Paolo Magni | Academic Influence

Paolo Magni's AcademicInfluence.com Rankings

Paolo Magni

Computer Science

#9785

World Rank

#10265

Historical Rank

Algorithms

#401

World Rank

#406

Historical Rank

Computational Linguistics

#2406

World Rank

#2430

Historical Rank

Machine Learning

#4376

World Rank

#4426

Historical Rank

computer-science Degrees

Download Badge

Computer Science

Paolo Magni's Degrees

PhD Computer Science University of Milan

Similar Degrees You Can Earn

Best Online PhD of Computer Science (Doctorates) 2026

Why Is Paolo Magni Influential?

(Suggest an Edit or Addition)

(See a Problem?)

Paolo Magni's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Waist circumference as a vital sign in clinical practice: a Consensus Statement from the IAS and ICCR Working Group on Visceral Obesity (2020) (528)
Characterization of the potent luteinizing hormone-releasing activity of KiSS-1 peptide, the natural ligand of GPR54. (2005) (451)
Visceral and ectopic fat, atherosclerosis, and cardiometabolic disease: a position statement. (2019) (449)
Predictive Pharmacokinetic-Pharmacodynamic Modeling of Tumor Growth Kinetics in Xenograft Models after Administration of Anticancer Agents (2004) (431)
A stabilizing model-based predictive control algorithm for nonlinear systems (2001) (348)
Organic carbon content of sediments as an indicator of stress in the marine benthos (2005) (321)
Screen-printed electrodes for environmental monitoring of heavy metal ions: a review (2016) (194)
2 month evening and night closed-loop glucose control in patients with type 1 diabetes under free-living conditions: a randomised crossover trial. (2015) (189)
Leptin:Adiponectin Ratio Is an Independent Predictor of Intima Media Thickness of the Common Carotid Artery (2007) (186)
The use of benthic indicators in Europe: from the Water Framework Directive to the Marine Strategy Framework Directive. (2010) (186)
Ontogeny and mechanisms of action for the stimulatory effect of kisspeptin on gonadotropin-releasing hormone system of the rat (2006) (185)
A Review of Mixed-Effects Models of Tumor Growth and Effects of Anticancer Drug Treatment Used in Population Analysis (2014) (141)
Expression of a leptin receptor in immortalized gonadotropin-releasing hormone-secreting neurons. (1999) (141)
Positive energy balance is associated with accelerated muscle atrophy and increased erythrocyte glutathione turnover during 5 wk of bed rest. (2008) (135)
Dietary iron overload induces visceral adipose tissue insulin resistance. (2011) (131)
Temporal data mining for the quality assessment of hemodialysis services (2005) (113)
Seasonal and interannual patterns of intertidal microphytobenthos in combination with laboratory and areal production estimates (2003) (109)
Liver fat accumulation is associated with circulating PCSK9 (2016) (107)
Output feedback and tracking of nonlinear systems with model predictive control (2001) (104)
Temporal scaling and relevance of bivalve nutrient excretion on a tidal flat of the Seto Inland Sea, Japan (2000) (104)
Amino acid-dependent activation of liver estrogen receptor alpha integrates metabolic and reproductive functions via IGF-1. (2011) (103)
Molecular aspects of adipokine-bone interactions. (2010) (97)
Leptin: a possible link between food intake, energy expenditure, and reproductive function (2000) (96)
Day-and-Night Closed-Loop Glucose Control in Patients With Type 1 Diabetes Under Free-Living Conditions: Results of a Single-Arm 1-Month Experience Compared With a Previously Reported Feasibility Study of Evening and Night at Home (2016) (95)
Sediment grain size and organic carbon distribution in the Cabras lagoon (Sardinia, Western Mediterranean) (2004) (91)
Genotoxicity biomarkers and acetylcholinesterase activity in natural populations of Mytilus galloprovincialis along a pollution gradient in the Gulf of Oristano (Sardinia, western Mediterranean). (2006) (85)
A mathematical model to study the effects of drugs administration on tumor growth dynamics. (2006) (83)
Suppressor of Cytokine Signaling-3 (SOCS-3) Induces Proprotein Convertase Subtilisin Kexin Type 9 (PCSK9) Expression in Hepatic HepG2 Cell Line* (2015) (82)
Distribution and ecological relevance of fine sediments in organic-enriched lagoons: the case study of the Cabras lagoon (Sardinia, Italy). (2008) (82)
The natural antioxidant alpha-lipoic acid induces p27(Kip1)-dependent cell cycle arrest and apoptosis in MCF-7 human breast cancer cells. (2010) (79)
Intelligent analysis of clinical time series: an application in the diabetes mellitus domain (2000) (79)
GC-MS profiling of the phytochemical constituents of the oleoresin from Copaifera langsdorffii Desf. and a preliminary in vivo evaluation of its antipsoriatic effect. (2013) (78)
Nutraceutical approach to moderate cardiometabolic risk: results of a randomized, double-blind and crossover study with Armolipid Plus. (2014) (76)
Diverse effects of invasive ecosystem engineers on marine biodiversity and ecosystem functions: A global review and meta‐analysis (2018) (74)
Integrating model-based decision support in a multi-modal reasoning system for managing type 1 diabetic patients (2003) (73)
Free and bound plasma leptin in normal weight and obese men and women: relationship with body composition, resting energy expenditure, insulin‐sensitivity, lipid profile and macronutrient preference (2005) (72)
Dispersion measurement by the single introduction method coupled with the back-sorption procedure: A chemisorption and TPD study of the different chemisorbed hydrogen species: I. Pt, Ru, and Rh on Alumina (1994) (72)
Animal-sediment relationships: evaluating the 'Pearson-Rosenberg paradigm' in Mediterranean coastal lagoons. (2009) (71)
A hierarchical Naïve Bayes Model for handling sample heterogeneity in classification problems: an application to tissue microarrays (2006) (71)
On the Myths of Indicator Species: Issues and Further Consideration in the Use of Static Concepts for Ecological Applications (2013) (70)
Activation of the Y1 receptor by neuropeptide Y regulates the growth of prostate cancer cells. (2006) (70)
Risk identification and possible countermeasures for muscle adverse effects during statin therapy. (2015) (70)
Biogeochemical indicators as tools for assessing sediment quality/vulnerability in transitional aquatic ecosystems (2004) (68)
Effect of fenretinide and low-dose tamoxifen on insulin sensitivity in premenopausal women at high risk for breast cancer. (2008) (68)
Sediment features, macrozoobenthic assemblages and trophic relationships (delta13C and delta15N analysis) following a dystrophic event with anoxia and sulphide development in the Santa Giusta lagoon (western Sardinia, Italy). (2008) (67)
Circulating Levels of Proprotein Convertase Subtilisin/Kexin Type 9 and Arterial Stiffness in a Large Population Sample: Data From the Brisighella Heart Study (2017) (67)
Prognostic effect of circulating adiponectin in a randomized 2 x 2 trial of low-dose tamoxifen and fenretinide in premenopausal women at risk for breast cancer. (2012) (67)
Parthenolide Inhibits the LPS‐induced Secretion of IL‐6 and TNF‐α and NF‐κB Nuclear Translocation in BV‐2 Microglia (2012) (66)
Temporal changes of a macrobenthic assemblage in harsh lagoon sediments (2009) (64)
The i148m Pnpla3 polymorphism influences serum adiponectin in patients with fatty liver and healthy controls (2012) (62)
Hormonal control of the neuropeptide Y system. (2003) (62)
Characterization of exopolysaccharides produced by seven biofilm-forming cyanobacterial strains for biotechnological applications (2013) (61)
Sediment characteristics and macrofauna distribution along a human-modified inlet in the Gulf of Oristano (Sardinia, Italy). (2007) (60)
Relationships between hydrodynamic parameters and grain size in two contrasting transitional environments: the Lagoons of Venice and Cabras, Italy. (2009) (60)
Twelve years after the first report of the crab Percnon gibbesi (H. Milne Edwards, 1853) in the Mediterranean: current distribution and invasion rates (2011) (59)
Bayesian Function Learning Using MCMC Methods (1998) (59)
Relationships Between Chemical Characteristics of Sediments and Macrofaunal Communities in the Cabras Lagoon (Western Mediterranean, Italy) (2005) (59)
Comparative analysis of macrofaunal species richness and composition in Posidonia oceanica, Cymodocea nodosa and leaf litter beds (2008) (58)
Minimal model S(I)=0 problem in NIDDM subjects: nonzero Bayesian estimates with credible confidence intervals. (2002) (57)
Deciding when to intervene: a Markov decision process approach (2000) (57)
Cow’s Milk Consumption and Health: A Health Professional’s Guide (2018) (55)
The effect of a tidal cycle on the dynamics of nutrients in a tidal estuary in the Seto Inland Sea, Japan (1998) (54)
Perspective: Improving Nutritional Guidelines for Sustainable Health Policies: Current Status and Perspectives (2017) (54)
Circulating ghrelin level is increased in coeliac disease as in functional dyspepsia and reverts to normal during gluten‐free diet (2006) (54)
Spatial distribution of trace metals (Cd, Pb, Hg, Cu, Zn, Fe and Mn) and oligo-elements (Mg, Ca, Na and K) in surface sediments of the Gulf of Tunis (Northern Tunisia) (2010) (53)
A metabolic scope based model of fish response to environmental changes (2012) (53)
Practical guidance for combination lipid-modifying therapy in high- and very-high-risk patients: A statement from a European Atherosclerosis Society Task Force. (2021) (52)
Relevance of the neuropeptide Y system in the biology of cancer progression. (2007) (52)
Seasonal patterns of pore-water nutrients, benthic chlorophyll a and sedimentary AVS in a macrobenthos-rich tidal flat (2006) (52)
Statin therapy and related risk of new-onset type 2 diabetes mellitus. (2014) (51)
Is ghrelin a signal of decreased fat-free mass in elderly subjects? (2006) (51)
Phaseolus vulgaris extract affects glycometabolic and appetite control in healthy human subjects (2012) (50)
The dopamine-somatostatin chimeric compound BIM-23A760 exerts antiproliferative and cytotoxic effects in human non-functioning pituitary tumors by activating ERK1/2 and p38 pathways. (2010) (50)
TimeClust: a clustering tool for gene expression time series (2008) (50)
Expression of neuropeptide Y receptors in human prostate cancer cells. (2001) (49)
Saprobity: a unified view of benthic succession models for coastal lagoons (2012) (48)
Feeding Behavior in Mammals Including Humans (2009) (48)
Impaired Expression of Insulin-Like Growth Factor-1 System in Skeletal Muscle of Amyotrophic Lateral Sclerosis Patients (2012) (47)
A stochastic model to assess the variability of blood glucose time series in diabetic patients self-monitoring (2006) (46)
Proprotein convertase subtilisin kexin type 9 and high-density lipoprotein metabolism: experimental animal models and clinical evidence. (2016) (46)
Integration of enzymatic data in Bacillus subtilis genome-scale metabolic model improves phenotype predictions and enables in silico design of poly-γ-glutamic acid production strains (2019) (45)
Effect of soy on metabolic syndrome and cardiovascular risk factors: a randomized controlled trial (2018) (45)
Cobalamin (vitamin B12) positively regulates interleukin-6 levels in rat cerebrospinal fluid (2002) (44)
Biological benthic tools as indicators of coastal marine ecosystems health (2003) (44)
Short term effects of hypoxia and bioturbation on solute fluxes, denitrification and buffering capacity in a shallow dystrophic pond (2009) (43)
Macrofaunal community structure and distribution in a muddy coastal lagoon (2004) (41)
Plasma Concentrations of the Enantiomers of Fluoxetine and Norfluoxetine: Sources of Variability and Preliminary Observations on Relations With Clinical Response (2002) (41)
Modeling of human tumor xenografts and dose rationale in oncology. (2013) (39)
Nutraceutical approach for the management of cardiovascular risk – a combination containing the probiotic Bifidobacterium longum BB536 and red yeast rice extract: results from a randomized, double-blind, placebo-controlled study (2019) (38)
Predictive pharmacokinetic–pharmacodynamic modeling of tumor growth after administration of an anti-angiogenic agent, bevacizumab, as single-agent and combination therapy in tumor xenografts (2013) (38)
Interlinked temporal changes in environmental conditions, chemical characteristics of sediments and macrofaunal assemblages in an estuarine intertidal sandflat (Seto Inland Sea, Japan) (2006) (38)
Pharmacometrics Markup Language (PharmML): Opening New Perspectives for Model Exchange in Drug Development (2015) (38)
Semidiurnal Dynamics of Salinity, Nutrients and Suspended Particulate Matter in an Estuary in the Seto Inland Sea, Japan, during a Spring Tide Cycle (2002) (38)
Fermentation of lactose to ethanol in cheese whey permeate and concentrated permeate by engineered Escherichia coli (2017) (37)
Somatostatin and dopamine receptor interaction in prostate and lung cancer cell lines. (2010) (36)
Testing additivity of anticancer agents in pre-clinical studies: a PK/PD modelling approach. (2009) (36)
Low-intermediate dose testosterone replacement therapy by different pharmaceutical preparations improves frailty score in elderly hypogonadal hyperglycaemic patients (2013) (36)
Somatostatin, somatostatin analogs and somatostatin receptor dynamics in the biology of cancer progression. (2013) (36)
Forskolin and phorbol ester stimulation of neuropeptide Y (NPY) production and secretion by aggregating fetal brain cells in culture: evidence for regulation of NPY biosynthesis at transcriptional and posttranscriptional levels. (1992) (35)
Leukemia inhibitory factor induces the chemomigration of immortalized gonadotropin-releasing hormone neurons through the independent activation of the Janus kinase/signal transducer and activator of transcription 3, mitogen-activated protein kinase/extracellularly regulated kinase 1/2, and phosphati (2007) (34)
Comprehensive two-dimensional gas chromatography using large sample volume injection for the determination of polynuclear aromatic hydrocarbons in complex matrices. (2003) (34)
A predictive pharmacokinetic–pharmacodynamic model of tumor growth kinetics in xenograft mice after administration of anticancer agents given in combination (2013) (34)
Antipsychotic prescription patterns in Xhosa patients with schizophrenia or schizoaffective disorder. (2008) (34)
Characterization of an inducible promoter in different DNA copy number conditions (2012) (34)
The effect of hydrodynamics on shell orientation and population density of Pinna nobilis in the Gulf of Oristano (Sardinia, Italy) (2013) (33)
Bottom-Up Engineering of Biological Systems through Standard Bricks: A Modularity Study on Basic Parts and Devices (2012) (31)
Bayesian analysis of blood glucose time series from diabetes home monitoring (2000) (31)
Regulation of prostate cancer cell proliferation by somatostatin receptor activation (2010) (31)
Multiplexing and demultiplexing logic functions for computing signal processing tasks in synthetic biology. (2011) (31)
Characterization of a synthetic bacterial self-destruction device for programmed cell death and for recombinant proteins release (2011) (31)
Role of neuropeptide Y and its receptors in the progression of endocrine-related cancer (2007) (30)
Osteocalcin as a potential risk biomarker for cardiovascular and metabolic diseases (2016) (30)
A Minimal Model of Tumor Growth Inhibition (2008) (29)
A standard vector for the chromosomal integration and characterization of BioBrick™ parts in Escherichia coli (2013) (29)
Concurrent solvent recondensation large sample volume splitless injection (2003) (29)
Retinoic acid negatively regulates neuropeptide Y expression in human neuroblastoma cells (2000) (29)
Half-life measurements of chemical inducers for recombinant gene expression (2014) (28)
Leptin, ciliary neurotrophic factor, leukemia inhibitory factor and interleukin-6: class-I cytokines involved in the neuroendocrine regulation of the reproductive function. (2009) (28)
Phytoplankton dynamics in relation to environmental changes in a phytoplankton-dominated Mediterranean lagoon (Cabras Lagoon, Italy) (2012) (28)
Density and distribution of Patella ferruginea in a Marine Protected Area (western Sardinia, Italy): Constraint analysis for population conservation (2012) (28)
Dexamethasone-induced accumulation of neuropeptide-Y by aggregating fetal brain cells in culture: a process dependent on the developmental age of the aggregates. (1991) (28)
Is the establishment of MPAs enough to preserve endangered intertidal species? The case of Patella ferruginea in Mal di Ventre Island (W Sardinia, Italy) (2016) (27)
Integrating Different Methodologies for Insulin Therapy Support in Type 1 Diabetic Patients (2001) (27)
Hepatic steatosis and PNPLA3 I148M variant are associated with serum Fetuin‐A independently of insulin resistance (2014) (27)
Testing the saprobity hypothesis in a Mediterranean lagoon: effects of confinement and organic enrichment on benthic communities. (2014) (27)
TA-clustering: Cluster analysis of gene expression profiles through Temporal Abstractions (2005) (26)
Mouse embryonic stem cells that survive γ‐rays exposure maintain pluripotent differentiation potential and genome stability (2012) (26)
Mining biomedical time series by combining structural analysis and temporal abstractions (1998) (25)
Patterns of seasonal variation in lagoonal macrozoobenthic assemblages (Mellah lagoon, Algeria). (2015) (25)
GC instrumentation for on‐column injection of large volumes: Automated optimization of conditions (1995) (25)
High Density Lipoproteins Inhibit Oxidative Stress-Induced Prostate Cancer Cell Proliferation (2016) (25)
A Multidisciplinary and Ecosystemic Approach in the Oristano Lagoon-Gulf System (Sardinia, Italy) as a Tool in Management Plans (2008) (25)
Palm oil and human health. Meeting report of NFI: Nutrition Foundation of Italy symposium (2017) (25)
Cholinergic muscarinic mechanisms regulate neuropeptide Y gene expression via protein kinase C in human neuroblastoma cells (1998) (24)
Intelligent Analysis of Clinical Time Series by Combining Structural Filtering and Temporal Abstractions (1999) (23)
Plasma nerve growth factor (NGF) and inflammatory cytokines (IL-6 and MCP-1) in young and adult subjects with Down syndrome: an interesting pathway. (2006) (23)
A model-based approach to the in vitro evaluation of anticancer activity (2009) (23)
dCas9 regulator to neutralize competition in CRISPRi circuits (2020) (22)
Nonparametric AUC Estimation in Population Studies with Incomplete Sampling: A Bayesian Approach (2002) (22)
Free insulin‐like growth factor (IGF)‐1 and IGF‐binding proteins‐2 and ‐3 in serum and cerebrospinal fluid of amyotrophic lateral sclerosis patients (2010) (22)
Theranostic Nanocages for Imaging and Photothermal Therapy of Prostate Cancer Cells by Active Targeting of Neuropeptide-Y Receptor. (2016) (21)
Water chemistry variability in the lower intertidal zone [-2pt] of an estuary in the Seto Inland Sea, Japan: seasonal patterns of nutrients and particulate compounds (2000) (21)
Reduced sampling schedule for the glucose minimal model: importance of Bayesian estimation. (2006) (20)
Effects of a lupin protein concentrate on lipids, blood pressure and insulin resistance in moderately dyslipidaemic patients : a randomised controlled trial (2017) (20)
Gender-related lipid and/or lipoprotein responses to statins in subjects in primary and secondary prevention. (2015) (20)
Multi-Faceted Characterization of a Novel LuxR-Repressible Promoter Library for Escherichia coli (2015) (20)
Current mathematical models for cancer drug discovery (2017) (20)
Three Thiamine Analogues Differently Alter Thiamine Transport and Metabolism in Nervous Tissue: An In Vivo Kinetic Study Using Rats (2003) (19)
DT-Planner: an environment for managing dynamic decision problems. (1997) (18)
Leptin, Resistin, and Proprotein Convertase Subtilisin/Kexin Type 9 (2020) (18)
Serum irisin is upregulated in patients affected by amyotrophic lateral sclerosis and correlates with functional and metabolic status (2018) (18)
Free and bound leptin in prepubertal children with Down's syndrome and different degrees of adiposity (2004) (18)
Spatial variations in δ13c and δ15n values of primary consumers in a coastal lagoon (2012) (18)
Regulated production and secretion of immunoreactive neuropeptide Y by aggregating fetal brain cells in cultures. (1991) (18)
White Paper: Landscape on Technical and Conceptual Requirements and Competence Framework in Drug/Disease Modeling and Simulation (2013) (17)
Dissolved organic matter dynamics in Mediterranean lagoons: The relationship between DOC and CDOM (2018) (17)
Characterization and sub-cellular localization of SS1R, SS2R, and SS5R in human late-stage prostate cancer cells: Effect of mono- and bi-specific somatostatin analogs on cell growth (2014) (17)
Bayesian Identification of a Population Compartmental Model of C-Peptide Kinetics (2000) (17)
Multifactorial Activation of NLRP3 Inflammasome: Relevance for a Precision Approach to Atherosclerotic Cardiovascular Risk and Disease (2020) (17)
Learning Rules with Complex Temporal Patterns in Biomedical Domains (2005) (17)
Inferring gene regulatory networks by integrating static and dynamic data (2007) (16)
Precedence Temporal Networks to represent temporal relationships in gene expression data (2007) (16)
Reduction of Cardio-Metabolic Risk and Body Weight through a Multiphasic Very-Low Calorie Ketogenic Diet Program in Women with Overweight/Obesity: A Study in a Real-World Setting (2021) (16)
BDNF Serum Levels with Respect to Multidimensional Assessment in Amyotrophic Lateral Sclerosis (2016) (16)
Unsaponifiable Fraction of Unripe Fruits of Olea europaea: An Interesting Source of Anti-inflammatory Constituents (2015) (16)
Modulatory actions of neuropeptide Y on prostate cancer growth: role of MAP kinase/ERK 1/2 activation. (2007) (16)
Changes in stress hormones and metabolism during a 105-day simulated Mars mission. (2014) (16)
Adiponectin interactions in bone and cartilage biology and disease. (2012) (16)
Effects of Zostera marina on the patterns of spatial distribution of sediments and macrozoobenthos in the boreal lagoon of Furen (Hokkaido, Japan). (2017) (16)
Adipokine actions on cartilage homeostasis. (2011) (16)
Sex hormones and adipokines in healthy pre-menopausal, post-menopausal and elderly women, and in age-matched men: Data from the Brisighella Heart Study (2011) (15)
Using uncertainty management techniques in medical therapy planning: A decision-theoretic approach (1998) (15)
Plasma adiponectin and leptin concentrations in professional rugby players. (2010) (15)
Accurate peak list extraction from proteomic mass spectra for identification and profiling studies (2010) (15)
Geographic patterns of biodiversity in European coastal marine benthos (2016) (15)
The two tryptophans of β2-microglobulin have distinct roles in function and folding and might represent two independent responses to evolutionary pressure (2011) (14)
Review of pH sensing materials from macro- to nano-scale: Recent developments and examples of seawater applications (2020) (14)
Random Walk Models for Bayesian Clustering of Gene Expression Profiles (2005) (14)
Iron overload induces hypogonadism in male mice via extrahypothalamic mechanisms (2017) (14)
Insulin Minimal Model Indexes and Secretion: Proper Handling of Uncertainty by a Bayesian Approach (2004) (14)
Plasma PCSK9 levels and lipoprotein distribution are preserved in carriers of genetic HDL disorders. (2018) (14)
Free and bound plasma leptin in anorexia nervosa patients during a refeeding program (2016) (14)
Accounting for inter-correlation between enzyme abundance: a simulation study to assess implications on global sensitivity analysis within physiologically-based pharmacokinetics (2019) (14)
Model Description Language (MDL): A Standard for Modeling and Simulation (2017) (14)
Irisin and BDNF serum levels and behavioral disturbances in Alzheimer’s disease (2019) (13)
An early and transient period of protein synthesis is required for induction of neuropeptide Y-mRNA by phorbol ester and forskolin in aggregate cultures of fetal brain cells (1993) (13)
Body composition and metabolic changes during a 520-day mission simulation to Mars (2018) (13)
Antiproliferative activity on human prostate carcinoma cell lines of new peptidomimetics containing the spiroazepinoindolinone scaffold. (2013) (13)
Dynamic Probabilistic Networks for Modelling and Identifying Dynamic Systems: a MCMC Approach (1997) (13)
Temporal Variation in the Trophic Levels of Secondary Consumers in a Mediterranean Coastal Lagoon (Cabras Lagoon, Italy) (2017) (13)
Consistent patterns of spatial variability between NE Atlantic and Mediterranean rocky shores (2016) (13)
Population dynamics and secondary production of Donax trunculus (Mollusca, Bivalvia) in the Gulf of Annaba (Northeast Algeria) (2016) (13)
Adipokines and Sexual Hormones Associated with the Components of the Metabolic Syndrome in Pharmacologically Untreated Subjects: Data from the Brisighella Heart Study (2011) (12)
Spatiotemporal variation in environmental features and elemental/isotopic composition of organic matter sources and primary producers in the Yundang Lagoon (Xiamen, China) (2019) (12)
Expression of Functional Ciliary Neurotrophic Factor Receptors in Immortalized Gonadotrophin‐Releasing Hormone‐Secreting Neurones (2005) (12)
LEPTIN, RESISTIN, AND PCSK9 - THE ROLE OF STAT3. (2020) (12)
Oxidative Stress Modulation by Cameroonian Spice Extracts in HepG2 Cells: Involvement of Nrf2 and Improvement of Glucose Uptake (2020) (12)
Metabolic Syndrome, Adipokines and Hormonal Factors in Pharmacologically Untreated Adult Elderly Subjects from the Brisighella Heart Study Historical Cohort (2012) (12)
Pharmacokinetic/pharmacodynamic modeling of etoposide tumor growth inhibitory effect in Walker‐256 tumor‐bearing rat model using free intratumoral drug concentrations (2017) (12)
Adherence to the Mediterranean Diet: Impact of Geographical Location of the Observations (2022) (12)
δ13C and δ15N variations in organic matter pools, Mytilus spp. and Macoma balthica along the European Atlantic coast (2013) (12)
A Perl procedure for protein identification by Peptide Mass Fingerprinting (2009) (12)
Analysis of amplicon-based NGS data from neurological disease gene panels: a new method for allele drop-out management (2016) (11)
Hydroethanolic plant extracts from Cameroon positively modulate enzymes relevant to carbohydrate/lipid digestion and cardio-metabolic diseases. (2019) (11)
Dietary Cameroonian Plants Exhibit Anti-Inflammatory Activity in Human Gastric Epithelial Cells (2020) (11)
Experimental measurements and mathematical modeling of biological noise arising from transcriptional and translational regulation of basic synthetic gene circuits. (2016) (11)
Temporal changes of a food web structure driven by different primary producers in a subtropical eutrophic lagoon. (2020) (11)
GABA-B1 Receptor-Null Schwann Cells Exhibit Compromised In Vitro Myelination (2018) (11)
Hydromethanolic Extracts from Adansonia digitata L. Edible Parts Positively Modulate Pathophysiological Mechanisms Related to the Metabolic Syndrome (2020) (11)
BDNF Val66Met polymorphism alters food intake and hypothalamic BDNF expression in mice (2020) (11)
Variance based global sensitivity analysis of physiologically based pharmacokinetic absorption models for BCS I–IV drugs (2018) (10)
Essence of the patterns of cover and richness of intertidal hard bottom communities: a pan-European study (2016) (10)
Quality Assessment of Hemodialysis Services through Temporal Data Mining (2003) (10)
Disentangling heterogeneity and commonalities in nanotidal Mediterranean lagoons through environmental features and macrozoobenthic assemblages (2020) (10)
Anti-Müllerian Hormone, Growth Hormone, and Insulin-Like Growth Factor 1 Modulate the Migratory and Secretory Patterns of GnRH Neurons (2021) (10)
Assessing the impact of the Asian mussel Arcuatula senhousia in the recently invaded Oristano Lagoon-Gulf System (W Sardinia, Italy) (2015) (10)
Interlinked temporal changes in environmental conditions, chemical characteristics of sediments and macrofaunal assemblages in an estuarine intertidal sandflat (Seto Inland Sea, Japan) (2006) (10)
A machine learning approach based on ACMG/AMP guidelines for genomic variant classification and prioritization (2022) (10)
The role of physical variables in biodiversity patterns of intertidal macroalgae along European coasts (2016) (10)
Total, free and bound leptin and thyroid function in elderly women with different body weights (2008) (10)
Improving Dialysis Services through Information Technology: From Telemedicine to Data Mining (2001) (10)
Temporal distribution of intertidal macrozoobenthic assemblages in a Nanozostera noltii-dominated area (Lagoon of Venice). (2016) (10)
Suppressor of Cytokine Signaling-3 ( SOCS-3 ) induces Proprotein Convertase Subtilisin Kexin Type 9 ( PCSK 9 ) expression in hepatic HepG 2 cell line * (2015) (10)
A New Approach for the Analysis of Mass Spectrometry Data for Biomarker Discovery (2006) (9)
Trophic Features, Benthic Recovery, and Dominance of the Invasive Mytilopsis Sallei in the Yundang Lagoon (Xiamen, China) Following Long-Term Restoration (2019) (9)
Inflammaging and neurodegenerative diseases: Role of NLRP3 inflammasome activation in brain atherosclerotic vascular disease (2021) (9)
Aldosterone receptor antagonists: Biology and novel therapeutic applications (2005) (9)
Modeling tumor growth inhibition and toxicity outcome after administration of anticancer agents in xenograft mice: A Dynamic Energy Budget (DEB) approach. (2018) (9)
Model‐Based Assessment of Alternative Study Designs in Pediatric Trials. Part II: Bayesian Approaches (2016) (9)
A procedure to decompose high resolution mass spectra (2007) (9)
Role of the energy sensor adenosine monophosphate-activated protein kinase in the regulation of immature gonadotropinreleasing hormone neuron migration (2011) (9)
1280 DIETARY IRON OVERLOAD INDUCES VISCERAL ADIPOSE TISSUE INSULIN RESISTANCE ASSOCIATED WITH HYPER-RESISTINEMIA, AND SYNERGIZES WITH OBESITY AND FATTY LIVER IN INDUCING SYSTEMIC INSULIN RESISTANCE (2011) (9)
Compartmental model identification based on an empirical Bayesian approach: The case of thiamine kinetics in rats (2001) (9)
A Synthetic Close-Loop Controller Circuit for the Regulation of an Extracellular Molecule by Engineered Bacteria (2019) (8)
Meiofaunal Dynamics and Heterogeneity along Salinity and Trophic Gradients in a Mediterranean Transitional System (2019) (8)
In vitro cell growth pharmacodynamic studies: a new nonparametric approach to determining the relative importance of drug concentration and treatment time (2003) (8)
Optimal Design for Informative Protocols in Xenograft Tumor Growth Inhibition Experiments in Mice (2016) (8)
Leptin actions on the reproductive axis. (2001) (8)
Laboratory Experiments on Bivalve Excretion Rates of Nutrients (2005) (8)
MAMA—Towards a new paradigm for ocean monitoring in the Mediterranean (2003) (8)
Interactions of Oxysterols with Atherosclerosis Biomarkers in Subjects with Moderate Hypercholesterolemia and Effects of a Nutraceutical Combination (Bifidobacterium longum BB536, Red Yeast Rice Extract) (Randomized, Double-Blind, Placebo-Controlled Study) (2021) (8)
Bicuspid aortic valve, atherosclerosis and changes of lipid metabolism: Are there pathological molecular links? (2019) (8)
Integrative Analysis of Multi-Omics and Genetic Approaches—A New Level in Atherosclerotic Cardiovascular Risk Prediction (2021) (8)
A Bioinformatics Approach to Explore MicroRNAs as Tools to Bridge Pathways Between Plants and Animals. Is DNA Damage Response (DDR) a Potential Target Process? (2019) (8)
Population Pharmacokinetic Modeling of Etoposide Free Concentrations in Solid Tumor (2016) (8)
Model‐Based Assessment of Alternative Study Designs in Pediatric Trials. Part I: Frequentist Approaches (2016) (7)
Building in-house PBPK modelling tools for oral drug administration from literature information (2019) (7)
Quantification of the gene silencing performances of rationally-designed synthetic small RNAs (2015) (7)
Contribution of binge eating behaviour to cardiometabolic risk factors in subjects starting a weight loss or maintenance programme (2016) (7)
Re-using biological devices: a model-aided analysis of interconnected transcriptional cascades designed from the bottom-up (2017) (7)
Hypothalamic neuropeptide systems as targets for potential anti-obesity drugs. (2007) (7)
Joint analysis of macrofaunal and meiofaunal assemblages improves the assessment of lagoonal environmental heterogeneity (2022) (7)
A Minimal Model of Tumor Growth Inhibition in Combination Regimens Under the Hypothesis of No Interaction Between Drugs (2012) (7)
Application of Artificial Neural Networks to Predict the Intrinsic Solubility of Drug-Like Molecules (2021) (7)
In Vitro Chronic Administration of ERbeta Selective Ligands and Prostate Cancer Cell Growth: Hypotheses on the Selective Role of 3beta-Adiol in AR-Positive RV1 Cells (2014) (7)
A Population Dynamic Energy Budget-Based Tumor Growth Inhibition Model for Etoposide Effects on Wistar Rats (2019) (7)
TGI-Simulator: A visual tool to support the preclinical phase of the drug discovery process by assessing in silico the effect of an anticancer drug (2012) (7)
Erratum to “The natural antioxidant alpha-lipoic acid induces p27Kip1-dependent cell cycle arrest and apoptosis in MCF-7 human breast cancer cells” [Eur. J. Pharmacol. 641 (2010) 29-34] (2011) (7)
A tumor-in-host DEB-based approach for modeling cachexia and bevacizumab resistance. (2019) (7)
Impact of Soy β-Conglycinin Peptides on PCSK9 Protein Expression in HepG2 Cells (2021) (6)
Nutraceuticals for Dyslipidaemia and Glucometabolic Diseases: What the Guidelines Tell Us (and Do Not Tell, Yet) (2022) (6)
Influence of the level of oxygenation in sediment and water on copper bioavailability to marine bivalves: laboratory experiments and translocation experiments in the field (1998) (6)
Increased circulating adiponectin in males with chronic HCV hepatitis. (2015) (6)
Mathematical modeling of efficacy and safety for anticancer drugs clinical development (2018) (6)
Hydroethanolic Extract of Prunus domestica L.: Metabolite Profiling and In Vitro Modulation of Molecular Mechanisms Associated to Cardiometabolic Diseases (2022) (6)
Cameroonian Spice Extracts Modulate Molecular Mechanisms Relevant to Cardiometabolic Diseases in SW 872 Human Liposarcoma Cells (2021) (6)
Inter-compound and Intra-compound Global Sensitivity Analysis of a Physiological Model for Pulmonary Absorption of Inhaled Compounds (2020) (6)
A generic framework to assess the representation and protection of benthic ecosystems in European marine protected areas (2020) (6)
Engineering endogenous fermentative routes in ethanologenic Escherichia coli W for bioethanol production from concentrated whey permeate. (2020) (6)
Microphytobenthic biomass, diversity and exopolymeric substances ina shallow dystrophic coastal lagoon (2018) (6)
New cost-effective, interoperable sensors tested on existing ocean observing platforms in application of European directives: The COMMON SENSE European project (2015) (5)
A new approach to optimal dynamic therapy planning (1998) (5)
A Dynamic Energy Budget (DEB) based modeling framework to describe tumor-in-host growth inhibition and cachexia onset during anticancer treatment in in vivo xenograft studies (2021) (5)
Modelling the effects of cell-to-cell variability on the output of interconnected gene networks in bacterial populations (2015) (5)
The zebrafish model system for dyslipidemia and atherosclerosis research: Focus on environmental/exposome factors and genetic mechanisms. (2022) (5)
Interlinked seasonal variation in biogenic nutrient fluxes and pore-water nutrient concentrations in intertidal sediments (2014) (5)
A BioBrick™-Compatible Vector for Allelic Replacement Using the XylE Gene as Selection Marker (2016) (4)
Electronic conference on 'The Southern and Eastern Mediterranean Sea and the Black Sea: new challenges for marine biodiversity research and monitoring': summary of discussions, 6 to 24 September, 2004 (2004) (4)
Cholinergic regulation of neuropeptide Y synthesis and release in human neuroblastoma cells (2008) (4)
Correction: Bottom-Up Engineering of Biological Systems through Standard Bricks: A Modularity Study on Basic Parts and Devices (2012) (4)
Aldosterone receptor antagonists: Biology and novel therapeutical applications (2003) (4)
In Vitro–In Vivo Correlation (IVIVC) Population Modeling for the In Silico Bioequivalence of a Long-Acting Release Formulation of Progesterone (2021) (4)
Modeling restoration of gefitinib efficacy by co‐administration of MET inhibitors in an EGFR inhibitor‐resistant NSCLC xenograft model: A tumor‐in‐host DEB‐based approach (2021) (4)
Mechanistic Models of Inducible Synthetic Circuits for Joint Description of DNA Copy Number, Regulatory Protein Level, and Cell Load (2019) (4)
Space Flight-Promoted Insulin Resistance as a Possible Disruptor of Wound Healing (2022) (4)
Methods for genetic optimization of biocatalysts for biofuel production from dairy waste through synthetic biology (2015) (4)
Leptin Actions on the Reproductive Axis (2003) (4)
Polyphenol-Rich Extracts of Xylopia and Aframomum Species Show Metabolic Benefits by Lowering Hepatic Lipid Accumulation in Diet-Induced Obese Mice (2022) (4)
Osteocalcin-expressing endothelial progenitor cells and serum osteocalcin forms are independent biomarkers of coronary atherosclerotic disease severity in male and female patients (2022) (3)
Use of prior knowledge and extrapolation in paediatric drug development: A case study with deferasirox. (2019) (3)
Analysing Italian voluntary abortion data using a Bayesian approach to the time series decomposition (2004) (3)
Precedence temporal networks from gene expression data (2005) (3)
A multidisciplinary study on the dynamics of biophilic elements in a tidal estuary in the Seto Inland Sea, Japan (1998) (3)
Effects of an invasive mussel, Arcuatula senhousia, on local benthic consumers: a laboratory 13C‐labeling study (2016) (3)
Ethambutol disposition in humans: challenges and limitations of whole-body physiologically-based pharmacokinetic modelling in early drug development. (2020) (3)
Indicators of Stress in the Marine Benthos: Proceedings of an International workshop on the promotion and use of benthic tools for assessing the health of coastal marine ecosystems, Torregrande-Oristano, Italy 8-9 October 2004 (2005) (3)
Inferring gene expression networks via static and dynamic data integration (2006) (3)
Adiponectin in nonalcoholic fatty liver disease : correlation with liver damage and PNPLA3 genotype (2011) (3)
Clinical practice gaps and challenges in non‐alcoholic steatohepatitis care: An international physician needs assessment (2022) (3)
Gibbs Sampling for Signal Reconstruction (1997) (3)
Modeling approaches for reducing safety-related attrition in drug discovery and development: a review on myelotoxicity, immunotoxicity, cardiovascular toxicity, and liver toxicity (2021) (3)
5 – Parameter Estimation (2014) (3)
Mathematical modeling of growth and death dynamics of mouse embryonic stem cells irradiated with γ-rays. (2014) (3)
23 – Modelling for Synthetic Biology (2014) (3)
indexes? of glucose effectiveness and insulin sensitivity The hot IVGTT two-compartment minimal model: (2011) (2)
Complex Bayesian Modeling Workflows Encoding and Execution Made Easy With a Novel WinBUGS Plugin of the Drug Disease Model Resources Interoperability Framework (2018) (2)
Pro-inflammatory cytokines and adipokines regulate PCSK9 expression in HepG2 cells (2017) (2)
Physical and Chemical Variability of Tidal Streams (2005) (2)
Temporal Scaling of Benthic Nutrient Regeneration in Bivalve-Dominated Tidal Flat (2005) (2)
Hierarchical Naive Bayes Classifiers for uncertain data ? (2006) (2)
Characterisation of individual ferritin response in patients receiving chelation therapy (2022) (2)
Translational model-based approach to assist the dose-range selection of an antibody-drug conjugate entering Phase I (2017) (2)
Clustering gene expression data with Temporal Abstractions (2004) (2)
Prediction of the Effect of Renal Impairment on the Pharmacokinetics of New Drugs (2018) (2)
A translational model-based approach to inform the choice of the dose in phase 1 oncology trials: the case study of erdafitinib (2021) (2)
Progress and prospects of biological approaches targeting PCSK9 for cholesterol-lowering, from molecular mechanism to clinical efficacy (2020) (2)
Somatostatin (SS), SS receptors and SS analog treatment in tumorigenesis (2012) (2)
CRISPR interference as low burden logic inverters in synthetic circuits: characterization and tuning (2020) (2)
A minimal model describing the effect of drug administration on tumor growth dynamics (2006) (2)
F-17 Dietary iron overload induces visceral adipose tissue insulin resistance and hyper-resistinemia, and synergizes with obesity and fatty liver in inducing systemic insulin resistance (2011) (2)
Assessing the Glucose Time Course in Critically Ill Patients by a Mathematical Model (2011) (2)
Online Microreactor Titanium Dioxide RPLC-LTQ-Orbitrap MS Automated Platform for Shotgun Analysis of (Phospho) Proteins in Human Amniotic Fluid (2013) (2)
PhosphoHunter: An Efficient Software Tool for Phosphopeptide Identification (2015) (2)
Life-Style And Cardio-Metabolic Profile Of A Population Living In A Clustered Alpine Village (The Plic Chiesa Study): Comparison With An Urban Cohort (Plic Study) (2019) (1)
Nutrient Analysis in Arctic Waters Using a Portable Sensing Platform (2021) (1)
Taxonomic vs functional patterns across European marine benthic habitats: using research infrastructures (LIFEWATCH, ESFRI) in large-scale ecology (2016) (1)
872 ADIPONECTIN IN NONALCOHOLIC FATTY LIVER DISEASE: CORRELATION WITH LIVER DAMAGE AND PNPLA3 GENOTYPE (2011) (1)
A one-year review of patients admitted to tertiary HIV/Neuropsychiatry beds in the Western Cape (2008) (1)
7 – Population Modelling (2014) (1)
Functional genomics meta-analysis to identify gene set enrichment networks in cardiac hypertrophy (2021) (1)
NPY (neuropeptide Y) (2011) (1)
Seasonal Coupling Between Intertidal Macrofauna and Sediment Column Porewater Nutrient Concentrations (2005) (1)
Mechanistic Multiscale Pharmacokinetic Model for the Anticancer Drug 2’,2’‐difluorodeoxycytidine (Gemcitabine) in Pancreatic Cancer (2020) (1)
Soya-enriched mixed diet significantly improves cardiovascular and metabolic risk factors: A randomized controlled trial (2016) (1)
TNF-alpha induces proprotein convertase subtilisin kexin type 9 (PCSK9) expression in hepatic HepG2 cell line in a SOCS-3-dependent manner (2016) (1)
Summarizing Probe Intensities of Affymetrix GeneChip 3' Expression Arrays Taking into Account Day-to-Day Variability (2011) (1)
The Optimal Dynamic Therapy: a Decision-theoretic Approach (1998) (1)
Liver fat accumulation is associated with circulating PCSK9 levels (2015) (1)
Characterization of an inducible promoter in different DNA copy number conditions (2012) (1)
Microarray Data Analysis: Gene Regulatory Networks (2011) (1)
Plasma Levels of Proprotein Convertase Subtilisin/Kexin Type 9 Are Inversely Associated with N-Terminal Pro B-Type Natriuretic Peptide in Older Men and Women (2022) (1)
Spatio-temporal variability of microphytobenthos in the coastal lagoon of Cabras (Sardinia, Italy) (2011) (1)
Ship‐Mounted Acoustic Doppler Current Profiler (ADCP): Characteristics and Field Applications to Measure Coastal Hydrodynamics (2019) (1)
A Population Pharmacokinetic Model of Macitentan and Its Active Metabolite Aprocitentan in Healthy Volunteers and Patients with Pulmonary Arterial Hypertension (2021) (1)
NPY1R (neuropeptide Y receptor Y1) (2011) (1)
NPY family of peptides in endocrine, breast and prostate tumors (2005) (1)
Half-life measurements of chemical inducers for recombinant gene expression (2014) (1)
Paolo Common Carotid Artery Leptin : Adiponectin Ratio Is an Independent Predictor of Intima Media Thickness of the (2007) (1)
SOCS-3 induces proprotein convertase subtilisin kexin type 9 (PCSK9) expression in hepatic HepG2 cell line: a potential link between hypertriglyceridemia and insulin resistance (2016) (1)
GIBBS SAMPLING FOR SIGNALRECONSTRUCTIONRiccardo (1997) (0)
Erratum to: Interlinked temporal changes in environmental conditions, chemical characteristics of sediments and macrofaunal assemblages in an estuarine intertidal sandflat (Seto Inland Sea, Japan) (2007) (0)
TGGAGAGCGAGGGCTTTG TCACTGCATGTGAGGGAAAG GTGCACACTCCATTGCATTC CTGCCTGGCTTCCTCTTCA ACCAATGAGTTTCCGACCAG GCATACCGCGATTCCTTTT CTCGGACCATGCTAGGACAGTAG CCTCCAGCAACTCTCCTTTG CCATGTTTTGACCAATGCTG C TTCTGGGTAGACCTCTGGGAGTTCC (2017) (0)
Regular Consumption of a Balanced Salmon-Based Salty Snack Does Not Affect Energy Intake, Body Composition and Biochemical Parameters in Healthy Volunteers (2013) (0)
Characterization of regulatory parts for the metabolic engineering of E. coli and B. subtilis: applications in the conversion of bio-waste into biofuels and bioproducts (2017) (0)
Method and instrument for the injection of samples in gas chromatography (2004) (0)
A PK/PD model for tumor-in-host growth kinetics following administration of an antiangiogenic agent given alone or in combination regimens (2017) (0)
Towards the management of transitional waters: assessing the potential of benthic tools (2010) (0)
STAT3 inhibition induces PCSK9 in hepatic cell line: possible involvement in hypertriglyceridemia associated with insulin resistance (2015) (0)
Gonadotropin-releasing hormone-secreting neuron development and function: an update. (2022) (0)
Could Iron Overload Impair the Migratory Ability of Neurons? Evidence from a Cell-Based Model (2012) (0)
Evaluation of software tools for Bayesian estimation on population models:an update based on current software versions (2018) (0)
Clinical Classification of Myelofibrosis with Myeloid Metaplasia (MMM): Cluster Analysis of 861 Patients Enrolled into a Nationwide Prospective Registry (RIMM). (2005) (0)
Possibilities of integration of monitoring requirements by other EU and national legislation (2016) (0)
A comparison of eVai, CADD and VVP variant prediction results on the ICR639 hereditary cancer dataset (2019) (0)
EFFECT OF SOMATOSTATIN RECEPTOR (SSTS) SUB-CELLULAR LOCALIZATION AND DIMERIZATION ON MONO- AND BI-SPECIFIC SOMATOSTATIN ANALOGS ANTIPROLIFERATIVE EFFECTS IN DU-145 AND PC-3 HUMAN ANDROGEN-INDEPENDENT PROSTATE CANCER CELLS (2013) (0)
Introduction to Topic 2.5: Regional and international cooperation and comparative situations in the Mediterranean and Black Seas (2004) (0)
Microarray Data Analysis: General Concepts, Gene Selection, and Classification (2011) (0)
Iron overload impairs the migratory ability of a model of immature and migratory GnRH neurons (2013) (0)
P1 Circulating adiponectin levels as a predictive factor of breast cancer in a double-blind 2×2 phase II trial of low-dose tamoxifen and fenretinide for breast cancer prevention (2010) (0)
Summary of discussions on Topic 2.1: Endangered biodiversity and management of marine protected areas, wetlands, lagoons, estuaries and seagrass meadows (2004) (0)
Variability of microphytobenthos communities in a shallow lagoon: Cabras (Sardinia, Italy) (2010) (0)
PCSK9 expression is regulated by pro-inflammatory cytokines and adipokines in HEPG2 cells (2016) (0)
Introduction to Topic 2.4: Environmental variability and biodiversity predictability: data collection and ocean models- what to do? (2004) (0)
Insulin-like growth factor system in skeletal muscle in Amyotrophic Lateral Sclerosis (2008) (0)
Common discussion and synthesis: summary (2004) (0)
Insulin-like Growth Factor-1 profiling in Amyotrophic Lateral Sclerosis (ALS) (2006) (0)
Impact of enzyme inter-correlation on global sensitivity analysis of PBPK models: a case study with repaglinide (2018) (0)
Mining DNA Microarray Gene Expression Data (2009) (0)
In-Silico and in-Vivo Metabolic Engineering Strategies to Optimize Waste Bioconversion Pathways in Microbial Strains: Two Case Studies on Ethanol and Poly-Gamma-Glutamic Acid Biosynthesis (2018) (0)
Summary of discussions on Topic 2.4: Environmental variability and biodiversity predictability: data collection and ocean models - what to do? (2004) (0)
Atlas of Genetics and Cytogenetics in Oncology and Haematology (2010) (0)
Re-using Biological Devices: Characterization and Mathematical Modeling of Protein- and CRISPRi-mediated Regulation Devices to Design Predictable Interconnected Circuits with Reduced Cell Load (2018) (0)
Validation of a workflow for the detection of small copy number variation from gene panels NGS data (2018) (0)
Erratum to "Effects of Zostera marina on the patterns of spatial distribution of sediments and macrozoobenthos in the boreal lagoon of Furen (Hokkaido, Japan)" [Mar. Environ. Res. 131 (2017) 90-102]. (2018) (0)
KING-REX: a custom end-to-end solution for kinome gene expression profiling (2018) (0)
A model-based approach to extrapolate drug-drug interactions from rats to humans (2017) (0)
COMMON SENSE Deliverable (2014) (0)
Summary of discussions on Topic 2.5: Regional and international cooperation and comparative situations in the Mediterranean and Black Seas (2004) (0)
Learning gene regulatory networks with an Intelligent data analysis approach : an application to the yeast cell cycle (2005) (0)
Leptin and resistin affect PCSK9 expression: In vitro and in vivo evidence (2018) (0)
T-11 Adiponectin in nonalcoholic fatty liver disease: Correlation with liver damage and PNPLA3 genotype (2011) (0)
In-situ testing of innovative marine instrumentation for nutrients, heavy metals and pH in Kongsfjorden, Svalbard Islands (2016) (0)
A Bayesian Nonparametric Approach to AUC Determination in Population Studies (2000) (0)
Temporal expression analysis to elucidate regulatory mechanisms of heart development. (2009) (0)
Instant Connect Gas Sampling Valve Module Introducing a New Flexibility in Gas Sampling for GC and GC-MS (2014) (0)
GABA-B1 Receptor-Null Schwann Cells Exhibit Compromised In Vitro Myelination (2018) (0)
RESPONSES OF BENTHIC INDICATORS IN ITALIAN COASTAL TRANSITIONAL ECOSYSTEMS (2009) (0)
Improving Phosphopeptides Identification by MS/MS Spectra Analysis: A NewPerl Software Tool (2011) (0)
Glucose and lipid homeostasis during confinement in a 520-day simulated interplanetary mission to Mars (2015) (0)
Gold nanocages for imaging and therapy of prostate cancer cells (2016) (0)
Prediction of ferritin response to chelation in patients affected by transfusion-dependent haemoglobinophaties (2018) (0)
Tidally Mediated Changes in Nutrient Concentrations (2005) (0)
Editorial Collaborators (2017) (0)
Corrigendum to “Regulation of prostate cancer cell proliferation by somatostatin receptor activation” [Mol. Cell. Endocrinol. 315 (1–2) (2010) 254–262] (2011) (0)
A novel method for proteomic analysis of immunoglobulin light chains and attribution to a germline gene-based family (2011) (0)
BY 1 SOMATOSTATIN RECEPTOR ACTIVATION 2 3 4 ABBREVIATED TITLE : SRIF receptor activation in prostate cancer 5 6 (2019) (0)
F1000 recommendations - Cell Metabolism 2011 (2013) (0)
Web discussions on cardiovascular diseases: assessing the impact of COVID-19 pandemic. An Italian prospective analysis (2021) (0)
Somatostatin and dopamine receptor dimerization in prostate and lung tumor cell lines (2009) (0)
Somatostatin and dopamine receptor regulation and effects of a new somatostatin/dopamine chimeric compound on cell proliferation of the human androgen-dependent prostate cancer cell line LNCaP (2007) (0)
Analysis of intergenic conserved sequences in the POF critical region on X chromosome (2003) (0)
Which data are necessary to build a WB-PBPK model that accurately predicts exposure in the lung? A case study using Ethambutol for tuberculosis treatment (2017) (0)
Rational engineering of protein- and CRISPRi- mediated regulation devices to design predictable interconnected circuits with reduced cell load (2017) (0)
Analysis of relevant technical issues and deficiencies of the existing sensors and related initiatives currently set and working in marine environment. New generation technologies for cost-effective sensors (2014) (0)
[OP.1A.10] CIRCULATING LEVELS OF PCSK9 AND ARTERIAL STIFFNESS IN A LARGE POPULATION SAMPLE: DATA FROM THE BRISIGHELLA HEART STUDY (2017) (0)
INDICATORS OF STRESS IN THE MARINE BENTHOS (2014) (0)
Helium saving device for a gas chromatograph (2011) (0)
Is ghrelin a potential signal of decreased fat-free mass in elderly subjects? (2006) (0)
Correction to: Nutraceutical approach for the management of cardiovascular risk – a combination containing the probiotic Bifidobacterium longum BB536 and red yeast rice extract: results from a randomized, double-blind, placebo-controlled study (2019) (0)
Effect of soy on metabolic syndrome and cardiovascular risk factors: Evidence from a randomized controlled trial (2017) (0)
Review of existing and operable observing systems and sensors (2014) (0)
Phosphopeptide identification: an automated Perl procedure (2010) (0)
Day-to-day variability in microarray experiment: a new algorithm to summarize probe levels and minimize this effect (2008) (0)
SEX HORMONES AND ADIPOKINES IN HEALTHY PRE-MENOPAUSAL, POST-MENOPAUSAL AND ELDERLY WOMEN, AND IN AGE-MATCHED MEN: DATA FROM THE BRISIGHELLA HEART STUDY: PP.34.374 (2010) (0)
Selective ERbeta activation leads to somatostatin receptor up-regulation in prostate cancer cells (2014) (0)
humanssimulated by head-down bed rest in Increase in epinephrine-induced responsiveness during (2015) (0)
Optimal Design for Informative Protocols in Xenograft Tumor Growth Inhibition Models (2015) (0)
Somatostatin and Dopamine Receptor Dimerization in Prostate and Lung Tumors (2009) (0)
Serum Irisin levels and metabolic state in amyotrophic lateral sclerosis (2015) (0)
Circulating PCSK9 Levels are Associated with the Hepatic Fat in Non-Alcoholic Fatty Liver Disease (2016) (0)
Cardiometabolic profile in PLIC-MI and PLIC-CHIESA cohorts: Comparison of two different geographic settings (2020) (0)
An energy based model able to describe the effect of anticancer drugs on tumor growth and host body weight (2014) (0)
Precedence Temporal Networks: a New Tool for Extracting Temporal Relationships in Gene Expression Profiles (2005) (0)
Summary of discussions on Topic 1.3: Historical data sets and grey literature: the value of "real" data and the need for quality control (2004) (0)
Somatostatin and prostate cancer: role of somatostatin receptors in the control of tumor growth (2013) (0)
Improving protein identification by MsPI using peak intensity (2009) (0)
Efficient conversion of industrial bio-waste into biofuels and bioproducts through E. coli and B. subtilis synthetic biology (2017) (0)
Leptin and resistin affect PCSK9 expression via STAT3 involvement. (2017) (0)
Precedence Temporal Networks: Extraction and Representation of Temporal Relationships in Gene Expression Profiles (2005) (0)
A Bayesian method for clustering gene expression temporal profiles from microarray data (2004) (0)
A standard vector for the chromosomal integration and characterization of BioBrick™ parts in Escherichia coli (2013) (0)
Replacement, Reduction, and Refinement of Animal Experiments in Anticancer Drug Development: The Contribution of 3D In Vitro Cancer Models in the Drug Efficacy Assessment (2023) (0)
Accounting for inter-correlation between enzyme abundance: a simulation study to assess implications on global sensitivity analysis within physiologically-based pharmacokinetics (2019) (0)
Synthetic and systems biology for cost-competitive γ-PGA production (2017) (0)
P285 EFFECT OF MEDITERRANEAN DIET-INDUCED WEIGHT LOSS ON PLASMA CYTOKINE LEVELS AND ABDOMINAL VISCERAL FAT IN OBESE WOMEN (2009) (0)
CRISPR Interference Modules as Low-Burden Logic Inverters in Synthetic Circuits (2022) (0)
Evaluation of a minimal WB-PBPK platform supporting different routes of administration (2017) (0)
Adipose tissue related adipokines and cytokines regulate PCSK9 expression in HepG2 cells (2016) (0)
Apr 28, 2019 Integration of enzymatic data in Bacillus subtilis genome-scale metabolic model improves phenotype predictions and enables in silico design of poly--glutamic (2019) (0)
Circulating levels of PCSK9 and arterial stiffness in a large population sample: Data from the brisighella heart study. (2017) (0)
Inferring gene expression networks through static and dynamic data integration (2006) (0)
Method and device for carrier gas flow rate control in a chromatograph (1995) (0)
Whole-body PBPK model for a translational study of Azathioprine pharmacokinetics (2018) (0)
Sensor monitoring strategy (2016) (0)
Neuropeptide Y-Y1 receptors mediate the effects of neuropeptide Y on prostate cancer cell growth (2006) (0)
P050 PHARMACOKINETIC OF ORAL MELATONIN IN CRITICALLY ILL PATIENTS (2008) (0)
Arrangement for introduction of samples in analysis devices (1993) (0)
Characterization and sub-cellular localization of somatostatin receptors in DU-145 and PC-3 human androgen-independent prostate cancer cells: effect of mono- and bi-specific somatostatin analogs on cell growth (2013) (0)
Plasma PCSK9 levels and lipoprotein distribution are preserved in patients with severe hypoalphalipoproteinemia. (2017) (0)
Gender-specific comparison of six QT correction formulae in dyslipidemic patients in primary prevention (2013) (0)
A Population Dynamic Energy Budget-Based Tumor Growth Inhibition Model for Etoposide Effects on Wistar Rats (2019) (0)
[28] ADIPOKINES AND SEX HORMONES ARE DIFFERENTLY ASSOCIATED TO CARDIOMETABOLIC RISK FACTORS IN A RANDOMIZED SAMPLE OF ADULT-ELDERLY HEALTHY SUBJECTS: THE BRISIGHELLA HEART STUDY (2009) (0)
Population Pharmacokinetic Modeling of Etoposide Free Concentrations in Solid Tumor (2016) (0)
Abstract A61: Circulating adiponectin levels as a predictive factor of breast cancer in a double-blind 2x2 phase II trial of low-dose tamoxifen and fenretinide for breast cancer prevention (2010) (0)
A Bayesian approach to non-parametric AUC estimation in population studies (2003) (0)
Protein identification by MsPI software tool: implementation of a scoring function intensity-based (2009) (0)
Effects of somatostatin analogs on cell proliferation of DU-145 and PC-3 human androgen-indipendent prostate cancer cell lines. (2012) (0)
EDITORIAL [Hot Topic: Novel Approaches to the Drug Therapy of Obesity (Guest Editor: Prof. Paolo Magni)] (2007) (0)
NPY 1 R ( neuropeptide Y receptor Y 1 ) (2012) (0)
Hormonal Treatments of Endocrine-Dependent Tumors: Preclinical Aspects (2003) (0)
Heart rate correction of the QT interval: A nonparametric individualized approach (2008) (0)
ENDOCRINE ADAPTATIONS TO SIMULATED MICROGRAVITY (2010) (0)
Introduction to Topic 1.3: Historical data sets and grey literature: the value of 'real' data and the need for quality control (2004) (0)
Synthetic Biology Approaches for the Rational Engineering of Novel E. coli and B. subtilis Biocatalysts for the Conversion of Industrial Bio-Wasteinto Biofuels and Bioproducts (2017) (0)
Mining biomedical timeseries bycombining structural analysis andtemporal abstractions (1998) (0)
Optimal Design for Informative Protocols in Xenograft Tumor Growth Inhibition Experiments in Mice (2016) (0)
Response to Letter by Kotani et al (2008) (0)
Somatostatin receptor regulation and effects of somatostatin and somatostatin analogues on cell proliferation of the human androgen-dependent prostate cancer cell line LNCaP (2007) (0)
Paediatric trial design optimization using prior knowledge in combination with modelling & simulations (2017) (0)
Comprehensive kinome NGS targeted expression profiling by KING-REX (2019) (0)
Field testing, validation and optimization report (2016) (0)
A potential mechanism for copper amplification of prostaglandin E2 action: attenuation of prostaglandin E2-induced efflux of cyclic AMP from median eminence explants. (1991) (0)
Setting the scene: biodiversity and ecosystem services in the Asia-Pacific region (2018) (0)
Variance based global sensitivity analysis of physiologically based pharmacokinetic absorption models for BCS I–IV drugs (2018) (0)
A bioinformatic approach to predict the cross-kingdompotential of plant miRNA in humans (2018) (0)
Leptin Actions on the Reproductive System (2016) (0)
CA-IMT and QT parameters in dyslipidemic patients in primary prevention at different ESC/EAS cardiovascular risk levels (2013) (0)
MsPI: a tool for the analysis of peptide mass fingerprinting data (2008) (0)
Structural analysis of the abortion time series reported in the ISTAT summaries (2001) (0)
Automatic translation of Bayesian pharmacometric models: the PharmML-to-WinBugs converter (2015) (0)
In-situ detection of nutrients in Kongsfjorden, Svalbard Islands using a cost effective nutrient sensor (2018) (0)
Serum osteocalcin forms and osteocalcin-expressing endothelial progenitor cells are independent biomarkers of coronary atherosclerotic disease severity (2022) (0)
Efficacy and safety of a nutraceutical with probiotic and red yeast rice extract in patients with moderate hypercholesterolemia: A randomized, double-blind, placebo-controlled study. (2017) (0)
Optimal age and strategy for screening hereditary hemochromatosis. The answers from a Markov decision process (1999) (0)
03 - LIFE-STYLE AND CARDIO-METABOLIC PROFILE OF A POPULATION LIVING IN A CLUSTERED ALPINE VILLAGE (THE PLIC CHIESA STUDY): COMPARISON WITH AN URBAN COHORT (PLIC STUDY) (2019) (0)
Tumor growth modelling for drug development (2014) (0)
Assessing vascular aging in young subjects with obesity: Usefulness and critical issues. (2022) (0)
Procedures of sensors deployment methodology on physical supports/platforms (2014) (0)
Leukemia inhibitory factor promotes the chemomigration of immature GNRH neurons (2006) (0)
Protocols for the field testing (2015) (0)
Evaluation of the health benefits of soy protein consumption in patients carrying the metabolic syndrome (2015) (0)
High Density Lipoproteins Inhibit Oxidative Stress-Induced Prostate Cancer Cell Proliferation (2018) (0)
Overcome Metabolic Burden in Rational Design of Genetic Synthetic Circuits: Deep Characterization of a Crispri Alternative (2018) (0)
STOCHASTIC CONTROL WITH GRAPHICAL MODELS : THEINFLUENCE VIEW APPROACHPaolo (2007) (0)
SOCS-3 induces PCSK9 expression in hepatic HepG2 cell line (2015) (0)
Compartmenta lmode lidentification base do na nempirica lBayesian approach :th ecas eo fthiamin ekinetics i nrats (2001) (0)
Optimization of gamma-PGA biosynthesis supported by synthetic biology and metabolic engineering strategies (2018) (0)

This paper list is powered by the following services:

Other Resources About Paolo Magni

lab-bioinfo.unipv.it

What Schools Are Affiliated With Paolo Magni?

Paolo Magni is affiliated with the following schools: