Peter A Jones
#86,841
Most Influential Person Now
Researcher
Peter A Jones's AcademicInfluence.com Rankings
Peter A Jonescomputer-science Degrees
Computer Science
#2928
World Rank
#3065
Historical Rank
Computational Linguistics
#79
World Rank
#81
Historical Rank
Machine Learning
#239
World Rank
#242
Historical Rank
Artificial Intelligence
#402
World Rank
#409
Historical Rank
Download Badge
Computer Science
Why Is Peter A Jones Influential?
(Suggest an Edit or Addition)Peter A Jones's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- The fundamental role of epigenetic events in cancer (2002) (5593)
- Functions of DNA methylation: islands, start sites, gene bodies and beyond (2012) (4680)
- Epigenetics in cancer. (2010) (4409)
- The Epigenomics of Cancer (2007) (4303)
- Epigenetics in human disease and prospects for epigenetic therapy (2004) (3082)
- Cancer-epigenetics comes of age (1999) (2508)
- A decade of exploring the cancer epigenome — biological and translational implications (2011) (2494)
- The Role of DNA Methylation in Mammalian Epigenetics (2001) (1891)
- Cellular differentiation, cytidine analogs and DNA methylation (1980) (1708)
- Comprehensive analysis of CpG islands in human chromosomes 21 and 22 (2002) (1576)
- Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. (2006) (1346)
- Epigenetic therapy of cancer: past, present and future (2006) (1262)
- Multiple new phenotypes induced in 10T 1 2 and 3T3 cells treated with 5-azacytidine (1979) (1085)
- Cancer genetics and epigenetics: two sides of the same coin? (2012) (1001)
- DNA-Demethylating Agents Target Colorectal Cancer Cells by Inducing Viral Mimicry by Endogenous Transcripts (2015) (920)
- Gene body methylation can alter gene expression and is a therapeutic target in cancer. (2014) (846)
- Targeting the cancer epigenome for therapy (2016) (805)
- Rethinking how DNA methylation patterns are maintained (2009) (735)
- Epigenetic Modifications as Therapeutic Targets (2010) (708)
- Epigenetic Determinants of Cancer. (2016) (690)
- DNA methylation: The nuts and bolts of repression (2007) (649)
- Cooperativity between DNA Methyltransferases in the Maintenance Methylation of Repetitive Elements (2002) (572)
- DZNep is a global histone methylation inhibitor that reactivates developmental genes not silenced by DNA methylation (2009) (569)
- Inhibition of DNA methylation and reactivation of silenced genes by zebularine. (2003) (512)
- Demethylation of a hypermethylated P15/INK4B gene in patients with myelodysplastic syndrome by 5-Aza-2'-deoxycytidine (decitabine) treatment. (2002) (506)
- DNA methylation and breast carcinogenesis (2002) (478)
- Distinct localization of histone H3 acetylation and H3-K4 methylation to the transcription start sites in the human genome. (2004) (476)
- Altering gene expression with 5-azacytidine (1985) (398)
- Histone H3-lysine 9 methylation is associated with aberrant gene silencing in cancer cells and is rapidly reversed by 5-aza-2'-deoxycytidine. (2002) (395)
- The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53 (1998) (393)
- Epigenetics and MicroRNAs (2007) (387)
- The CpG Island Searcher: A new WWW resource (2003) (372)
- Frequent switching of Polycomb repressive marks and DNA hypermethylation in the PC3 prostate cancer cell line (2008) (363)
- P16 gene in uncultured tumours (1994) (347)
- Immune regulation by low doses of the DNA methyltransferase inhibitor 5-azacitidine in common human epithelial cancers (2014) (344)
- Genome-wide mapping of nucleosome positioning and DNA methylation within individual DNA molecules (2012) (339)
- Epigenetic changes in cancer (2007) (337)
- Alterations of immune response of non-small cell lung cancer with Azacytidine (2013) (335)
- The putative tumor suppressor microRNA-101 modulates the cancer epigenome by repressing the polycomb group protein EZH2. (2009) (331)
- Preferential response of cancer cells to zebularine. (2004) (304)
- Association of Breast Cancer DNA Methylation Profiles with Hormone Receptor Status and Response to Tamoxifen (2004) (290)
- Epigenetic Activation of Tumor Suppressor MicroRNAs in Human Cancer Cells (2006) (290)
- Cancer epigenetics: modifications, screening, and therapy. (2008) (285)
- Targeting DNA methylation for epigenetic therapy. (2010) (283)
- Epigenetic therapy in immune-oncology (2019) (280)
- Hypomethylation of a LINE-1 Promoter Activates an Alternate Transcript of the MET Oncogene in Bladders with Cancer (2010) (264)
- High frequency mutagenesis by a DNA methyltransferase (1992) (262)
- Inhibition of DNA methylation by chemical carcinogens in vitro (1983) (253)
- DNA methylation screening identifies driver epigenetic events of cancer cell survival. (2012) (250)
- p53 and treatment of bladder cancer (1997) (237)
- Footprinting of mammalian promoters: use of a CpG DNA methyltransferase revealing nucleosome positions at a single molecule level (2005) (218)
- Detection of Methylated Apoptosis-Associated Genes in Urine Sediments of Bladder Cancer Patients (2004) (216)
- Continuous Zebularine Treatment Effectively Sustains Demethylation in Human Bladder Cancer Cells (2004) (213)
- DNA methylation and cellular reprogramming. (2010) (211)
- Role of nucleosomal occupancy in the epigenetic silencing of the MLH1 CpG island. (2007) (210)
- Comparison of biological effects of non-nucleoside DNA methylation inhibitors versus 5-aza-2′-deoxycytidine (2005) (209)
- DAP-kinase loss of expression in various carcinoma and B-cell lymphoma cell lines: possible implications for role as tumor suppressor gene (1997) (206)
- Analysis of gene induction in human fibroblasts and bladder cancer cells exposed to the methylation inhibitor 5-aza-2'-deoxycytidine. (2002) (204)
- Selective Anchoring of DNA Methyltransferases 3A and 3B to Nucleosomes Containing Methylated DNA (2009) (203)
- Methylation, mutation and cancer (1992) (202)
- Identification of DNMT1 (DNA methyltransferase 1) hypomorphs in somatic knockouts suggests an essential role for DNMT1 in cell survival (2006) (202)
- Moving AHEAD with an international human epigenome project (2008) (202)
- Delivery of 5-aza-2'-deoxycytidine to cells using oligodeoxynucleotides. (2007) (187)
- DNA methylation directly silences genes with non-CpG island promoters and establishes a nucleosome occupied promoter. (2011) (186)
- Establishment of conditional vectors for hairpin siRNA knockdowns. (2003) (185)
- Reconfiguration of nucleosome-depleted regions at distal regulatory elements accompanies DNA methylation of enhancers and insulators in cancer (2014) (180)
- Role of the DNA methyltransferase variant DNMT3b3 in DNA methylation. (2004) (178)
- Polycomb-Repressed Genes Have Permissive Enhancers that Initiate Reprogramming (2011) (174)
- A blueprint for a Human Epigenome Project: the AACR Human Epigenome Workshop. (2005) (165)
- Unique DNA methylation patterns distinguish noninvasive and invasive urothelial cancers and establish an epigenetic field defect in premalignant tissue. (2010) (161)
- Progressing toward a molecular description of colorectal cancer development (1992) (160)
- Genome-wide nucleosome map and cytosine methylation levels of an ancient human genome (2014) (156)
- MicroRNAs: critical mediators of differentiation, development and disease. (2009) (152)
- Vitamin C increases viral mimicry induced by 5-aza-2′-deoxycytidine (2016) (151)
- H2A.Z maintenance during mitosis reveals nucleosome shifting on mitotically silenced genes. (2010) (146)
- Roles of Cell Division and Gene Transcription in the Methylation of CpG Islands (1999) (141)
- Mechanisms of Disease: genetic and epigenetic alterations that drive bladder cancer (2005) (134)
- Changes in phenotypic expression in embryonic and adult cells treated with 5‐azacytidine (1982) (130)
- Prognostic relevance of methylation markers in patients with non-muscle invasive bladder carcinoma. (2005) (127)
- OCT4 establishes and maintains nucleosome-depleted regions that provide additional layers of epigenetic regulation of its target genes (2011) (127)
- p53 gene and protein status: the role of p53 alterations in predicting outcome in patients with bladder cancer. (2007) (125)
- S110, a 5-Aza-2′-Deoxycytidine–Containing Dinucleotide, Is an Effective DNA Methylation Inhibitor In vivo and Can Reduce Tumor Growth (2010) (125)
- Nucleosomes Containing Methylated DNA Stabilize DNA Methyltransferases 3A/3B and Ensure Faithful Epigenetic Inheritance (2011) (117)
- Overview of cancer epigenetics. (2005) (112)
- Tissue-specific alternative splicing in the human INK4a/ARF cell cycle regulatory locus (1999) (108)
- Zebularine: A Unique Molecule for an Epigenetically Based Strategy in Cancer Chemotherapy (2005) (103)
- Long-term Epigenetic Therapy with Oral Zebularine Has Minimal Side Effects and Prevents Intestinal Tumors in Mice (2008) (101)
- DNA methylation analysis by digital bisulfite genomic sequencing and digital MethyLight (2008) (100)
- Cell division is required for de novo methylation of CpG islands in bladder cancer cells. (2002) (99)
- Combination Epigenetic Therapy in Advanced Breast Cancer with 5-Azacitidine and Entinostat: A Phase II National Cancer Institute/Stand Up to Cancer Study (2016) (99)
- Allelic methylation levels of the noncoding VTRNA2-1 located on chromosome 5q31.1 predict outcome in AML. (2012) (97)
- Chromatin, cancer and drug therapies. (2008) (95)
- Epigenetics in Carcinogenesis and Cancer Prevention (2003) (94)
- PAX6 methylation and ectopic expression in human tumor cells (2000) (94)
- DNMT3B isoforms without catalytic activity stimulate gene body methylation as accessory proteins in somatic cells (2016) (93)
- DNA methylation and cancer (2002) (92)
- Fibrin overlay methods for the detection of single transformed cells and colonies of transformed cells (1975) (92)
- Hyperphosphorylation of pRb: a mechanism for RB tumour suppressor pathway inactivation in bladder cancer (2004) (91)
- Bivalent Regions of Cytosine Methylation and H3K27 Acetylation Suggest an Active Role for DNA Methylation at Enhancers. (2016) (91)
- Gene Activation by 5-Azacytidine (1984) (88)
- Fibrinolytic activity in a human fibrosarcoma cell line and evidence for the induction of plasminogen activator secretion during tumor formation (1975) (85)
- Origins of bidirectional promoters: computational analyses of intergenic distance in the human genome. (2003) (82)
- Constitutive Nucleosome Depletion and Ordered Factor Assembly at the GRP78 Promoter Revealed by Single Molecule Footprinting (2006) (79)
- Reduced Rates of Gene Loss, Gene Silencing, and Gene Mutation in Dnmt1-Deficient Embryonic Stem Cells (2001) (79)
- Functional DNA demethylation is accompanied by chromatin accessibility (2013) (78)
- Discovery of Epigenetically Masked Tumor Suppressor Genes in Endometrial Cancer (2005) (78)
- The role of DNA methylation in directing the functional organization of the cancer epigenome (2015) (76)
- A Panel of Three Markers Hyper- and Hypomethylated in Urine Sediments Accurately Predicts Bladder Cancer Recurrence (2014) (76)
- Identification of DNA methylation differences during tumorigenesis by methylation-sensitive arbitrarily primed polymerase chain reaction. (2002) (76)
- Allele-specific methylation of the human c-Ha-ras-1 gene (1987) (75)
- Dynamic Nucleosome-Depleted Regions at Androgen Receptor Enhancers in the Absence of Ligand in Prostate Cancer Cells (2011) (75)
- Vitamin C - A new player in regulation of the cancer epigenome. (2017) (73)
- DNA methylation enables transposable element-driven genome expansion (2020) (72)
- RUNX3 methylation reveals that bladder tumors are older in patients with a history of smoking. (2008) (72)
- Equitoxic Doses of 5-Azacytidine and 5-Aza-2′Deoxycytidine Induce Diverse Immediate and Overlapping Heritable Changes in the Transcriptome (2010) (68)
- Locus-Wide Chromatin Remodeling and Enhanced Androgen Receptor-Mediated Transcription in Recurrent Prostate Tumor Cells (2006) (67)
- Switching roles for DNA and histone methylation depend on evolutionary ages of human endogenous retroviruses (2018) (66)
- Inhibition of histone deacetylation does not block resilencing of p16 after 5-aza-2'-deoxycytidine treatment. (2007) (66)
- Dual Inhibition of DNA and Histone Methyltransferases Increases Viral Mimicry in Ovarian Cancer Cells. (2018) (63)
- Gene Reactivation by 5-Aza-2′-Deoxycytidine–Induced Demethylation Requires SRCAP–Mediated H2A.Z Insertion to Establish Nucleosome Depleted Regions (2012) (62)
- Analysis of cyclin‐dependent kinase inhibitor expression and methylation patterns in human prostate cancers (2000) (61)
- Combination epigenetic therapy in metastatic colorectal cancer (mCRC) with subcutaneous 5-azacitidine and entinostat: a phase 2 consortium/stand Up 2 cancer study (2017) (61)
- DNA Methylation as a Target for Drug Design (1998) (60)
- Quantitative methylation analysis using methylation-sensitive single-nucleotide primer extension (Ms-SNuPE). (2002) (57)
- Identification and characterization of alternatively spliced variants of DNA methyltransferase 3a in mammalian cells. (2002) (57)
- LINE-1 methylation in plasma DNA as a biomarker of activity of DNA methylation inhibitors in patients with solid tumors (2009) (56)
- Discovery of a first-in-class reversible DNMT1-selective inhibitor with improved tolerability and efficacy in acute myeloid leukemia (2021) (53)
- ZEBULARINE: A UNIQUE MOLECULE FOR AN EPIGENETICALLY BASED STRATEGY IN CANCER CHEMOTHERAPY. THE MAGIC OF ITS CHEMISTRY AND BIOLOGY (2005) (47)
- Early acquisition of homozygous deletions of p16/p19 during squamous cell carcinogenesis and genetic mosaicism in bladder cancer (1998) (45)
- Molecular targets and targeted therapies in bladder cancer management (2008) (45)
- Identifying aggressive prostate cancer foci using a DNA methylation classifier (2017) (45)
- Epigenetic reprogramming as a key contributor to melanocyte malignant transformation (2011) (42)
- The tumor suppressor microRNA-101 becomes an epigenetic player by targeting the Polycomb group protein EZH2 in cancer (2009) (42)
- SNF5 Is an Essential Executor of Epigenetic Regulation during Differentiation (2013) (41)
- At the tipping point for epigenetic therapies in cancer. (2014) (41)
- Analysis of individual remodeled nucleosomes reveals decreased histone–DNA contacts created by hSWI/SNF (2009) (39)
- Oral vitamin C supplementation to patients with myeloid cancer on azacitidine treatment: Normalization of plasma vitamin C induces epigenetic changes (2019) (39)
- Down-regulation of ARID1A is sufficient to initiate neoplastic transformation along with epigenetic reprogramming in non-tumorigenic endometriotic cells. (2017) (39)
- A phase 1 study of azacitidine combined with chemotherapy in childhood leukemia: a report from the TACL consortium. (2018) (38)
- Diagnostic markers of urothelial cancer based on DNA methylation analysis (2013) (38)
- DNA methylation and cancer. (1986) (35)
- Tissue inhibitor of metalloproteinase 1 expression associated with gene demethylation confers anoikis resistance in early phases of melanocyte malignant transformation. (2009) (33)
- Mother–child transmission of epigenetic information by tunable polymorphic imprinting (2018) (30)
- Structure of nucleosome-bound DNA methyltransferases DNMT3A and DNMT3B (2020) (29)
- The Mutational Burden of 5-Methylcytosine (1996) (29)
- Identification of DNA Methylation-Independent Epigenetic Events Underlying Clear Cell Renal Cell Carcinoma. (2016) (28)
- Mutagenic, clastogenic and oncogenic effects of 1-β-d-arabinofuranosylcytosine (1979) (28)
- Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters (2017) (27)
- Meddling with methylation (2003) (23)
- Activation of a Subset of Evolutionarily Young Transposable Elements and Innate Immunity Are Linked to Clinical Responses to 5-Azacytidine (2020) (23)
- A blueprint for an international cancer epigenome consortium. A report from the AACR Cancer Epigenome Task Force. (2012) (23)
- Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells (2012) (22)
- Establishment of active chromatin structure at enhancer elements by mixed-lineage leukemia 1 to initiate estrogen-dependent gene expression (2013) (22)
- Activation of p16 gene silenced by DNA methylation in cancer cells by phosphoramidate derivatives of 2'-deoxyzebularine. (2008) (21)
- Differentially methylated alleles in a distinct region of the human interleukin-1alpha promoter are associated with allele-specific expression of IL-1alpha in CD4+ T cells. (2006) (20)
- Reprogramming of the human intestinal epigenome by surgical tissue transposition (2014) (19)
- DNA methylator and mismatch repair phenotypes are not mutually exclusive in colorectal cancer cell lines (2000) (18)
- DNA Methylation in Bladder Cancer (1998) (17)
- Nucleosome Occupancy and Methylome Sequencing (NOMe-seq). (2018) (15)
- Methylation‐Sensitive Single‐Molecule Analysis of Chromatin Structure (2010) (15)
- DNA methylation dynamics and dysregulation delineated by high-throughput profiling in the mouse (2022) (14)
- Advances in Brief Analysis of Gene Induction in Human Fibroblasts and Bladder Cancer Cells Exposed to the Methylation Inhibitor 5-Aza-2-deoxycytidine 1 (2002) (13)
- Bladder cancer genotype stability during clinical progression (2000) (13)
- Epigenetic landscape change analysis during human EMT sheds light on a key EMT mediator TRIM29 (2017) (13)
- Oocyte age and preconceptual alcohol use are highly correlated with epigenetic imprinting of a noncoding RNA (nc886) (2021) (12)
- A Phase 1 Study of Azacitidine (AZA) in Combination with Fludarabine and Cytarabine in Relapse/Refractory Childhood Leukemia: A Therapeutic Advances in Childhood Leukemia & Lymphoma (TACL) Study (2014) (12)
- The Human Epigenome (2012) (11)
- Genome-wide nucleosome occupancy and DNA methylation profiling of four human cell lines (2014) (11)
- An Epigenetic Approach for Finding Tumor Suppressors (2003) (10)
- Out of Africa and into epigenetics: discovering reprogramming drugs (2010) (9)
- Role of nucleosomes in mitotic bookmarking (2011) (9)
- epiG: statistical inference and profiling of DNA methylation from whole-genome bisulfite sequencing data (2017) (8)
- DNA methylation and cancer. (2002) (8)
- Epigenetic Therapy of Cancer (2014) (7)
- Alterations in deoxyribonucleic acid (DNA) methylation patterns of Calca, Timp3, Mmp2, and Igf2r are associated with chronic cystitis in a cyclophosphamide-induced mouse model. (2013) (6)
- DNA Methylation Errors and Cancer1 (2006) (6)
- Structure of DNA methyltransferases DNMT3A/DNMT3B bound to a nucleosome (2020) (6)
- Effect of myogenic determination on tumorigenicity of chemically transformed 10T1/2 cells (1991) (4)
- Oncogenic Transformation of C 3 H / 10 T 1 / 2 Clone 8 Mouse Embryo Cells by Halogenated Pyrimidine Nucleosides 1 (2006) (4)
- Oral Vitamin C Supplementation to Azacitidine in Patients with Myeloid Cancer: Normalization of Plasma Vitamin C Induces Epigenetic Changes (2018) (4)
- Molecular Cancer Therapeutics S 110 , a 5-Aza-2 ′-Deoxycytidine – Containing Dinucleotide , Is an Effective DNA Methylation Inhibitor In vivo and Can Reduce Tumor Growth (2010) (4)
- Genome wide analysis of DNA methylation and nucleosome positioning (2013) (3)
- GROWTH OF MACROPHAGES ON COLLAGEN-, ELASTIN-, AND GLYCOPROTEIN-COATED PLATES AS A TOOL FOR INVESTIGATING MACROPHAGE PROTEINASES (1981) (3)
- Identifying aggressive prostate cancer foci using a DNA methylation classifier (2017) (3)
- The Use of Ascorbic Acid for Selection of Transformed Cells with Differences in Tumorigenicities and Anchorage-Independent Growth: Implications for Chemoprevention1 (1983) (2)
- The cancer epigenome. (2007) (2)
- Abstract 4619: Epigenetic therapy and sensitization of lung cancer to immunotherapy. (2013) (2)
- Epigenetic therapy of cancer: past, present and future (2006) (2)
- Multiple hypermethylated genes are potential in vivo targets of demethylating agents (2003) (2)
- Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells (2012) (1)
- Abstract A11: Role of chromatin remodeler mutations in urothelial cell carcinoma of the bladder (2013) (1)
- 5-Methylcytosine and 5-Azacytosine Containing 25Mer Duplexes: Synthesis and Investigation of their Interaction with HeLa Nuclear Protein Extracts (1995) (1)
- Modulation of the Immune System by Epigenetic Therapy: A Rationale for Combined Use of DNA Methyltransferase Inhibitors and Immune Checkpoint Inhibitors (2017) (1)
- Abstract PR07: SNF5 is an essential executor of epigenetic regulation during differentiation (2013) (1)
- Base Excision Repair of U:G Mismatches at a Mutational Hotspot in the p53 Gene Is More Efficient Than Base Excision Repair of T:G Mismatches in Extracts of Human Colon Tumors1 (2006) (1)
- The Molecular Progression of Bladder Cancer (1996) (1)
- Diagnostic markers of urothelial cancer based on DNA methylation analysis (2013) (1)
- RNA mis-splicing drives viral mimicry response after DNMTi therapy in SETD2-mutant kidney cancer (2023) (1)
- Advances in Brief Base Excision Repair of U : G Mismatches at a Mutational Hotspot in the p 53 Gene Is More Efficient Than Base Excision Repair of T : G Mismatches in Extracts of Human Colon Tumors 1 (2006) (1)
- A POTENTIAL ROLE OF ABERRANT DNA METHYLATION IN THE CHEMORESISTANCE IN BLADDER CANCER CELLS. DNA METHYLATION INHIBITORS COULD RE‐SENSITIZE DRUG‐RESISTANCE BLADDER CANCER CELLS.: MP98‐02 (2017) (1)
- Chromosome-specific retention of cancer-associated DNA hypermethylation following pharmacological inhibition of DNMT1 (2022) (1)
- Regulation of Proteases in Cultured Human Urothelium (1987) (1)
- Upregulation of the miR-515 cluster in the MCF7 breast cancer cell line by epigenetic therapy (2008) (1)
- Carcinogenesis Mechanisms for the Involvement of DNA Methylation in Colon Updated (2006) (1)
- Advances in Brief Identification and Characterization of Differentially Methylated Regions of Genomic DNA by Methylation-sensitive Arbitrarily Primed PCR 1 (2006) (1)
- Abstract IA04: How DNA methylation organizes the cancer epigenome (2016) (1)
- Acute myeloid leukemia of the elderly: results of induction after previous treatment of high-risk myelodysplastic syndrome with a demethylating agent (2003) (1)
- Structure of nucleosome-bound DNA methyltransferases DNMT3A and DNMT3B (2020) (0)
- Effect ofCellular Determination on Oncogenic Transformation byChemicals andOncogenes (1988) (0)
- DNA METHYLATION AS A POSSIBLE PREDICTOR OF BLADDER CANCER PROGRESSION (1999) (0)
- Abstract IA20: DNA methylation and nucleosome repositioning in cancer (2011) (0)
- Epigenetic Silencing of a Novel Candidate Tumor Suppressor “miR” Predicts Poor Prognosis In High-Risk MDS and AML. (2010) (0)
- Genomic Imprinting, Wolf Reik, Azim Surani. Oxford University Press, Oxford (1997), 245, $125.00 (cloth); $55.00 (paper). (1998) (0)
- Carcinomas Gene Mutations in Primary Nasopharyngeal p 53 Absence of Updated Version (2006) (0)
- CONVERSION OF NON-MUSCLE CELLS INTO FUNCTIONAL STRIATED MYOTUBES BY 5-AZACYTIDINE (1978) (0)
- an ancient human genome Genome-wide nucleosome map and cytosine methylation levels of Material Supplemental (2014) (0)
- Field Defect in Premalignant Tissue and Invasive Urothelial Cancers and Establish an Epigenetic Unique DNA Methylation Patterns Distinguish Noninvasive (2010) (0)
- Basic and clinical frontiers of cancer epigenetics : extended abstracts for the 41th International Symposium of the Princess Takamatsu Cancer Research Fund : November 17-19, 2010 Tokyo, Japan (2011) (0)
- 1699 IDENTIFYING NOVEL DNA METHYLATION MARKERS TO MONITOR BLADDER CANCER RECURRENCE IN URINE SEDIMENTS FROM TURBT PATIENTS (2013) (0)
- DNA Methylation, Differentiation and Cancer (1991) (0)
- Abstract 2993: A switch in epigenetic silencing mechanisms of endogenous retroviruses during human genome evolution (2018) (0)
- MP61-10 DNA METHYLATION INHIBITORS MAY REVERSE DRUG-RESISTANCE IN HUMAN BLADDER CANCER CELLS (2016) (0)
- Abstract IA01: The epigenetics of cancer (2020) (0)
- Alterations in the DNA Methylation Patterns of Calca, Timp3, Mmp2, and Igf2r are Associated with Chronic Cystitis in a Cyclophosphamide-induced Mouse Model (2013) (0)
- Abstract B02: The role of chromatin remodeler protein ARID1a in ovarian clear cell carcinoma (2016) (0)
- Induction of Antigen-Specific T Cells Targeting Endogenous Retroelements During Epigenetic Treatment of Myelodysplastic Syndrome (2017) (0)
- in CD4+ T cells α of IL-1 promoter are associated with allele-specific expression α interleukin-1 Differentially methylated alleles in a distinct region of the human (2013) (0)
- Abstract A1-05: Elucidation of epigenetic driver genes in clear cell renal cell carcinoma using a newly developed assay, AcceSssIble (2015) (0)
- Hamster fibrosarcoma cells were synchronized by mitotic selection and exposed to varying concentrations of i-fJ-D (2006) (0)
- Abstract 4801: Hypomethylation of a LINE-1 promoter activates an alternate transcript of the MET oncogene in bladders with cancer (2010) (0)
- The Role of DNA Methylation in Expression of the pl 9 / pl 6 Locus in Human Bladder Cancer Cell Lines 1 (2006) (0)
- Abstract B03: Identification of epigenetic regulated genes through simultaneous analysis of DNA methylation and chromatin structure in uncultured tumors (2016) (0)
- Meeting Highlights: Molecular Biology and Pharmacology of Human Growth Factors (1988) (0)
- Abstract IA14: Increasing viral mimicry with vitamin C (2020) (0)
- 359 TMS-1 is frequently hypermethylated in prostate cancer and can be re-induced by treatment with 5-aza-2-deoxycytidine (2004) (0)
- Locus in Human Bladder Cancer Cell Lines p 19 / p 16 The Role of DNA Methylation in Expression of the Updated Version (2006) (0)
- Abstract 677: Transient exposure to decitabine results in sustained cell growth inhibition and long term DNA demethylation at specific loci. (2013) (0)
- Effect of AscorbicAcid on the Resistanceof the Extracellular Matrix to Hydrolysisby Tumor Cells1 (1980) (0)
- Abstract IA14: Targeting human endogenous retroviruses for epigenetic therapy (2017) (0)
- Perspectives in Cancer Research DNA Methylation and Cancer1 (2006) (0)
- 745: Frequent Methylation of Apoptosis-Associated Genes in Bladder Cancer Cell Lines, Tumor Samples, and Urine Samples for Diagnosis of Bladder Cancer (2004) (0)
- Frequently Hypermethylated in Human Tumor Cells Epidermal Growth Factor and Follistatin Domains Is The Gene for a Novel Transmembrane Protein Containing Updated (2000) (0)
- Abstract LB-130: Simultaneous evaluation of chromatin accessibility and DNA methylation in clear cell renal cell carcinoma by a newly developed assay, AcceSssIble (2014) (0)
- Abstract CT121: A Phase II trial of guadecitabine (G) plus atezolizumab (A) in patients with metastatic urothelial carcinoma (UC) progressing after initial checkpoint inhibitor therapy (2021) (0)
- Uni and Epig (2010) (0)
- Abstract 4780: The effects of the global loss of DNA methylation on the functional organization of the epigenome (2014) (0)
- 826 Methylation of the E-cadherin and the TIMP-3 genes are positive prognostic markers for patients with non-muscle invasive bladder carcinoma (2004) (0)
- 212 Frequent methylation of apoptosis-associated genes in bladder cancer cell lines, tumour samples, and urine samples for diagnosis of bladder cancer (2004) (0)
- Abstract IA16: Reactivating epigenetically silenced genes (2013) (0)
- Abstract 4624: Identification of novel DNA methylation markers to track patient's response to DNA demethylation agents. (2013) (0)
- Abstract 4702: Effects of smoking on the molecular pathology of urinary bladder cancer and its prognostic importance (2010) (0)
- Frequent methylation of p15 5′ region in leukemic and preleukemic disorders, and reduction of p15 methylation levels by 5-aza-deoxycytidine treatment is correlated with clinical remission (1996) (0)
- 743: Methylation of the E-Cadherin and the TIMP-3 Genes are Positive Prognostic Markers for Patients with Non-Muscle Invasive Bladder Carcinoma (2004) (0)
- 484 COMPARISON OF METHYLATION PATTERNS BETWEEN PRIMARY AND RECURRENT NON-MUSCLE INVASIVE BLADDER CANCER (2007) (0)
- 69 Hypomethylation of a non-coding RNA on chromosome 5q31.1 is a positive prognostic factor for survival in AML/high risk MDS (2011) (0)
- P31 DNA methylation profiles in breast cancer — relation to hormone receptors and role in response to adjuvant endocrine treatment (2004) (0)
- Cancer Cell Epigenetic Silencing of the MLH 1 CpG Island aberrant gene regulation in cancer (0)
- Abstract A39: Viral response markers in immune-competent solid tumors by immunohistochemistry (2018) (0)
- Advances in Brief Microsatellite instability in Bladder Cancer I (2007) (0)
- Abstract 1078: The nucleosomal acidic patch helps anchor ofde novoDNA methyltransferase DNMT3A2/3B3 complex (2020) (0)
- Timp1 gene demethylation contributes to the anoikis resistance phenotype along melanocyte malignant transformation (2007) (0)
- Absence of Ligand in Prostate Cancer Cells Androgen Receptor Enhancers in the Dynamic Nucleosome-Depleted Regions at (2014) (0)
- DNA METHYLATION INHIBITORS COULD RE‐SENSITIZE DRUG‐RESISTANCE BLADDER CANCER CELLS IN VITRO AND IN VIVO: MP54‐19 (2018) (0)
- I point mutations in human ition polymorphism ! (2005) (0)
- Cancer esearch or and Stem Cell Biology que DNA Methylation Patterns Distinguish Noninvasive Invasive Urothelial Cancers and Establish an R enetic Field Defect in Premalignant Tissue (2010) (0)
- Ubiquitous andTenacious Methylation oftheCpG SiteinCodon248 ofthep53GeneMayExplain ItsFrequent Appearance as a Mutational HotSpotinHumanCancer (1994) (0)
- Effects of X-lrradiationon ArtificialBloodVessel Wall Degradation by InvasiveTumorCells1 (2006) (0)
- Abstract B56: DNA demethylation in gene bodies is of therapeutic significance (2013) (0)
- Genetic alterations during the progression of sporadic melanoma: 128 (1997) (0)
- CACCD ' AACCCCGG ) oracombinationf 2 primers ( MGCO : AACCD ' CACCD ' AACCGCOC ) + ( MGF 2 : AACCCTCACCCTAACCCGCG ) (2006) (0)
- Abstract 3092: Activation of evolutionarily young transposable elements and the host innate immune system are linked to clinical response to 5-azacitidine (2019) (0)
- CHAPTER 10:Dosing – When Less is More (2015) (0)
- Decoding the Chromatin Code (2012) (0)
- The status of GAS1 gene in bladder tumor progression (1996) (0)
- Islands in Bladder Cancer Cells Methylation of CpG de Novo Cell Division Is Required for Updated (2002) (0)
- Differences in anchorage independent growth and tumorigenicity between morphologically transformed 10t 1/2 cells reverted or not reverted to a normal phenotype by ascorbic acid (1981) (0)
- Abstract 2004: Effect of epigenetic drugs on melanocytes and melanoma cell lines phenotype and aggressiveness (2011) (0)
- Abstract 4892: Epigenetic reprogramming associated with melanocyte malignant transformation induced by sustained stress condition (2010) (0)
- Genome wide analysis of DNA methylation and nucleosome positioning (2013) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Peter A Jones?
Peter A Jones is affiliated with the following schools:
