drug Treatment Used in Population Analysis (2014) (141)
- Expression of a leptin receptor in immortalized gonadotropin-releasing hormone-secreting neurons. (1999) (141)
- Positive energy balance is associated with accelerated muscle atrophy and increased erythrocyte glutathione turnover during 5 wk of bed rest. (2008) (135)
- Dietary iron overload induces visceral adipose tissue insulin resistance. (2011) (131)
- Temporal data mining for the quality assessment of hemodialysis services (2005) (113)
- Seasonal and interannual patterns of intertidal microphytobenthos in combination with laboratory and areal production estimates (2003) (109)
- Liver fat accumulation is associated with circulating PCSK9 (2016) (107)
- Output feedback and tracking of nonlinear systems with model predictive control (2001) (104)
- Temporal scaling and relevance of bivalve nutrient excretion on a tidal flat of the Seto Inland Sea, Japan (2000) (104)
- Amino acid-dependent activation of liver estrogen receptor alpha integrates metabolic and reproductive functions via IGF-1. (2011) (103)
- Molecular aspects of adipokine-bone interactions. (2010) (97)
- Leptin: a possible link between food intake, energy expenditure, and reproductive function (2000) (96)
- Day-and-Night Closed-Loop Glucose Control in Patients With Type 1 Diabetes Under Free-Living Conditions: Results of a Single-Arm 1-Month Experience Compared With a Previously Reported Feasibility Study of Evening and Night at Home (2016) (95)
- Sediment grain size and organic carbon distribution in the Cabras lagoon (Sardinia, Western Mediterranean) (2004) (91)
- Genotoxicity biomarkers and acetylcholinesterase activity in natural populations of Mytilus galloprovincialis along a pollution gradient in the Gulf of Oristano (Sardinia, western Mediterranean). (2006) (85)
- A mathematical model to study the effects of drugs administration on tumor growth dynamics. (2006) (83)
- Suppressor of Cytokine Signaling-3 (SOCS-3) Induces Proprotein Convertase Subtilisin Kexin Type 9 (PCSK9) Expression in Hepatic HepG2 Cell Line* (2015) (82)
- Distribution and ecological relevance of fine sediments in organic-enriched lagoons: the case study of the Cabras lagoon (Sardinia, Italy). (2008) (82)
- The natural antioxidant alpha-lipoic acid induces p27(Kip1)-dependent cell cycle arrest and apoptosis in MCF-7 human breast cancer cells. (2010) (79)
- Intelligent analysis of clinical time series: an application in the diabetes mellitus domain (2000) (79)
- GC-MS profiling of the phytochemical constituents of the oleoresin from Copaifera langsdorffii Desf. and a preliminary in vivo evaluation of its antipsoriatic effect. (2013) (78)
- Nutraceutical approach to moderate cardiometabolic risk: results of a randomized, double-blind and crossover study with Armolipid Plus. (2014) (76)
- Diverse effects of invasive ecosystem engineers on marine biodiversity and ecosystem functions: A global review and meta‐analysis (2018) (74)
- Integrating model-based decision support in a multi-modal reasoning system for managing type 1 diabetic patients (2003) (73)
- Free and bound plasma leptin in normal weight and obese men and women: relationship with body composition, resting energy expenditure, insulin‐sensitivity, lipid profile and macronutrient preference (2005) (72)
- Dispersion measurement by the single introduction method coupled with the back-sorption procedure: A chemisorption and TPD study of the different chemisorbed hydrogen species: I. Pt, Ru, and Rh on Alumina (1994) (72)
- Animal-sediment relationships: evaluating the 'Pearson-Rosenberg paradigm' in Mediterranean coastal lagoons. (2009) (71)
- A hierarchical Naïve Bayes Model for handling sample heterogeneity in classification problems: an application to tissue microarrays (2006) (71)
- On the Myths of Indicator Species: Issues and Further Consideration in the Use of Static Concepts for Ecological Applications (2013) (70)
- Activation of the Y1 receptor by neuropeptide Y regulates the growth of prostate cancer cells. (2006) (70)
- Risk identification and possible countermeasures for muscle adverse effects during statin therapy. (2015) (70)
- Biogeochemical indicators as tools for assessing sediment quality/vulnerability in transitional aquatic ecosystems (2004) (68)
- Effect of fenretinide and low-dose tamoxifen on insulin sensitivity in premenopausal women at high risk for breast cancer. (2008) (68)
- Sediment features, macrozoobenthic assemblages and trophic relationships (delta13C and delta15N analysis) following a dystrophic event with anoxia and sulphide development in the Santa Giusta lagoon (western Sardinia, Italy). (2008) (67)
- Circulating Levels of Proprotein Convertase Subtilisin/Kexin Type 9 and Arterial Stiffness in a Large Population Sample: Data From the Brisighella Heart Study (2017) (67)
- Prognostic effect of circulating adiponectin in a randomized 2 x 2 trial of low-dose tamoxifen and fenretinide in premenopausal women at risk for breast cancer. (2012) (67)
- Parthenolide Inhibits the LPS‐induced Secretion of IL‐6 and TNF‐α and NF‐κB Nuclear Translocation in BV‐2 Microglia (2012) (66)
- Temporal changes of a macrobenthic assemblage in harsh lagoon sediments (2009) (64)
- The i148m Pnpla3 polymorphism influences serum adiponectin in patients with fatty liver and healthy controls (2012) (62)
- Hormonal control of the neuropeptide Y system. (2003) (62)
- Characterization of exopolysaccharides produced by seven biofilm-forming cyanobacterial strains for biotechnological applications (2013) (61)
- Sediment characteristics and macrofauna distribution along a human-modified inlet in the Gulf of Oristano (Sardinia, Italy). (2007) (60)
- Relationships between hydrodynamic parameters and grain size in two contrasting transitional environments: the Lagoons of Venice and Cabras, Italy. (2009) (60)
- Twelve years after the first report of the crab Percnon gibbesi (H. Milne Edwards, 1853) in the Mediterranean: current distribution and invasion rates (2011) (59)
- Bayesian Function Learning Using MCMC Methods (1998) (59)
- Relationships Between Chemical Characteristics of Sediments and Macrofaunal Communities in the Cabras Lagoon (Western Mediterranean, Italy) (2005) (59)
- Comparative analysis of macrofaunal species richness and composition in Posidonia oceanica, Cymodocea nodosa and leaf litter beds (2008) (58)
- Minimal model S(I)=0 problem in NIDDM subjects: nonzero Bayesian estimates with credible confidence intervals. (2002) (57)
- Deciding when to intervene: a Markov decision process approach (2000) (57)
- Cow’s Milk Consumption and Health: A Health Professional’s Guide (2018) (55)
- The effect of a tidal cycle on the dynamics of nutrients in a tidal estuary in the Seto Inland Sea, Japan (1998) (54)
- Perspective: Improving Nutritional Guidelines for Sustainable Health Policies: Current Status and Perspectives (2017) (54)
- Circulating ghrelin level is increased in coeliac disease as in functional dyspepsia and reverts to normal during gluten‐free diet (2006) (54)
- Spatial distribution of trace metals (Cd, Pb, Hg, Cu, Zn, Fe and Mn) and oligo-elements (Mg, Ca, Na and K) in surface sediments of the Gulf of Tunis (Northern Tunisia) (2010) (53)
- A metabolic scope based model of fish response to environmental changes (2012) (53)
- Practical guidance for combination lipid-modifying therapy in high- and very-high-risk patients: A statement from a European Atherosclerosis Society Task Force. (2021) (52)
- Relevance of the neuropeptide Y system in the biology of cancer progression. (2007) (52)
- Seasonal patterns of pore-water nutrients, benthic chlorophyll a and sedimentary AVS in a macrobenthos-rich tidal flat (2006) (52)
- Statin therapy and related risk of new-onset type 2 diabetes mellitus. (2014) (51)
- Is ghrelin a signal of decreased fat-free mass in elderly subjects? (2006) (51)
- Phaseolus vulgaris extract affects glycometabolic and appetite control in healthy human subjects (2012) (50)
- The dopamine-somatostatin chimeric compound BIM-23A760 exerts antiproliferative and cytotoxic effects in human non-functioning pituitary tumors by activating ERK1/2 and p38 pathways. (2010) (50)
- TimeClust: a clustering tool for gene expression time series (2008) (50)
- Expression of neuropeptide Y receptors in human prostate cancer cells. (2001) (49)
- Saprobity: a unified view of benthic succession models for coastal lagoons (2012) (48)
- Feeding Behavior in Mammals Including Humans (2009) (48)
- Impaired Expression of Insulin-Like Growth Factor-1 System in Skeletal Muscle of Amyotrophic Lateral Sclerosis Patients (2012) (47)
- A stochastic model to assess the variability of blood glucose time series in diabetic patients self-monitoring (2006) (46)
- Proprotein convertase subtilisin kexin type 9 and high-density lipoprotein metabolism: experimental animal models and clinical evidence. (2016) (46)
- Integration of enzymatic data in Bacillus subtilis genome-scale metabolic model improves phenotype predictions and enables in silico design of poly-γ-glutamic acid production strains (2019) (45)
- Effect of soy on metabolic syndrome and cardiovascular risk factors: a randomized controlled trial (2018) (45)
- Cobalamin (vitamin B12) positively regulates interleukin-6 levels in rat cerebrospinal fluid (2002) (44)
- Biological benthic tools as indicators of coastal marine ecosystems health (2003) (44)
- Short term effects of hypoxia and bioturbation on solute fluxes, denitrification and buffering capacity in a shallow dystrophic pond (2009) (43)
- Macrofaunal community structure and distribution in a muddy coastal lagoon (2004) (41)
- Plasma Concentrations of the Enantiomers of Fluoxetine and Norfluoxetine: Sources of Variability and Preliminary Observations on Relations With Clinical Response (2002) (41)
- Modeling of human tumor xenografts and dose rationale in oncology. (2013) (39)
- Nutraceutical approach for the management of cardiovascular risk – a combination containing the probiotic Bifidobacterium longum BB536 and red yeast rice extract: results from a randomized, double-blind, placebo-controlled study (2019) (38)
- Predictive pharmacokinetic–pharmacodynamic modeling of tumor growth after administration of an anti-angiogenic agent, bevacizumab, as single-agent and combination therapy in tumor xenografts (2013) (38)
- Interlinked temporal changes in environmental conditions, chemical characteristics of sediments and macrofaunal assemblages in an estuarine intertidal sandflat (Seto Inland Sea, Japan) (2006) (38)
- Pharmacometrics Markup Language (PharmML): Opening New Perspectives for Model Exchange in Drug Development (2015) (38)
- Semidiurnal Dynamics of Salinity, Nutrients and Suspended Particulate Matter in an Estuary in the Seto Inland Sea, Japan, during a Spring Tide Cycle (2002) (38)
- Fermentation of lactose to ethanol in cheese whey permeate and concentrated permeate by engineered Escherichia coli (2017) (37)
- Somatostatin and dopamine receptor interaction in prostate and lung cancer cell lines. (2010) (36)
- Testing additivity of anticancer agents in pre-clinical studies: a PK/PD modelling approach. (2009) (36)
- Low-intermediate dose testosterone replacement therapy by different pharmaceutical preparations improves frailty score in elderly hypogonadal hyperglycaemic patients (2013) (36)
- Somatostatin, somatostatin analogs and somatostatin receptor dynamics in the biology of cancer progression. (2013) (36)
- Forskolin and phorbol ester stimulation of neuropeptide Y (NPY) production and secretion by aggregating fetal brain cells in culture: evidence for regulation of NPY biosynthesis at transcriptional and posttranscriptional levels. (1992) (35)
- Leukemia inhibitory factor induces the chemomigration of immortalized gonadotropin-releasing hormone neurons through the independent activation of the Janus kinase/signal transducer and activator of transcription 3, mitogen-activated protein kinase/extracellularly regulated kinase 1/2, and phosphati (2007) (34)
- Comprehensive two-dimensional gas chromatography using large sample volume injection for the determination of polynuclear aromatic hydrocarbons in complex matrices. (2003) (34)
- A predictive pharmacokinetic–pharmacodynamic model of tumor growth kinetics in xenograft mice after administration of anticancer agents given in combination (2013) (34)
- Antipsychotic prescription patterns in Xhosa patients with schizophrenia or schizoaffective disorder. (2008) (34)
- Characterization of an inducible promoter in different DNA copy number conditions (2012) (34)
- The effect of hydrodynamics on shell orientation and population density of Pinna nobilis in the Gulf of Oristano (Sardinia, Italy) (2013) (33)
- Bottom-Up Engineering of Biological Systems through Standard Bricks: A Modularity Study on Basic Parts and Devices (2012) (31)
- Bayesian analysis of blood glucose time series from diabetes home monitoring (2000) (31)
- Regulation of prostate cancer cell proliferation by somatostatin receptor activation (2010) (31)
- Multiplexing and demultiplexing logic functions for computing signal processing tasks in synthetic biology. (2011) (31)
- Characterization of a synthetic bacterial self-destruction device for programmed cell death and for recombinant proteins release (2011) (31)
- Role of neuropeptide Y and its receptors in the progression of endocrine-related cancer (2007) (30)
- Osteocalcin as a potential risk biomarker for cardiovascular and metabolic diseases (2016) (30)
- A Minimal Model of Tumor Growth Inhibition (2008) (29)
- A standard vector for the chromosomal integration and characterization of BioBrick™ parts in Escherichia coli (2013) (29)
- Concurrent solvent recondensation large sample volume splitless injection (2003) (29)
- Retinoic acid negatively regulates neuropeptide Y expression in human neuroblastoma cells (2000) (29)
- Half-life measurements of chemical inducers for recombinant gene expression (2014) (28)
- Leptin, ciliary neurotrophic factor, leukemia inhibitory factor and interleukin-6: class-I cytokines involved in the neuroendocrine regulation of the reproductive function. (2009) (28)
- Phytoplankton dynamics in relation to environmental changes in a phytoplankton-dominated Mediterranean lagoon (Cabras Lagoon, Italy) (2012) (28)
- Density and distribution of Patella ferruginea in a Marine Protected Area (western Sardinia, Italy): Constraint analysis for population conservation (2012) (28)
- Dexamethasone-induced accumulation of neuropeptide-Y by aggregating fetal brain cells in culture: a process dependent on the developmental age of the aggregates. (1991) (28)
- Is the establishment of MPAs enough to preserve endangered intertidal species? The case of Patella ferruginea in Mal di Ventre Island (W Sardinia, Italy) (2016) (27)
- Integrating Different Methodologies for Insulin Therapy Support in Type 1 Diabetic Patients (2001) (27)
- Hepatic steatosis and PNPLA3 I148M variant are associated with serum Fetuin‐A independently of insulin resistance (2014) (27)
- Testing the saprobity hypothesis in a Mediterranean lagoon: effects of confinement and organic enrichment on benthic communities. (2014) (27)
- TA-clustering: Cluster analysis of gene expression profiles through Temporal Abstractions (2005) (26)
- Mouse embryonic stem cells that survive γ‐rays exposure maintain pluripotent differentiation potential and genome stability (2012) (26)
- Mining biomedical time series by combining structural analysis and temporal abstractions (1998) (25)
- Patterns of seasonal variation in lagoonal macrozoobenthic assemblages (Mellah lagoon, Algeria). (2015) (25)
- GC instrumentation for on‐column injection of large volumes: Automated optimization of conditions (1995) (25)
- High Density Lipoproteins Inhibit Oxidative Stress-Induced Prostate Cancer Cell Proliferation (2016) (25)
- A Multidisciplinary and Ecosystemic Approach in the Oristano Lagoon-Gulf System (Sardinia, Italy) as a Tool in Management Plans (2008) (25)
- Palm oil and human health. Meeting report of NFI: Nutrition Foundation of Italy symposium (2017) (25)
- Cholinergic muscarinic mechanisms regulate neuropeptide Y gene expression via protein kinase C in human neuroblastoma cells (1998) (24)
- Intelligent Analysis of Clinical Time Series by Combining Structural Filtering and Temporal Abstractions (1999) (23)
- Plasma nerve growth factor (NGF) and inflammatory cytokines (IL-6 and MCP-1) in young and adult subjects with Down syndrome: an interesting pathway. (2006) (23)
- A model-based approach to the in vitro evaluation of anticancer activity (2009) (23)
- dCas9 regulator to neutralize competition in CRISPRi circuits (2020) (22)
- Nonparametric AUC Estimation in Population Studies with Incomplete Sampling: A Bayesian Approach (2002) (22)
- Free insulin‐like growth factor (IGF)‐1 and IGF‐binding proteins‐2 and ‐3 in serum and cerebrospinal fluid of amyotrophic lateral sclerosis patients (2010) (22)
- Theranostic Nanocages for Imaging and Photothermal Therapy of Prostate Cancer Cells by Active Targeting of Neuropeptide-Y Receptor. (2016) (21)
- Water chemistry variability in the lower intertidal zone [-2pt] of an estuary in the Seto Inland Sea, Japan: seasonal patterns of nutrients and particulate compounds (2000) (21)
- Reduced sampling schedule for the glucose minimal model: importance of Bayesian estimation. (2006) (20)
- Effects of a lupin protein concentrate on lipids, blood pressure and insulin resistance in moderately dyslipidaemic patients : a randomised controlled trial (2017) (20)
- Gender-related lipid and/or lipoprotein responses to statins in subjects in primary and secondary prevention. (2015) (20)
- Multi-Faceted Characterization of a Novel LuxR-Repressible Promoter Library for Escherichia coli (2015) (20)
- Current mathematical models for cancer drug discovery (2017) (20)
- Three Thiamine Analogues Differently Alter Thiamine Transport and Metabolism in Nervous Tissue: An In Vivo Kinetic Study Using Rats (2003) (19)
- DT-Planner: an environment for managing dynamic decision problems. (1997) (18)
- Leptin, Resistin, and Proprotein Convertase Subtilisin/Kexin Type 9 (2020) (18)
- Serum irisin is upregulated in patients affected by amyotrophic lateral sclerosis and correlates with functional and metabolic status (2018) (18)
- Free and bound leptin in prepubertal children with Down's syndrome and different degrees of adiposity (2004) (18)
- Spatial variations in δ13c and δ15n values of primary consumers in a coastal lagoon (2012) (18)
- Regulated production and secretion of immunoreactive neuropeptide Y by aggregating fetal brain cells in cultures. (1991) (18)
- White Paper: Landscape on Technical and Conceptual Requirements and Competence Framework in Drug/Disease Modeling and Simulation (2013) (17)
- Dissolved organic matter dynamics in Mediterranean lagoons: The relationship between DOC and CDOM (2018) (17)
- Characterization and sub-cellular localization of SS1R, SS2R, and SS5R in human late-stage prostate cancer cells: Effect of mono- and bi-specific somatostatin analogs on cell growth (2014) (17)
- Bayesian Identification of a Population Compartmental Model of C-Peptide Kinetics (2000) (17)
- Multifactorial Activation of NLRP3 Inflammasome: Relevance for a Precision Approach to Atherosclerotic Cardiovascular Risk and Disease (2020) (17)
- Learning Rules with Complex Temporal Patterns in Biomedical Domains (2005) (17)
- Inferring gene regulatory networks by integrating static and dynamic data (2007) (16)
- Precedence Temporal Networks to represent temporal relationships in gene expression data (2007) (16)
- Reduction of Cardio-Metabolic Risk and Body Weight through a Multiphasic Very-Low Calorie Ketogenic Diet Program in Women with Overweight/Obesity: A Study in a Real-World Setting (2021) (16)
- BDNF Serum Levels with Respect to Multidimensional Assessment in Amyotrophic Lateral Sclerosis (2016) (16)
- Unsaponifiable Fraction of Unripe Fruits of Olea europaea: An Interesting Source of Anti-inflammatory Constituents (2015) (16)
- Modulatory actions of neuropeptide Y on prostate cancer growth: role of MAP kinase/ERK 1/2 activation. (2007) (16)
- Changes in stress hormones and metabolism during a 105-day simulated Mars mission. (2014) (16)
- Adiponectin interactions in bone and cartilage biology and disease. (2012) (16)
- Effects of Zostera marina on the patterns of spatial distribution of sediments and macrozoobenthos in the boreal lagoon of Furen (Hokkaido, Japan). (2017) (16)
- Adipokine actions on cartilage homeostasis. (2011) (16)
- Sex hormones and adipokines in healthy pre-menopausal, post-menopausal and elderly women, and in age-matched men: Data from the Brisighella Heart Study (2011) (15)
- Using uncertainty management techniques in medical therapy planning: A decision-theoretic approach (1998) (15)
- Plasma adiponectin and leptin concentrations in professional rugby players. (2010) (15)
- Accurate peak list extraction from proteomic mass spectra for identification and profiling studies (2010) (15)
- Geographic patterns of biodiversity in European coastal marine benthos (2016) (15)
- The two tryptophans of β2-microglobulin have distinct roles in function and folding and might represent two independent responses to evolutionary pressure (2011) (14)
- Review of pH sensing materials from macro- to nano-scale: Recent developments and examples of seawater applications (2020) (14)
- Random Walk Models for Bayesian Clustering of Gene Expression Profiles (2005) (14)
- Iron overload induces hypogonadism in male mice via extrahypothalamic mechanisms (2017) (14)
- Insulin Minimal Model Indexes and Secretion: Proper Handling of Uncertainty by a Bayesian Approach (2004) (14)
- Plasma PCSK9 levels and lipoprotein distribution are preserved in carriers of genetic HDL disorders. (2018) (14)
- Free and bound plasma leptin in anorexia nervosa patients during a refeeding program (2016) (14)
- Accounting for inter-correlation between enzyme abundance: a simulation study to assess implications on global sensitivity analysis within physiologically-based pharmacokinetics (2019) (14)
- Model Description Language (MDL): A Standard for Modeling and Simulation (2017) (14)
- Irisin and BDNF serum levels and behavioral disturbances in Alzheimer’s disease (2019) (13)
- An early and transient period of protein synthesis is required for induction of neuropeptide Y-mRNA by phorbol ester and forskolin in aggregate cultures of fetal brain cells (1993) (13)
- Body composition and metabolic changes during a 520-day mission simulation to Mars (2018) (13)
- Antiproliferative activity on human prostate carcinoma cell lines of new peptidomimetics containing the spiroazepinoindolinone scaffold. (2013) (13)
- Dynamic Probabilistic Networks for Modelling and Identifying Dynamic Systems: a MCMC Approach (1997) (13)
- Temporal Variation in the Trophic Levels of Secondary Consumers in a Mediterranean Coastal Lagoon (Cabras Lagoon, Italy) (2017) (13)
- Consistent patterns of spatial variability between NE Atlantic and Mediterranean rocky shores (2016) (13)
- Population dynamics and secondary production of Donax trunculus (Mollusca, Bivalvia) in the Gulf of Annaba (Northeast Algeria) (2016) (13)
- Adipokines and Sexual Hormones Associated with the Components of the Metabolic Syndrome in Pharmacologically Untreated Subjects: Data from the Brisighella Heart Study (2011) (12)
- Spatiotemporal variation in environmental features and elemental/isotopic composition of organic matter sources and primary producers in the Yundang Lagoon (Xiamen, China) (2019) (12)
- Expression of Functional Ciliary Neurotrophic Factor Receptors in Immortalized Gonadotrophin‐Releasing Hormone‐Secreting Neurones (2005) (12)
- LEPTIN, RESISTIN, AND PCSK9 - THE ROLE OF STAT3. (2020) (12)
- Oxidative Stress Modulation by Cameroonian Spice Extracts in HepG2 Cells: Involvement of Nrf2 and Improvement of Glucose Uptake (2020) (12)
- Metabolic Syndrome, Adipokines and Hormonal Factors in Pharmacologically Untreated Adult Elderly Subjects from the Brisighella Heart Study Historical Cohort (2012) (12)
- Pharmacokinetic/pharmacodynamic modeling of etoposide tumor growth inhibitory effect in Walker‐256 tumor‐bearing rat model using free intratumoral drug concentrations (2017) (12)
- Adherence to the Mediterranean Diet: Impact of Geographical Location of the Observations (2022) (12)
- δ13C and δ15N variations in organic matter pools, Mytilus spp. and Macoma balthica along the European Atlantic coast (2013) (12)
- A Perl procedure for protein identification by Peptide Mass Fingerprinting (2009) (12)
- Analysis of amplicon-based NGS data from neurological disease gene panels: a new method for allele drop-out management (2016) (11)
- Hydroethanolic plant extracts from Cameroon positively modulate enzymes relevant to carbohydrate/lipid digestion and cardio-metabolic diseases. (2019) (11)
- Dietary Cameroonian Plants Exhibit Anti-Inflammatory Activity in Human Gastric Epithelial Cells (2020) (11)
- Experimental measurements and mathematical modeling of biological noise arising from transcriptional and translational regulation of basic synthetic gene circuits. (2016) (11)
- Temporal changes of a food web structure driven by different primary producers in a subtropical eutrophic lagoon. (2020) (11)
- GABA-B1 Receptor-Null Schwann Cells Exhibit Compromised In Vitro Myelination (2018) (11)
- Hydromethanolic Extracts from Adansonia digitata L. Edible Parts Positively Modulate Pathophysiological Mechanisms Related to the Metabolic Syndrome (2020) (11)
- BDNF Val66Met polymorphism alters food intake and hypothalamic BDNF expression in mice (2020) (11)
- Variance based global sensitivity analysis of physiologically based pharmacokinetic absorption models for BCS I–IV drugs (2018) (10)
- Essence of the patterns of cover and richness of intertidal hard bottom communities: a pan-European study (2016) (10)
- Quality Assessment of Hemodialysis Services through Temporal Data Mining (2003) (10)
- Disentangling heterogeneity and commonalities in nanotidal Mediterranean lagoons through environmental features and macrozoobenthic assemblages (2020) (10)
- Anti-Müllerian Hormone, Growth Hormone, and Insulin-Like Growth Factor 1 Modulate the Migratory and Secretory Patterns of GnRH Neurons (2021) (10)
- Assessing the impact of the Asian mussel Arcuatula senhousia in the recently invaded Oristano Lagoon-Gulf System (W Sardinia, Italy) (2015) (10)
- Interlinked temporal changes in environmental conditions, chemical characteristics of sediments and macrofaunal assemblages in an estuarine intertidal sandflat (Seto Inland Sea, Japan) (2006) (10)
- A machine learning approach based on ACMG/AMP guidelines for genomic variant classification and prioritization (2022) (10)
- The role of physical variables in biodiversity patterns of intertidal macroalgae along European coasts (2016) (10)
- Total, free and bound leptin and thyroid function in elderly women with different body weights (2008) (10)
- Improving Dialysis Services through Information Technology: From Telemedicine to Data Mining (2001) (10)
- Temporal distribution of intertidal macrozoobenthic assemblages in a Nanozostera noltii-dominated area (Lagoon of Venice). (2016) (10)
- Suppressor of Cytokine Signaling-3 ( SOCS-3 ) induces Proprotein Convertase Subtilisin Kexin Type 9 ( PCSK 9 ) expression in hepatic HepG 2 cell line * (2015) (10)
- A New Approach for the Analysis of Mass Spectrometry Data for Biomarker Discovery (2006) (9)
- Trophic Features, Benthic Recovery, and Dominance of the Invasive Mytilopsis Sallei in the Yundang Lagoon (Xiamen, China) Following Long-Term Restoration (2019) (9)
- Inflammaging and neurodegenerative diseases: Role of NLRP3 inflammasome activation in brain atherosclerotic vascular disease (2021) (9)
- Aldosterone receptor antagonists: Biology and novel therapeutic applications (2005) (9)
- Modeling tumor growth inhibition and toxicity outcome after administration of anticancer agents in xenograft mice: A Dynamic Energy Budget (DEB) approach. (2018) (9)
- Model‐Based Assessment of Alternative Study Designs in Pediatric Trials. Part II: Bayesian Approaches (2016) (9)
- A procedure to decompose high resolution mass spectra (2007) (9)
- Role of the energy sensor adenosine monophosphate-activated protein kinase in the regulation of immature gonadotropinreleasing hormone neuron migration (2011) (9)
- 1280 DIETARY IRON OVERLOAD INDUCES VISCERAL ADIPOSE TISSUE INSULIN RESISTANCE ASSOCIATED WITH HYPER-RESISTINEMIA, AND SYNERGIZES WITH OBESITY AND FATTY LIVER IN INDUCING SYSTEMIC INSULIN RESISTANCE (2011) (9)
- Compartmental model identification based on an empirical Bayesian approach: The case of thiamine kinetics in rats (2001) (9)
- A Synthetic Close-Loop Controller Circuit for the Regulation of an Extracellular Molecule by Engineered Bacteria (2019) (8)
- Meiofaunal Dynamics and Heterogeneity along Salinity and Trophic Gradients in a Mediterranean Transitional System (2019) (8)
- In vitro cell growth pharmacodynamic studies: a new nonparametric approach to determining the relative importance of drug concentration and treatment time (2003) (8)
- Optimal Design for Informative Protocols in Xenograft Tumor Growth Inhibition Experiments in Mice (2016) (8)
- Leptin actions on the reproductive axis. (2001) (8)
- Laboratory Experiments on Bivalve Excretion Rates of Nutrients (2005) (8)
- MAMA—Towards a new paradigm for ocean monitoring in the Mediterranean (2003) (8)
- Interactions of Oxysterols with Atherosclerosis Biomarkers in Subjects with Moderate Hypercholesterolemia and Effects of a Nutraceutical Combination (Bifidobacterium longum BB536, Red Yeast Rice Extract) (Randomized, Double-Blind, Placebo-Controlled Study) (2021) (8)
- Bicuspid aortic valve, atherosclerosis and changes of lipid metabolism: Are there pathological molecular links? (2019) (8)
- Integrative Analysis of Multi-Omics and Genetic Approaches—A New Level in Atherosclerotic Cardiovascular Risk Prediction (2021) (8)
- A Bioinformatics Approach to Explore MicroRNAs as Tools to Bridge Pathways Between Plants and Animals. Is DNA Damage Response (DDR) a Potential Target Process? (2019) (8)
- Population Pharmacokinetic Modeling of Etoposide Free Concentrations in Solid Tumor (2016) (8)
- Model‐Based Assessment of Alternative Study Designs in Pediatric Trials. Part I: Frequentist Approaches (2016) (7)
- Building in-house PBPK modelling tools for oral drug administration from literature information (2019) (7)
- Quantification of the gene silencing performances of rationally-designed synthetic small RNAs (2015) (7)
- Contribution of binge eating behaviour to cardiometabolic risk factors in subjects starting a weight loss or maintenance programme (2016) (7)
- Re-using biological devices: a model-aided analysis of interconnected transcriptional cascades designed from the bottom-up (2017) (7)
- Hypothalamic neuropeptide systems as targets for potential anti-obesity drugs. (2007) (7)
- Joint analysis of macrofaunal and meiofaunal assemblages improves the assessment of lagoonal environmental heterogeneity (2022) (7)
- A Minimal Model of Tumor Growth Inhibition in Combination Regimens Under the Hypothesis of No Interaction Between Drugs (2012) (7)
- Application of Artificial Neural Networks to Predict the Intrinsic Solubility of Drug-Like Molecules (2021) (7)
- In Vitro Chronic Administration of ERbeta Selective Ligands and Prostate Cancer Cell Growth: Hypotheses on the Selective Role of 3beta-Adiol in AR-Positive RV1 Cells (2014) (7)
- A Population Dynamic Energy Budget-Based Tumor Growth Inhibition Model for Etoposide Effects on Wistar Rats (2019) (7)
- TGI-Simulator: A visual tool to support the preclinical phase of the drug discovery process by assessing in silico the effect of an anticancer drug (2012) (7)
- Erratum to “The natural antioxidant alpha-lipoic acid induces p27Kip1-dependent cell cycle arrest and apoptosis in MCF-7 human breast cancer cells” [Eur. J. Pharmacol. 641 (2010) 29-34] (2011) (7)
- A tumor-in-host DEB-based approach for modeling cachexia and bevacizumab resistance. (2019) (7)
- Impact of Soy β-Conglycinin Peptides on PCSK9 Protein Expression in HepG2 Cells (2021) (6)
- Nutraceuticals for Dyslipidaemia and Glucometabolic Diseases: What the Guidelines Tell Us (and Do Not Tell, Yet) (2022) (6)
- Influence of the level of oxygenation in sediment and water on copper bioavailability to marine bivalves: laboratory experiments and translocation experiments in the field (1998) (6)
- Increased circulating adiponectin in males with chronic HCV hepatitis. (2015) (6)
- Mathematical modeling of efficacy and safety for anticancer drugs clinical development (2018) (6)
- Hydroethanolic Extract of Prunus domestica L.: Metabolite Profiling and In Vitro Modulation of Molecular Mechanisms Associated to Cardiometabolic Diseases (2022) (6)
- Cameroonian Spice Extracts Modulate Molecular Mechanisms Relevant to Cardiometabolic Diseases in SW 872 Human Liposarcoma Cells (2021) (6)
- Inter-compound and Intra-compound Global Sensitivity Analysis of a Physiological Model for Pulmonary Absorption of Inhaled Compounds (2020) (6)
- A generic framework to assess the representation and protection of benthic ecosystems in European marine protected areas (2020) (6)
- Engineering endogenous fermentative routes in ethanologenic Escherichia coli W for bioethanol production from concentrated whey permeate. (2020) (6)
- Microphytobenthic biomass, diversity and exopolymeric substances ina shallow dystrophic coastal lagoon (2018) (6)
- New cost-effective, interoperable sensors tested on existing ocean observing platforms in application of European directives: The COMMON SENSE European project (2015) (5)
- A new approach to optimal dynamic therapy planning (1998) (5)
- A Dynamic Energy Budget (DEB) based modeling framework to describe tumor-in-host growth inhibition and cachexia onset during anticancer treatment in in vivo xenograft studies (2021) (5)
- Modelling the effects of cell-to-cell variability on the output of interconnected gene networks in bacterial populations (2015) (5)
- The zebrafish model system for dyslipidemia and atherosclerosis research: Focus on environmental/exposome factors and genetic mechanisms. (2022) (5)
- Interlinked seasonal variation in biogenic nutrient fluxes and pore-water nutrient concentrations in intertidal sediments (2014) (5)
- A BioBrick™-Compatible Vector for Allelic Replacement Using the XylE Gene as Selection Marker (2016) (4)
- Electronic conference on 'The Southern and Eastern Mediterranean Sea and the Black Sea: new challenges for marine biodiversity research and monitoring': summary of discussions, 6 to 24 September, 2004 (2004) (4)
- Cholinergic regulation of neuropeptide Y synthesis and release in human neuroblastoma cells (2008) (4)
- Correction: Bottom-Up Engineering of Biological Systems through Standard Bricks: A Modularity Study on Basic Parts and Devices (2012) (4)
- Aldosterone receptor antagonists: Biology and novel therapeutical applications (2003) (4)
- In Vitro–In Vivo Correlation (IVIVC) Population Modeling for the In Silico Bioequivalence of a Long-Acting Release Formulation of Progesterone (2021) (4)
- Modeling restoration of gefitinib efficacy by co‐administration of MET inhibitors in an EGFR inhibitor‐resistant NSCLC xenograft model: A tumor‐in‐host DEB‐based approach (2021) (4)
- Mechanistic Models of Inducible Synthetic Circuits for Joint Description of DNA Copy Number, Regulatory Protein Level, and Cell Load (2019) (4)
- Space Flight-Promoted Insulin Resistance as a Possible Disruptor of Wound Healing (2022) (4)
- Methods for genetic optimization of biocatalysts for biofuel production from dairy waste through synthetic biology (2015) (4)
- Leptin Actions on the Reproductive Axis (2003) (4)
- Polyphenol-Rich Extracts of Xylopia and Aframomum Species Show Metabolic Benefits by Lowering Hepatic Lipid Accumulation in Diet-Induced Obese Mice (2022) (4)
- Osteocalcin-expressing endothelial progenitor cells and serum osteocalcin forms are independent biomarkers of coronary atherosclerotic disease severity in male and female patients (2022) (3)
- Use of prior knowledge and extrapolation in paediatric drug development: A case study with deferasirox. (2019) (3)
- Analysing Italian voluntary abortion data using a Bayesian approach to the time series decomposition (2004) (3)
- Precedence temporal networks from gene expression data (2005) (3)
- A multidisciplinary study on the dynamics of biophilic elements in a tidal estuary in the Seto Inland Sea, Japan (1998) (3)
- Effects of an invasive mussel, Arcuatula senhousia, on local benthic consumers: a laboratory 13C‐labeling study (2016) (3)
- Ethambutol disposition in humans: challenges and limitations of whole-body physiologically-based pharmacokinetic modelling in early drug development. (2020) (3)
- Indicators of Stress in the Marine Benthos: Proceedings of an International workshop on the promotion and use of benthic tools for assessing the health of coastal marine ecosystems, Torregrande-Oristano, Italy 8-9 October 2004 (2005) (3)
- Inferring gene expression networks via static and dynamic data integration (2006) (3)
- Adiponectin in nonalcoholic fatty liver disease : correlation with liver damage and PNPLA3 genotype (2011) (3)
- Clinical practice gaps and challenges in non‐alcoholic steatohepatitis care: An international physician needs assessment (2022) (3)
- Gibbs Sampling for Signal Reconstruction (1997) (3)
- Modeling approaches for reducing safety-related attrition in drug discovery and development: a review on myelotoxicity, immunotoxicity, cardiovascular toxicity, and liver toxicity (2021) (3)
- 5 – Parameter Estimation (2014) (3)
- Mathematical modeling of growth and death dynamics of mouse embryonic stem cells irradiated with γ-rays. (2014) (3)
- 23 – Modelling for Synthetic Biology (2014) (3)
- indexes? of glucose effectiveness and insulin sensitivity The hot IVGTT two-compartment minimal model: (2011) (2)
- Complex Bayesian Modeling Workflows Encoding and Execution Made Easy With a Novel WinBUGS Plugin of the Drug Disease Model Resources Interoperability Framework (2018) (2)
- Pro-inflammatory cytokines and adipokines regulate PCSK9 expression in HepG2 cells (2017) (2)
- Physical and Chemical Variability of Tidal Streams (2005) (2)
- Temporal Scaling of Benthic Nutrient Regeneration in Bivalve-Dominated Tidal Flat (2005) (2)
- Hierarchical Naive Bayes Classifiers for uncertain data ? (2006) (2)
- Characterisation of individual ferritin response in patients receiving chelation therapy (2022) (2)
- Translational model-based approach to assist the dose-range selection of an antibody-drug conjugate entering Phase I (2017) (2)
- Clustering gene expression data with Temporal Abstractions (2004) (2)
- Prediction of the Effect of Renal Impairment on the Pharmacokinetics of New Drugs (2018) (2)
- A translational model-based approach to inform the choice of the dose in phase 1 oncology trials: the case study of erdafitinib (2021) (2)
- Progress and prospects of biological approaches targeting PCSK9 for cholesterol-lowering, from molecular mechanism to clinical efficacy (2020) (2)
- Somatostatin (SS), SS receptors and SS analog treatment in tumorigenesis (2012) (2)
- CRISPR interference as low burden logic inverters in synthetic circuits: characterization and tuning (2020) (2)
- A minimal model describing the effect of drug administration on tumor growth dynamics (2006) (2)
- F-17 Dietary iron overload induces visceral adipose tissue insulin resistance and hyper-resistinemia, and synergizes with obesity and fatty liver in inducing systemic insulin resistance (2011) (2)
- Assessing the Glucose Time Course in Critically Ill Patients by a Mathematical Model (2011) (2)
- Online Microreactor Titanium Dioxide RPLC-LTQ-Orbitrap MS Automated Platform for Shotgun Analysis of (Phospho) Proteins in Human Amniotic Fluid (2013) (2)
- PhosphoHunter: An Efficient Software Tool for Phosphopeptide Identification (2015) (2)
- Life-Style And Cardio-Metabolic Profile Of A Population Living In A Clustered Alpine Village (The Plic Chiesa Study): Comparison With An Urban Cohort (Plic Study) (2019) (1)
- Nutrient Analysis in Arctic Waters Using a Portable Sensing Platform (2021) (1)
- Taxonomic vs functional patterns across European marine benthic habitats: using research infrastructures (LIFEWATCH, ESFRI) in large-scale ecology (2016) (1)
- 872 ADIPONECTIN IN NONALCOHOLIC FATTY LIVER DISEASE: CORRELATION WITH LIVER DAMAGE AND PNPLA3 GENOTYPE (2011) (1)
- A one-year review of patients admitted to tertiary HIV/Neuropsychiatry beds in the Western Cape (2008) (1)
- 7 – Population Modelling (2014) (1)
- Functional genomics meta-analysis to identify gene set enrichment networks in cardiac hypertrophy (2021) (1)
- NPY (neuropeptide Y) (2011) (1)
- Seasonal Coupling Between Intertidal Macrofauna and Sediment Column Porewater Nutrient Concentrations (2005) (1)
- Mechanistic Multiscale Pharmacokinetic Model for the Anticancer Drug 2’,2’‐difluorodeoxycytidine (Gemcitabine) in Pancreatic Cancer (2020) (1)
- Soya-enriched mixed diet significantly improves cardiovascular and metabolic risk factors: A randomized controlled trial (2016) (1)
- TNF-alpha induces proprotein convertase subtilisin kexin type 9 (PCSK9) expression in hepatic HepG2 cell line in a SOCS-3-dependent manner (2016) (1)
- Summarizing Probe Intensities of Affymetrix GeneChip 3' Expression Arrays Taking into Account Day-to-Day Variability (2011) (1)
- The Optimal Dynamic Therapy: a Decision-theoretic Approach (1998) (1)
- Liver fat accumulation is associated with circulating PCSK9 levels (2015) (1)
- Characterization of an inducible promoter in different DNA copy number conditions (2012) (1)
- Microarray Data Analysis: Gene Regulatory Networks (2011) (1)
- Plasma Levels of Proprotein Convertase Subtilisin/Kexin Type 9 Are Inversely Associated with N-Terminal Pro B-Type Natriuretic Peptide in Older Men and Women (2022) (1)
- Spatio-temporal variability of microphytobenthos in the coastal lagoon of Cabras (Sardinia, Italy) (2011) (1)
- Ship‐Mounted Acoustic Doppler Current Profiler (ADCP): Characteristics and Field Applications to Measure Coastal Hydrodynamics (2019) (1)
- A Population Pharmacokinetic Model of Macitentan and Its Active Metabolite Aprocitentan in Healthy Volunteers and Patients with Pulmonary Arterial Hypertension (2021) (1)
- NPY1R (neuropeptide Y receptor Y1) (2011) (1)
- NPY family of peptides in endocrine, breast and prostate tumors (2005) (1)
- Half-life measurements of chemical inducers for recombinant gene expression (2014) (1)
- Paolo Common Carotid Artery Leptin : Adiponectin Ratio Is an Independent Predictor of Intima Media Thickness of the (2007) (1)
- SOCS-3 induces proprotein convertase subtilisin kexin type 9 (PCSK9) expression in hepatic HepG2 cell line: a potential link between hypertriglyceridemia and insulin resistance (2016) (1)
- GIBBS SAMPLING FOR SIGNALRECONSTRUCTIONRiccardo (1997) (0)
- Erratum to: Interlinked temporal changes in environmental conditions, chemical characteristics of sediments and macrofaunal assemblages in an estuarine intertidal sandflat (Seto Inland Sea, Japan) (2007) (0)
- TGGAGAGCGAGGGCTTTG TCACTGCATGTGAGGGAAAG GTGCACACTCCATTGCATTC CTGCCTGGCTTCCTCTTCA ACCAATGAGTTTCCGACCAG GCATACCGCGATTCCTTTT CTCGGACCATGCTAGGACAGTAG CCTCCAGCAACTCTCCTTTG CCATGTTTTGACCAATGCTG C TTCTGGGTAGACCTCTGGGAGTTCC (2017) (0)
- Regular Consumption of a Balanced Salmon-Based Salty Snack Does Not Affect Energy Intake, Body Composition and Biochemical Parameters in Healthy Volunteers (2013) (0)
- Characterization of regulatory parts for the metabolic engineering of E. coli and B. subtilis: applications in the conversion of bio-waste into biofuels and bioproducts (2017) (0)
- Method and instrument for the injection of samples in gas chromatography (2004) (0)
- A PK/PD model for tumor-in-host growth kinetics following administration of an antiangiogenic agent given alone or in combination regimens (2017) (0)
- Towards the management of transitional waters: assessing the potential of benthic tools (2010) (0)
- STAT3 inhibition induces PCSK9 in hepatic cell line: possible involvement in hypertriglyceridemia associated with insulin resistance (2015) (0)
- Gonadotropin-releasing hormone-secreting neuron development and function: an update. (2022) (0)
- Could Iron Overload Impair the Migratory Ability of Neurons? Evidence from a Cell-Based Model (2012) (0)
- Evaluation of software tools for Bayesian estimation on population models:an update based on current software versions (2018) (0)
- Clinical Classification of Myelofibrosis with Myeloid Metaplasia (MMM): Cluster Analysis of 861 Patients Enrolled into a Nationwide Prospective Registry (RIMM). (2005) (0)
- Possibilities of integration of monitoring requirements by other EU and national legislation (2016) (0)
- A comparison of eVai, CADD and VVP variant prediction results on the ICR639 hereditary cancer dataset (2019) (0)
- EFFECT OF SOMATOSTATIN RECEPTOR (SSTS) SUB-CELLULAR LOCALIZATION AND DIMERIZATION ON MONO- AND BI-SPECIFIC SOMATOSTATIN ANALOGS ANTIPROLIFERATIVE EFFECTS IN DU-145 AND PC-3 HUMAN ANDROGEN-INDEPENDENT PROSTATE CANCER CELLS (2013) (0)
- Introduction to Topic 2.5: Regional and international cooperation and comparative situations in the Mediterranean and Black Seas (2004) (0)
- Microarray Data Analysis: General Concepts, Gene Selection, and Classification (2011) (0)
- Iron overload impairs the migratory ability of a model of immature and migratory GnRH neurons (2013) (0)
- P1 Circulating adiponectin levels as a predictive factor of breast cancer in a double-blind 2×2 phase II trial of low-dose tamoxifen and fenretinide for breast cancer prevention (2010) (0)
- Summary of discussions on Topic 2.1: Endangered biodiversity and management of marine protected areas, wetlands, lagoons, estuaries and seagrass meadows (2004) (0)
- Variability of microphytobenthos communities in a shallow lagoon: Cabras (Sardinia, Italy) (2010) (0)
- PCSK9 expression is regulated by pro-inflammatory cytokines and adipokines in HEPG2 cells (2016) (0)
- Introduction to Topic 2.4: Environmental variability and biodiversity predictability: data collection and ocean models- what to do? (2004) (0)
- Insulin-like growth factor system in skeletal muscle in Amyotrophic Lateral Sclerosis (2008) (0)
- Common discussion and synthesis: summary (2004) (0)
- Insulin-like Growth Factor-1 profiling in Amyotrophic Lateral Sclerosis (ALS) (2006) (0)
- Impact of enzyme inter-correlation on global sensitivity analysis of PBPK models: a case study with repaglinide (2018) (0)
- Mining DNA Microarray Gene Expression Data (2009) (0)
- In-Silico and in-Vivo Metabolic Engineering Strategies to Optimize Waste Bioconversion Pathways in Microbial Strains: Two Case Studies on Ethanol and Poly-Gamma-Glutamic Acid Biosynthesis (2018) (0)
- Summary of discussions on Topic 2.4: Environmental variability and biodiversity predictability: data collection and ocean models - what to do? (2004) (0)
- Atlas of Genetics and Cytogenetics in Oncology and Haematology (2010) (0)
- Re-using Biological Devices: Characterization and Mathematical Modeling of Protein- and CRISPRi-mediated Regulation Devices to Design Predictable Interconnected Circuits with Reduced Cell Load (2018) (0)
- Validation of a workflow for the detection of small copy number variation from gene panels NGS data (2018) (0)
- Erratum to "Effects of Zostera marina on the patterns of spatial distribution of sediments and macrozoobenthos in the boreal lagoon of Furen (Hokkaido, Japan)" [Mar. Environ. Res. 131 (2017) 90-102]. (2018) (0)
- KING-REX: a custom end-to-end solution for kinome gene expression profiling (2018) (0)
- A model-based approach to extrapolate drug-drug interactions from rats to humans (2017) (0)
- COMMON SENSE Deliverable (2014) (0)
- Summary of discussions on Topic 2.5: Regional and international cooperation and comparative situations in the Mediterranean and Black Seas (2004) (0)
- Learning gene regulatory networks with an Intelligent data analysis approach : an application to the yeast cell cycle (2005) (0)
- Leptin and resistin affect PCSK9 expression: In vitro and in vivo evidence (2018) (0)
- T-11 Adiponectin in nonalcoholic fatty liver disease: Correlation with liver damage and PNPLA3 genotype (2011) (0)
- In-situ testing of innovative marine instrumentation for nutrients, heavy metals and pH in Kongsfjorden, Svalbard Islands (2016) (0)
- A Bayesian Nonparametric Approach to AUC Determination in Population Studies (2000) (0)
- Temporal expression analysis to elucidate regulatory mechanisms of heart development. (2009) (0)
- Instant Connect Gas Sampling Valve Module Introducing a New Flexibility in Gas Sampling for GC and GC-MS (2014) (0)
- GABA-B1 Receptor-Null Schwann Cells Exhibit Compromised In Vitro Myelination (2018) (0)
- RESPONSES OF BENTHIC INDICATORS IN ITALIAN COASTAL TRANSITIONAL ECOSYSTEMS (2009) (0)
- Improving Phosphopeptides Identification by MS/MS Spectra Analysis: A NewPerl Software Tool (2011) (0)
- Glucose and lipid homeostasis during confinement in a 520-day simulated interplanetary mission to Mars (2015) (0)
- Gold nanocages for imaging and therapy of prostate cancer cells (2016) (0)
- Prediction of ferritin response to chelation in patients affected by transfusion-dependent haemoglobinophaties (2018) (0)
- Tidally Mediated Changes in Nutrient Concentrations (2005) (0)
- Editorial Collaborators (2017) (0)
- Corrigendum to “Regulation of prostate cancer cell proliferation by somatostatin receptor activation” [Mol. Cell. Endocrinol. 315 (1–2) (2010) 254–262] (2011) (0)
- A novel method for proteomic analysis of immunoglobulin light chains and attribution to a germline gene-based family (2011) (0)
- BY 1 SOMATOSTATIN RECEPTOR ACTIVATION 2 3 4 ABBREVIATED TITLE : SRIF receptor activation in prostate cancer 5 6 (2019) (0)
- F1000 recommendations - Cell Metabolism 2011 (2013) (0)
- Web discussions on cardiovascular diseases: assessing the impact of COVID-19 pandemic. An Italian prospective analysis (2021) (0)
- Somatostatin and dopamine receptor dimerization in prostate and lung tumor cell lines (2009) (0)
- Somatostatin and dopamine receptor regulation and effects of a new somatostatin/dopamine chimeric compound on cell proliferation of the human androgen-dependent prostate cancer cell line LNCaP (2007) (0)
- Analysis of intergenic conserved sequences in the POF critical region on X chromosome (2003) (0)
- Which data are necessary to build a WB-PBPK model that accurately predicts exposure in the lung? A case study using Ethambutol for tuberculosis treatment (2017) (0)
- Rational engineering of protein- and CRISPRi- mediated regulation devices to design predictable interconnected circuits with reduced cell load (2017) (0)
- Analysis of relevant technical issues and deficiencies of the existing sensors and related initiatives currently set and working in marine environment. New generation technologies for cost-effective sensors (2014) (0)
- [OP.1A.10] CIRCULATING LEVELS OF PCSK9 AND ARTERIAL STIFFNESS IN A LARGE POPULATION SAMPLE: DATA FROM THE BRISIGHELLA HEART STUDY (2017) (0)
- INDICATORS OF STRESS IN THE MARINE BENTHOS (2014) (0)
- Helium saving device for a gas chromatograph (2011) (0)
- Is ghrelin a potential signal of decreased fat-free mass in elderly subjects? (2006) (0)
- Correction to: Nutraceutical approach for the management of cardiovascular risk – a combination containing the probiotic Bifidobacterium longum BB536 and red yeast rice extract: results from a randomized, double-blind, placebo-controlled study (2019) (0)
- Effect of soy on metabolic syndrome and cardiovascular risk factors: Evidence from a randomized controlled trial (2017) (0)
- Review of existing and operable observing systems and sensors (2014) (0)
- Phosphopeptide identification: an automated Perl procedure (2010) (0)
- Day-to-day variability in microarray experiment: a new algorithm to summarize probe levels and minimize this effect (2008) (0)
- SEX HORMONES AND ADIPOKINES IN HEALTHY PRE-MENOPAUSAL, POST-MENOPAUSAL AND ELDERLY WOMEN, AND IN AGE-MATCHED MEN: DATA FROM THE BRISIGHELLA HEART STUDY: PP.34.374 (2010) (0)
- Selective ERbeta activation leads to somatostatin receptor up-regulation in prostate cancer cells (2014) (0)
- humanssimulated by head-down bed rest in Increase in epinephrine-induced responsiveness during (2015) (0)
- Optimal Design for Informative Protocols in Xenograft Tumor Growth Inhibition Models (2015) (0)
- Somatostatin and Dopamine Receptor Dimerization in Prostate and Lung Tumors (2009) (0)
- Serum Irisin levels and metabolic state in amyotrophic lateral sclerosis (2015) (0)
- Circulating PCSK9 Levels are Associated with the Hepatic Fat in Non-Alcoholic Fatty Liver Disease (2016) (0)
- Cardiometabolic profile in PLIC-MI and PLIC-CHIESA cohorts: Comparison of two different geographic settings (2020) (0)
- An energy based model able to describe the effect of anticancer drugs on tumor growth and host body weight (2014) (0)
- Precedence Temporal Networks: a New Tool for Extracting Temporal Relationships in Gene Expression Profiles (2005) (0)
- Summary of discussions on Topic 1.3: Historical data sets and grey literature: the value of "real" data and the need for quality control (2004) (0)
- Somatostatin and prostate cancer: role of somatostatin receptors in the control of tumor growth (2013) (0)
- Improving protein identification by MsPI using peak intensity (2009) (0)
- Efficient conversion of industrial bio-waste into biofuels and bioproducts through E. coli and B. subtilis synthetic biology (2017) (0)
- Leptin and resistin affect PCSK9 expression via STAT3 involvement. (2017) (0)
- Precedence Temporal Networks: Extraction and Representation of Temporal Relationships in Gene Expression Profiles (2005) (0)
- A Bayesian method for clustering gene expression temporal profiles from microarray data (2004) (0)
- A standard vector for the chromosomal integration and characterization of BioBrick™ parts in Escherichia coli (2013) (0)
- Replacement, Reduction, and Refinement of Animal Experiments in Anticancer Drug Development: The Contribution of 3D In Vitro Cancer Models in the Drug Efficacy Assessment (2023) (0)
- Accounting for inter-correlation between enzyme abundance: a simulation study to assess implications on global sensitivity analysis within physiologically-based pharmacokinetics (2019) (0)
- Synthetic and systems biology for cost-competitive γ-PGA production (2017) (0)
- P285 EFFECT OF MEDITERRANEAN DIET-INDUCED WEIGHT LOSS ON PLASMA CYTOKINE LEVELS AND ABDOMINAL VISCERAL FAT IN OBESE WOMEN (2009) (0)
- CRISPR Interference Modules as Low-Burden Logic Inverters in Synthetic Circuits (2022) (0)
- Evaluation of a minimal WB-PBPK platform supporting different routes of administration (2017) (0)
- Adipose tissue related adipokines and cytokines regulate PCSK9 expression in HepG2 cells (2016) (0)
- Apr 28, 2019 Integration of enzymatic data in Bacillus subtilis genome-scale metabolic model improves phenotype predictions and enables in silico design of poly--glutamic (2019) (0)
- Circulating levels of PCSK9 and arterial stiffness in a large population sample: Data from the brisighella heart study. (2017) (0)
- Inferring gene expression networks through static and dynamic data integration (2006) (0)
- Method and device for carrier gas flow rate control in a chromatograph (1995) (0)
- Whole-body PBPK model for a translational study of Azathioprine pharmacokinetics (2018) (0)
- Sensor monitoring strategy (2016) (0)
- Neuropeptide Y-Y1 receptors mediate the effects of neuropeptide Y on prostate cancer cell growth (2006) (0)
- P050 PHARMACOKINETIC OF ORAL MELATONIN IN CRITICALLY ILL PATIENTS (2008) (0)
- Arrangement for introduction of samples in analysis devices (1993) (0)
- Characterization and sub-cellular localization of somatostatin receptors in DU-145 and PC-3 human androgen-independent prostate cancer cells: effect of mono- and bi-specific somatostatin analogs on cell growth (2013) (0)
- Plasma PCSK9 levels and lipoprotein distribution are preserved in patients with severe hypoalphalipoproteinemia. (2017) (0)
- Gender-specific comparison of six QT correction formulae in dyslipidemic patients in primary prevention (2013) (0)
- A Population Dynamic Energy Budget-Based Tumor Growth Inhibition Model for Etoposide Effects on Wistar Rats (2019) (0)
- [28] ADIPOKINES AND SEX HORMONES ARE DIFFERENTLY ASSOCIATED TO CARDIOMETABOLIC RISK FACTORS IN A RANDOMIZED SAMPLE OF ADULT-ELDERLY HEALTHY SUBJECTS: THE BRISIGHELLA HEART STUDY (2009) (0)
- Population Pharmacokinetic Modeling of Etoposide Free Concentrations in Solid Tumor (2016) (0)
- Abstract A61: Circulating adiponectin levels as a predictive factor of breast cancer in a double-blind 2x2 phase II trial of low-dose tamoxifen and fenretinide for breast cancer prevention (2010) (0)
- A Bayesian approach to non-parametric AUC estimation in population studies (2003) (0)
- Protein identification by MsPI software tool: implementation of a scoring function intensity-based (2009) (0)
- Effects of somatostatin analogs on cell proliferation of DU-145 and PC-3 human androgen-indipendent prostate cancer cell lines. (2012) (0)
- EDITORIAL [Hot Topic: Novel Approaches to the Drug Therapy of Obesity (Guest Editor: Prof. Paolo Magni)] (2007) (0)
- NPY 1 R ( neuropeptide Y receptor Y 1 ) (2012) (0)
- Hormonal Treatments of Endocrine-Dependent Tumors: Preclinical Aspects (2003) (0)
- Heart rate correction of the QT interval: A nonparametric individualized approach (2008) (0)
- ENDOCRINE ADAPTATIONS TO SIMULATED MICROGRAVITY (2010) (0)
- Introduction to Topic 1.3: Historical data sets and grey literature: the value of 'real' data and the need for quality control (2004) (0)
- Synthetic Biology Approaches for the Rational Engineering of Novel E. coli and B. subtilis Biocatalysts for the Conversion of Industrial Bio-Wasteinto Biofuels and Bioproducts (2017) (0)
- Mining biomedical timeseries bycombining structural analysis andtemporal abstractions (1998) (0)
- Optimal Design for Informative Protocols in Xenograft Tumor Growth Inhibition Experiments in Mice (2016) (0)
- Response to Letter by Kotani et al (2008) (0)
- Somatostatin receptor regulation and effects of somatostatin and somatostatin analogues on cell proliferation of the human androgen-dependent prostate cancer cell line LNCaP (2007) (0)
- Paediatric trial design optimization using prior knowledge in combination with modelling & simulations (2017) (0)
- Comprehensive kinome NGS targeted expression profiling by KING-REX (2019) (0)
- Field testing, validation and optimization report (2016) (0)
- A potential mechanism for copper amplification of prostaglandin E2 action: attenuation of prostaglandin E2-induced efflux of cyclic AMP from median eminence explants. (1991) (0)
- Setting the scene: biodiversity and ecosystem services in the Asia-Pacific region (2018) (0)
- Variance based global sensitivity analysis of physiologically based pharmacokinetic absorption models for BCS I–IV drugs (2018) (0)
- A bioinformatic approach to predict the cross-kingdompotential of plant miRNA in humans (2018) (0)
- Leptin Actions on the Reproductive System (2016) (0)
- CA-IMT and QT parameters in dyslipidemic patients in primary prevention at different ESC/EAS cardiovascular risk levels (2013) (0)
- MsPI: a tool for the analysis of peptide mass fingerprinting data (2008) (0)
- Structural analysis of the abortion time series reported in the ISTAT summaries (2001) (0)
- Automatic translation of Bayesian pharmacometric models: the PharmML-to-WinBugs converter (2015) (0)
- In-situ detection of nutrients in Kongsfjorden, Svalbard Islands using a cost effective nutrient sensor (2018) (0)
- Serum osteocalcin forms and osteocalcin-expressing endothelial progenitor cells are independent biomarkers of coronary atherosclerotic disease severity (2022) (0)
- Efficacy and safety of a nutraceutical with probiotic and red yeast rice extract in patients with moderate hypercholesterolemia: A randomized, double-blind, placebo-controlled study. (2017) (0)
- Optimal age and strategy for screening hereditary hemochromatosis. The answers from a Markov decision process (1999) (0)
- 03 - LIFE-STYLE AND CARDIO-METABOLIC PROFILE OF A POPULATION LIVING IN A CLUSTERED ALPINE VILLAGE (THE PLIC CHIESA STUDY): COMPARISON WITH AN URBAN COHORT (PLIC STUDY) (2019) (0)
- Tumor growth modelling for drug development (2014) (0)
- Assessing vascular aging in young subjects with obesity: Usefulness and critical issues. (2022) (0)
- Procedures of sensors deployment methodology on physical supports/platforms (2014) (0)
- Leukemia inhibitory factor promotes the chemomigration of immature GNRH neurons (2006) (0)
- Protocols for the field testing (2015) (0)
- Evaluation of the health benefits of soy protein consumption in patients carrying the metabolic syndrome (2015) (0)
- High Density Lipoproteins Inhibit Oxidative Stress-Induced Prostate Cancer Cell Proliferation (2018) (0)
- Overcome Metabolic Burden in Rational Design of Genetic Synthetic Circuits: Deep Characterization of a Crispri Alternative (2018) (0)
- STOCHASTIC CONTROL WITH GRAPHICAL MODELS : THEINFLUENCE VIEW APPROACHPaolo (2007) (0)
- SOCS-3 induces PCSK9 expression in hepatic HepG2 cell line (2015) (0)
- Compartmenta lmode lidentification base do na nempirica lBayesian approach :th ecas eo fthiamin ekinetics i nrats (2001) (0)
- Optimization of gamma-PGA biosynthesis supported by synthetic biology and metabolic engineering strategies (2018) (0)
This paper list is powered by the following services:
Other Resources About Paolo Magni
What Schools Are Affiliated With Paolo Magni?
Paolo Magni is affiliated with the following schools: