Pierre Corvol | Academic Influence

Pierre Corvol's AcademicInfluence.com Rankings

Pierre Corvol

Philosophy

#3062

World Rank

#5035

Historical Rank

Logic

#1060

World Rank

#1690

Historical Rank

philosophy Degrees

Download Badge

Philosophy

Pierre Corvol's Degrees

Doctorate Medicine Université Paris Cité
Doctorate Biological and Medical Sciences Université Paris Cité

Why Is Pierre Corvol Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Pierre Corvol is a French doctor and biology researcher. He was director of the Collège de France from 2006 to August 2012. Early life and education Corvol studied at the Lycée Condorcet in Paris, France. He served as resident at academic hospitals of Paris , and spent post-doctoral research at the National Institutes of Health in Bethesda, Maryland, USA, in 1969.

(See a Problem?)

Pierre Corvol's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. (1990) (3849)
Molecular basis of human hypertension: Role of angiotensinogen (1992) (1883)
PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). (1992) (1344)
Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. (1992) (1250)
Angiotensin II type 1 receptor gene polymorphisms in human essential hypertension. (1994) (744)
Two putative active centers in human angiotensin I-converting enzyme revealed by molecular cloning. (1988) (695)
A molecular variant of angiotensinogen associated with preeclampsia (1993) (518)
Mutations in the SDHB gene are associated with extra-adrenal and/or malignant phaeochromocytomas. (2003) (513)
Hypoxia, hypoxia-inducible transcription factor, and macrophages in human atherosclerotic plaques are correlated with intraplaque angiogenesis. (2008) (432)
Structure of the angiotensin I-converting enzyme gene. Two alternate promoters correspond to evolutionary steps of a duplicated gene. (1991) (425)
Expression of Angiotensin Type-1 (AT1) and Type-2 (AT2) Receptor mRNAs in the Adult Rat Brain: A Functional Neuroanatomical Review (1997) (422)
The two homologous domains of human angiotensin I-converting enzyme are both catalytically active. (1991) (359)
The R22X mutation of the SDHD gene in hereditary paraganglioma abolishes the enzymatic activity of complex II in the mitochondrial respiratory chain and activates the hypoxia pathway. (2001) (357)
Physiological role of a novel neuropeptide, apelin, and its receptor in the rat brain (2001) (351)
Steroid hormone receptors. (1975) (335)
Acute angiotensin-converting enzyme inhibition increases the plasma level of the natural stem cell regulator N-acetyl-seryl-aspartyl-lysyl-proline. (1996) (328)
Peptidyl dipeptidase A: angiotensin I-converting enzyme. (1995) (315)
Small-intestinal dysfunction accompanies the complex endocrinopathy of human proprotein convertase 1 deficiency. (2003) (313)
Angiopoietin-like 4 is a proangiogenic factor produced during ischemia and in conventional renal cell carcinoma. (2003) (310)
Identification of metabolic pathways of brain angiotensin II and III using specific aminopeptidase inhibitors: predominant role of angiotensin III in the control of vasopressin release. (1996) (300)
Haplotypes of angiotensinogen in essential hypertension. (1997) (299)
The Hemoregulatory Peptide N-Acetyl-Ser-Asp-Lys-Pro Is a Natural and Specific Substrate of the N-terminal Active Site of Human Angiotensin-converting Enzyme (*) (1995) (284)
The critical role of tissue angiotensin-converting enzyme as revealed by gene targeting in mice. (1997) (281)
Progesterone-binding components of chick oviduct. I. Preliminary characterization of cytoplasmic components. (1970) (258)
Association of hypertension with T594M mutation in β subunit of epithelial sodium channels in black people resident in London (1998) (258)
Efficacy and tolerance of spironolactone in essential hypertension. (1987) (256)
The angiotensin I converting enzyme gene and predisposition to high blood pressure. (1993) (255)
Biological effects of estradiol-17 beta in postmenopausal women: oral versus percutaneous administration. (1986) (251)
Early expression of all the components of the renin-angiotensin-system in human development. (1996) (243)
Soluble Form of the (Pro)Renin Receptor Generated by Intracellular Cleavage by Furin Is Secreted in Plasma (2009) (241)
Hormonal and Cardiac Effects of Converting Enzyme Inhibition in Rat Myocardial Infarction (1988) (241)
Angiopoietin-like 4 prevents metastasis through inhibition of vascular permeability and tumor cell motility and invasiveness (2006) (240)
The two homologous domains of human angiotensin I-converting enzyme interact differently with competitive inhibitors. (1992) (239)
Structural analysis and evaluation of the aldosterone synthase gene in hypertension. (1998) (229)
Antiandrogenic effect of spirolactones: mechanism of action. (1975) (227)
Polar Residues in the Transmembrane Domains of the Type 1 Angiotensin II Receptor Are Required for Binding and Coupling (1996) (206)
Tumor recurrence and hypertension persistence after successful pheochromocytoma operation. (1997) (198)
Distribution of plasma angiotensin I-converting enzyme levels in healthy men: relationship to environmental and hormonal parameters. (1991) (195)
Tissue-specific expression of type 1 angiotensin II receptor subtypes. An in situ hybridization study. (1994) (195)
Lessons from constitutively active mutants of G protein-coupled receptors (2002) (194)
Genetic susceptibility for human familial essential hypertension in a region of homology with blood pressure linkage on rat chromosome 10. (1997) (191)
Extracellular Matrix–Bound Angiopoietin-Like 4 Inhibits Endothelial Cell Adhesion, Migration, and Sprouting and Alters Actin Cytoskeleton (2006) (188)
Tissular expression and regulation of type 1 angiotensin II receptor subtypes by quantitative reverse transcriptase-polymerase chain reaction analysis. (1994) (185)
Species distribution of testosterone-binding globulin. (1973) (183)
Expression and characterization of recombinant human angiotensin I-converting enzyme. Evidence for a C-terminal transmembrane anchor and for a proteolytic processing of the secreted recombinant and plasma enzymes. (1991) (182)
Robo4 maintains vessel integrity and inhibits angiogenesis by interacting with UNC5B. (2011) (180)
Gene expression and tissue localization of the two isoforms of angiotensin I converting enzyme. (1993) (179)
Multiple Promoters in the WNK1 Gene: One Controls Expression of a Kidney-Specific Kinase-Defective Isoform (2003) (177)
Lack of evidence for linkage of the endothelial cell nitric oxide synthase gene to essential hypertension. (1995) (176)
Aminopeptidase A inhibitors as potential central antihypertensive agents. (1999) (176)
Mapping of a first locus for autosomal dominant myxomatous mitral-valve prolapse to chromosome 16p11.2-p12.1. (1999) (158)
Lack of angiotensin II-facilitated erythropoiesis causes anemia in angiotensin-converting enzyme-deficient mice. (2000) (157)
Physical properties and binding capacity of testosterone-estradiol-binding globulin in human plasma, determined by polyacrylamide gel electrophoresis. (1971) (154)
Myocardial recruitment during ANF mRNA increase with volume overload in the rat. (1986) (153)
Complete amino acid sequence and maturation of the mouse submaxillary gland renin precursor (1982) (153)
RXP 407, a phosphinic peptide, is a potent inhibitor of angiotensin I converting enzyme able to differentiate between its two active sites. (1999) (152)
The testicular transcript of the angiotensin I‐converting enzyme encodes for the ancestral, non‐duplicated form of the enzyme (1989) (151)
Seven lessons from two candidate genes in human essential hypertension: angiotensinogen and epithelial sodium channel. (1999) (149)
Mutation of Asp74 of the rat angiotensin II receptor confers changes in antagonist affinities and abolishes G-protein coupling. (1993) (148)
Cloning and Expression of an Evolutionary Conserved Single-domain Angiotensin Converting Enzyme from Drosophila melanogaster(*) (1995) (147)
Molecular genetics of human hypertension: role of angiotensinogen. (1997) (146)
Control of arterial branching morphogenesis in embryogenesis: go with the flow. (2005) (146)
Renin and angiotensinogen expression and functions in growth and apoptosis of human glioblastoma (2004) (142)
Angiogenesis and vascular architecture in pheochromocytomas: distinctive traits in malignant tumors. (2002) (139)
Systemic hypertension after cardiac transplantation: effect of cyclosporine on the renin-angiotensin-aldosterone system. (1985) (139)
The angiotensin receptor subtype AT1A predominates in rat forebrain areas involved in blood pressure, body fluid homeostasis and neuroendocrine control. (1995) (138)
Glucocorticoid-suppressible hyperaldosteronism and adrenal tumors occurring in a single French pedigree. (1995) (137)
Structure of human angiotensinogen gene. (1989) (136)
Effects of induced hyperthyroidism on steroid metabolism in man. (1971) (136)
New monoclonal antibodies directed against human renin. Powerful tools for the investigation of the renin system. (1984) (131)
Genetic analysis of the beta subunit of the epithelial Na+ channel in essential hypertension. (1998) (129)
Possible familial origin of multifocal renal artery fibromuscular dysplasia (1997) (128)
Identity of angiotensinogen precursors of rat brain and liver (1984) (127)
Reciprocal regulation of plasma apelin and vasopressin by osmotic stimuli. (2008) (125)
Distribution of angiotensin type-1 receptor messenger RNA expression in the adult rat brain (1997) (123)
Angiotensinogen and Its Cleaved Derivatives Inhibit Angiogenesis (2002) (123)
Angiotensin-Converting Enzyme 2 (ACE2) and ACE Activities Display Tissue-Specific Sensitivity to Undernutrition-Programmed Hypertension in the Adult Rat (2005) (122)
Proteolytic release of human angiotensin-converting enzyme. Localization of the cleavage site. (1993) (121)
Angiotensin II type 2 receptor mRNA expression in the developing cardiopulmonary system of the rat. (1996) (120)
Brain renin-angiotensin system blockade by systemically active aminopeptidase A inhibitors: a potential treatment of salt-dependent hypertension. (2004) (120)
Multiple forms of human renin. Purification and characterization. (1979) (118)
Angiotensin-Converting Enzyme C-Terminal Catalytic Domain Is the Main Site of Angiotensin I Cleavage In Vivo (2008) (112)
Recent advances in knowledge of the structure and function of the angiotensin I converting enzyme (1995) (112)
Angiotensin‐converting enzyme 2 (ACE2) expression and activity in human carotid atherosclerotic lesions (2008) (111)
Autosomal dominant pseudohypoaldosteronism type 1: mechanisms, evidence for neonatal lethality, and phenotypic expression in adults. (2006) (111)
Expression of type 1 angiotensin II receptor subtypes and angiotensin II-induced calcium mobilization along the rat nephron. (1997) (110)
Direct immunometric assay of active renin in human plasma. (1985) (109)
Angiogenesis Associated With Visceral and Subcutaneous Adipose Tissue in Severe Human Obesity (2008) (107)
Recombinant CYP11B genes encode enzymes that can catalyze conversion of 11-deoxycortisol to cortisol, 18-hydroxycortisol, and 18-oxocortisol. (1998) (104)
Internalization of the rat AT1a and AT1b receptors: pharmacological and functional requirements (1994) (103)
Expression of angiotensin II AT2 receptor mRNA during development of rat kidney and adrenal gland. (1995) (103)
Similar Frequencies of Renin Gene Restriction Fragment Length Polymorphisms in Hypertensive and Normotensive Subjects (1990) (101)
A new locus on chromosome 12p13.3 for pseudohypoaldosteronism type II, an autosomal dominant form of hypertension. (2000) (101)
Increased urinary free cortisol: a potential intermediate phenotype of essential hypertension. (1998) (100)
A direct determination of plasma aldosterone. (1974) (99)
Renin biosynthesis by human tumoral juxtaglomerular cells. Evidences for a renin precursor. (1984) (98)
hypertension Angiotensin II type 1 receptor gene polymorphisms in human essential (2009) (98)
The amino acid substitutions Ser288Gly and Val320Ala convert the cortisol producing enzyme, CYP11B1, into an aldosterone producing enzyme (1997) (97)
Measurement of urinary kallikrein activity. Species differences in kinin production. (1981) (97)
Akt Is a Major Downstream Target of PI3-Kinase Involved in Angiotensin II–Induced Proliferation (2003) (94)
M235T variant of the human angiotensinogen gene in unselected hypertensive patients (1993) (94)
Role of the N-terminal Catalytic Domain of Angiotensin-converting Enzyme Investigated by Targeted Inactivation in Mice* (2004) (93)
An In Situ Hybridization Study (2005) (93)
Hyperglycemia-induced defects in angiogenesis in the chicken chorioallantoic membrane model. (2004) (92)
A role of the (pro)renin receptor in neuronal cell differentiation. (2009) (92)
Molecular biology of the angiotensin I converting enzyme: I. Biochemistry and structure of the gene. (1993) (91)
Genotype–phenotype analysis of a newly discovered family with Liddle's syndrome (1997) (91)
Distribution of angiotensin II type‐2 receptor (AT2) mRNA expression in the adult rat brain (1996) (91)
Pharmacological inactivation of the endothelin type A receptor in the early chick embryo: a model of mispatterning of the branchial arch derivatives. (1998) (90)
Human chorionic cells in primary culture: a model for renin biosynthesis. (1982) (89)
Identification and characterization of neutral endopeptidase in endothelial cells from venous or arterial origins. (1992) (89)
Renin secreting tumors: diagnosis, conservative surgical approach and long-term results. (1995) (89)
Characterization of the expression of the hypoxia‐induced genes neuritin, TXNIP and IGFBP3 in cancer (2006) (89)
Rat angiotensinogen and des(angiotensin I)angiotensinogen: purification, characterization, and partial sequencing. (1981) (88)
Effects of percutaneous estradiol and conjugated estrogens on the level of plasma proteins and triglycerides in postmenopausal women. (1982) (88)
Nonproportional changes in plasma renin concentration, renal renin content, and rat renin messenger RNA. (1985) (87)
Heterodimerization of Endothelin-converting Enzyme-1 Isoforms Regulates the Subcellular Distribution of This Metalloprotease* (2003) (87)
Role of Angiotensinogen in Blood Pressure Homeostasis (1982) (87)
Response of plasma prorenin and active renin to chronic and acute alterations of renin secretion in normal humans. Studies using a direct immunoradiometric assay. (1989) (87)
RXP 407, a selective inhibitor of the N-domain of angiotensin I-converting enzyme, blocks in vivo the degradation of hemoregulatory peptide acetyl-Ser-Asp-Lys-Pro with no effect on angiotensin I hydrolysis. (2001) (87)
Tissue-specific regulation of type 1 angiotensin II receptor mRNA levels in the rat. (1996) (86)
Antialdosterones: incidence and prevention of sexual side effects. (1989) (85)
Effect of Reduced Angiotensin-Converting Enzyme Gene Expression and Angiotensin-Converting Enzyme Inhibition on Angiotensin and Bradykinin Peptide Levels in Mice (2004) (85)
Angiotensin II receptors: protein and gene structures, expression and potential pathological involvements. (1996) (85)
Cellular Distribution of Endothelin-converting Enzyme-1 in Human Tissues (1999) (84)
Differential regulation of renal angiotensin‐converting enzyme (ACE) and ACE2 during ACE inhibition and dietary sodium restriction in healthy rats (2008) (84)
Angiotensin I converting enzyme in human intestine and kidney (2004) (83)
Effects of antihypertensive treatment in one-clip, two kidney hypertension in rats. (1986) (83)
Molecular biology of the angiotensin I converting enzyme: II. Structure-function. Gene polymorphism and clinical implications. (1993) (83)
Spectrum of mutations in the renin–angiotensin system genes in autosomal recessive renal tubular dysgenesis (2012) (82)
The Drosophila melanogaster-related angiotensin-I-converting enzymes Acer and Ance--distinct enzymic characteristics and alternative expression during pupal development. (1998) (82)
Binding of glycyrrhetinic acid to kidney mineralocorticoid and glucocorticoid receptors. (1975) (81)
Regulation of angiotensinogen gene. (1989) (81)
Plasma angiotensins, renin, and blood pressure during acute renin inhibition by CGP 38 560A in hypertensive patients. (1989) (81)
Pharmacokinetic studies of nifedipine tablet. Correlation with antihypertensive effects. (1983) (81)
Ontogeny of angiotensin II type 2 (AT2) receptor mRNA in the rat. (1995) (79)
Renal tubular dysgenesis, a not uncommon autosomal recessive disorder leading to oligohydramnios: Role of the Renin-Angiotensin system. (2006) (78)
Systematic identification of mutations that constitutively activate the angiotensin II type 1A receptor by screening a randomly mutated cDNA library with an original pharmacological bioassay. (2000) (78)
Identification of two active site residues in human angiotensin I-converting enzyme. (1994) (77)
PC18, a Specific Aminopeptidase N Inhibitor, Induces Vasopressin Release by Increasing the Half-Life of Brain Angiotensin III (1999) (77)
cis-regulatory elements and trans-acting factors directing basal and cAMP-stimulated human renin gene expression in chorionic cells. (1994) (76)
Self-measurement and self-titration in hypertension: a pilot telemedicine study. (2007) (76)
Gain-of-function mutant of angiotensin II receptor, type 1A, causes hypertension and cardiovascular fibrosis in mice. (2007) (74)
Ontogeny of the two angiotensin II type 1 receptor subtypes in rats. (1994) (74)
A glutamate residue contributes to the exopeptidase specificity in aminopeptidase A. (1998) (74)
A mutation of angiotensinogen in a patient with preeclampsia leads to altered kinetics of the renin-angiotensin system (1995) (72)
Aminopeptidase A: distribution in rat brain nuclei and increased activity in spontaneously hypertensive rats (1997) (72)
Mice Lacking Endothelial Angiotensin-Converting Enzyme Have a Normal Blood Pressure (2002) (72)
Crossover design to test antihypertensive drugs with self-recorded blood pressure. (1988) (72)
Drosophila melanogaster angiotensin I-converting enzyme expressed in Pichia pastoris resembles the C domain of the mammalian homologue and does not require glycosylation for secretion and enzymic activity. (1996) (72)
Alternatively spliced human type 1 angiotensin II receptor mRNAs are translated at different efficiencies and encode two receptor isoforms. (1995) (71)
Substrate dependence of angiotensin I-converting enzyme inhibition: captopril displays a partial selectivity for inhibition of N-acetyl-seryl-aspartyl-lysyl-proline hydrolysis compared with that of angiotensin I. (1997) (71)
Two-site direct immunoassay specific for active renin. (1992) (70)
Implication of Ref-1 in the repression of renin gene transcription by intracellular calcium (2003) (69)
Modulation of Macrophage Activation State Protects Tissue from Necrosis during Critical Limb Ischemia in Thrombospondin-1-Deficient Mice (2008) (68)
Male fertility is dependent on dipeptidase activity of testis ACE (2005) (67)
Use of a specific antiserum for renin detection in human kidney. (1980) (67)
Mechanism of the antimineralocorticoid effects of spirolactones. (1981) (67)
Physiological and immunopathological consequences of active immunization of spontaneously hypertensive and normotensive rats against murine renin. (1990) (66)
Active immunization against renin in normotensive marmoset. (1987) (66)
Functional conservation of the active sites of human and Drosophila angiotensin I-converting enzyme. (2000) (66)
Constitutive Internalization of Constitutively Active Angiotensin II AT1A Receptor Mutants Is Blocked by Inverse Agonists* (2002) (66)
Familial hyperkalemic hypertension: phenotypic analysis in a large family with the WNK1 deletion mutation. (2003) (65)
Comparative enzymatic studies of human renin acting on pure natural or synthetic substrates. (1987) (64)
The angiotensin converting enzyme in the kidney. (1989) (64)
Direct radioimmunoassay of human renin. (1979) (64)
The hematopoietic system: a new niche for the renin–angiotensin system (2005) (63)
Molecular cloning and nucleotide sequence of a human renin cDNA fragment. (1983) (63)
The C-terminal Third Intracellular Loop of the Rat AT1A Angiotensin Receptor Plays a Key Role in G Protein Coupling Specificity and Transduction of the Mitogenic Signal* (1997) (63)
Renin-secreting tumors. (1994) (63)
Immunologic identification of both plasma and human renal inactive renin as prorenin. (1985) (63)
Ontogeny of endothelins-1 and -3, their receptors, and endothelin converting enzyme-1 in the early human embryo. (1998) (63)
Study of V1-vascular Vasopressin Receptor Gene Microsatellite Polymorphisms in Human Essential Hypertension☆ (2000) (63)
Role of the renin-angiotensin system in primitive erythropoiesis in the chick embryo. (2005) (62)
Aminopeptidase A, which generates one of the main effector peptides of the brain renin-angiotensin system, angiotensin III, has a key role in central control of arterial blood pressure. (2000) (61)
Arginine vasopressin gene expression in chronic cardiac failure in rats. (1990) (61)
Distribution of type 1 angiotensin II receptor subtype messenger RNAs in the rat fetus. (1994) (61)
A rapid high-performance liquid chromatography purification method of lodinated polypeptide hormones (1980) (61)
Molecular genetics of the renin-angiotensin-aldosterone system in human hypertension. (1997) (61)
Molecular cloning of a mouse submaxillary gland renin cDNA fragment. (1981) (60)
A Novel Distal Enhancer Confers Chorionic Expression on the Human Renin Gene* (1998) (60)
Biochemistry and regulation of angiotensinogen. (1983) (60)
Plasma concentration of testosterone, dihydrotestosterone, testosterone-oestradiol binding globulin, and pituitary gonadotrophins in the syndrome of male pseudo-hermaphroditism with testicular feminization. (1972) (60)
Role of the renin-angiotensin system in blood pressure regulation and in human hypertension: new insights from molecular genetics. (1995) (59)
Inhibition of angiotensin I-converting enzyme induces radioprotection by preserving murine hematopoietic short-term reconstituting cells. (2004) (59)
Angiotensinogen delays angiogenesis and tumor growth of hepatocarcinoma in transgenic mice. (2009) (58)
A novel peptide-processing activity of insect peptidyl-dipeptidase A (angiotensin I-converting enzyme): the hydrolysis of lysyl-arginine and arginyl-arginine from the C-terminus of an insect prohormone peptide. (1998) (58)
82 – Peptidyl-dipeptidase A/angiotensin I-converting enzyme (2004) (58)
Sib pair linkage analysis of renin gene haplotypes in human essential hypertension (2004) (57)
Endothelin-1, a Regulator of Angiogenesis in the Chick Chorioallantoic Membrane (2001) (56)
Angiotensinogen variants and human hypertension (1999) (56)
Pepstatin, an inhibitor for renin purification by affinity chromatography (1973) (56)
Study of asparagine 353 in aminopeptidase A: characterization of a novel motif (GXMEN) implicated in exopeptidase specificity of monozinc aminopeptidases. (2001) (55)
Cell Surface Localization of Proteolysis of Human Endothelial Angiotensin I-converting Enzyme (1995) (55)
Direct radioimmunoassay of rat angiotensinogen and its application to rats in various endocrine states. (1982) (55)
Characterization of plasma and cerebrospinal fluid human angiotensinogen and des-angiotensin I-angiotensinogen by direct radioimmunoassay. (1984) (55)
Immunocytochemical localization of angiotensinogen in rat liver and kidney (2004) (55)
Presence of renin, angiotensinogen, and converting enzyme in human pituitary lactotroph cells and prolactin adenomas. (1986) (55)
Inhibition of human renin by synthetic peptides derived from its prosegment. (1985) (55)
Regulation of Renin Secretion and Renin Synthesis by Second Messengers in Isolated Mouse Juxtaglomerular Cells (1991) (55)
Hypertension in Dahl salt-sensitive rats: biochemical and immunohistochemical studies. (1992) (55)
A tyrosine residue essential for catalytic activity in aminopeptidase A. (1997) (54)
Structural analysis and evaluation of the 11β‐hydroxysteroid dehydrogenase type 2 (11β‐HSD2) gene in human essential hypertension (1998) (54)
Direct radioimmunoassay of plasma aldosterone in normal subjects. (1978) (53)
Renin mRNA quantification using polymerase chain reaction in cultured juxtaglomerular cells. Short-term effects of cAMP on renin mRNA and secretion. (1993) (53)
Ontogeny of angiotensin II type 2 receptor mRNA expression in fetal and neonatal rat brain (1999) (53)
A new male pseudo-hermaphroditism associated with hypertension due to a block of 17 -hydroxylation. (1972) (52)
Evaluation of the SA locus in human hypertension. (1995) (52)
Rapid identification of patients with essential hypertension sensitive to acebutolol (a new cardioselective beta-blocker). (1976) (52)
Transcriptional induction of the human renin gene by cyclic AMP requires cyclic AMP response element-binding protein (CREB) and a factor binding a pituitary-specific trans-acting factor (Pit-1) motif. (1996) (51)
Critical overexpression of thrombospondin 1 in chronic leg ischaemia (2005) (51)
In vitro studies of progesterone binding proteins in guinea pig uterus. (1972) (51)
Comparative expression of vasopressin and angiotensin type-1 receptor mRNA in rat hypothalamic nuclei: a double in situ hybridization study. (1995) (50)
Synthesis and release of immunoreactive angiotensinogen by rat liver slices. (1983) (50)
Suppression of angiogenesis, tumor growth, and metastasis by adenovirus-mediated gene transfer of human angiotensinogen. (2006) (49)
Statistical test of models and computerised parameter estimation for aldosterone binding in rat kidney (1978) (49)
Polymorphisms of the γ subunit of the epithelial Na+ channel in essential hypertension (1999) (48)
Somatic mutations of the angiotensin II (AT1) receptor gene are not present in aldosterone-producing adenoma. (1997) (48)
Treatment of mild to moderate hypertension with or without the converting enzyme inhibitor enalapril. Results of a six-month double-blind trial. (1987) (48)
Dramatic protective effect of ligand against thermal degradation on mineraloand glucocorticoid receptors of rat kidney. (1977) (48)
Dinucleotide repeat polymorphism in the human angiotensinogen gene. (1991) (47)
HYPERTENSIVE CRISIS IN PATIENT WITH PHÆOCHROMOCYTOMA GIVEN METOCLOPRAMIDE (1976) (47)
Abnormalities of nasal potential difference measurement in Liddle's syndrome. (1998) (47)
Effects of estrogens on renin substrate and uterine weights in rats. (1973) (47)
Human renin inhibitor peptides. (1990) (47)
Disruption of the elastin gene in adult Williams syndrome is accompanied by a paradoxical reduction in arterial stiffness. (2002) (47)
Development and characterization of a radioimmunoassay technique for aldosterone. Application to the study of aldosterone output from perifused frog interrenal tissue. (1980) (46)
A recombinant rat vascular AT1 receptor confers growth properties to angiotensin II in Chinese hamster ovary cells. (1992) (45)
Discrepancy between plasma and lung angiotensin-converting enzyme activity in experimental congestive heart failure. A novel aspect of endothelium dysfunction. (1994) (45)
The renin-angiotensin system in thyroidectomized rats. (1981) (45)
Expression of steroidogenic enzyme messenger ribonucleic acids and corticosteroid production in aldosterone-producing and "nonfunctioning" adrenal adenomas. (1993) (45)
Diuretic and natriuretic effects of nifedipine on isolated perfused rat kidneys. (1982) (44)
Mice Lacking Endothelial ACE: Normal Blood Pressure With Elevated Angiotensin II (2003) (44)
Coexpression of endothelial PAS protein 1 with essential angiogenic factors suggests its involvement in human vascular development (2001) (44)
Study of V(1)-vascular vasopressin receptor gene microsatellite polymorphisms in human essential hypertension. (2000) (44)
Converting-enzyme inhibition buffers the counter-regulatory response to acute administration of nicardipine. (1987) (44)
Effects of captopril and minoxidil on left ventricular hypertrophy in resistant hypertensive patients: a 6 month double-blind comparison. (1990) (43)
Opposite regulation of renin gene expression by cyclic AMP and calcium in isolated mouse juxtaglomerular cells. (1995) (43)
Akt down-regulates ERK1/2 nuclear localization and angiotensin II-induced cell proliferation through PEA-15. (2006) (43)
Genetic Determinants of Nonmodulating Hypertension (2003) (43)
Angiotensinogen, Prorenin, and Renin Are Co-localized in the Secretory Granules of All Glandular Cells of the Rat Anterior Pituitary: An Immunoultrastructural Study (1998) (43)
[The renin-angiotensin-aldosterone system and its suppression]. (1982) (43)
Immunohistochemical characterization of renin-containing cells in the human juxtaglomerular apparatus during embryonal and fetal development. (1981) (42)
Effect of antihypertensive treatment on the left ventricular isomyosin profile in one-clip, two kidney hypertensive rats. (1986) (42)
Comparison of the hormonal and renal effects of captopril in severe essential and renovascular hypertension. (1982) (42)
Isolation and characterization of renin-producing human chorionic cells in culture. (1988) (42)
Link between adipose tissue angiogenesis and fat accumulation in severely obese subjects. (2012) (42)
Angiotensin II (type-1) receptor locus: CA repeat polymorphism and genetic mapping. (1994) (41)
Regulation of kallikrein and renin release by the isolated perfused rat kidney. (1983) (41)
Histidine 450 plays a critical role in catalysis and, with Ca2+, contributes to the substrate specificity of aminopeptidase A. (2000) (41)
1989 guidelines for the management of mild hypertension: memorandum from a WHO/ISH meeting. (1989) (41)
Comparison of the antihypertensive and hormonal effects of a cardioselective beta-blocker, acebutolol, and diuretics in essential hypertension. (1978) (41)
Large Scale Purification of Hog Renin: Physicochemical Characterization (1977) (40)
Quantification of angiogenesis in the chicken chorioallantoic membrane (CAM) (2011) (39)
Can the genetic factors influence the treatment of systemic hypertension? The case of the renin-angiotensin-aldosterone system. (1992) (39)
Abnormalities of renin-containing cells in human glomerular and vascular renal diseases. (1983) (39)
Inhibition of vasopressinergic neurons by central injection of a specific aminopeptidase A inhibitor (1998) (39)
Clinical implications of the molecular biology of the renin-angiotensin system. (1990) (38)
Coexpression of renin, angiotensinogen, and their messenger ribonucleic acids in adrenal tissues. (1992) (38)
Direct Radioimmunoassay of Human Renin (1980) (38)
The Angiotensin I‐Converting Enzyme (Kininase II): Molecular Organization and Regulation of Its Expression in Humans (1992) (38)
Regulation of prorenin secretion in cultured human transfected juxtaglomerular cells. (1987) (37)
Myocardial effect of converting enzyme inhibition in hypertensive and normotensive rats. (1988) (37)
Effects of mineralocorticoid receptor gene disruption on the components of the renin-angiotensin system in 8-day-old mice. (1999) (37)
Role of N-Glycosylation in Human Angiotensinogen* (1998) (37)
Functionality of two new polymorphisms in the human renin gene enhancer region (2002) (36)
Expression of renin in large arteries outside the kidney revealed by human renin promoter/LacZ transgenic mouse. (2002) (36)
Two di-leucine-based motifs account for the different subcellular localizations of the human endothelin-converting enzyme (ECE-1) isoforms. (1999) (35)
Characterization of precursor and secreted forms of rat angiotensinogen. (1984) (35)
Mechanism of action of a new antialdosterone compound, prorenone. (1979) (35)
Co-expression of type 1 angiotensin II receptor (AT1R) and renin mRNAs in juxtaglomerular cells of the rat kidney. (1993) (35)
Effect of adrenalectomy and aldosterone on the modulation of mineralocorticoid receptors in rat kidney. (1981) (34)
Long-term metabolic effects of spironolactone and thiazides combined with potassium-sparing agents for treatment of essential hypertension. (1988) (34)
Blood pressure effects of renin inhibition by human renin antiserum in normotensive marmosets. (1984) (34)
Cloning and functional characterization of a novel mas-related gene, modulating intracellular angiotensin II actions. (1991) (34)
Measurement of angiotensin II concentration in rat plasma: pathophysiological applications. (1989) (34)
Assignment by in situ hybridization of the angiotensinogen gene to chromosome band 1q4, the same region as the human renin gene (1990) (34)
Isolated clinical syndrome of primary aldosteronism in four patients with adrenocortical carcinoma. (1987) (33)
Inhibition of angiogenesis: A new function for angiotensinogen and des(angiotensin I)angiotensinogen (2003) (33)
A functional enhanced green fluorescent protein (EGFP)-tagged angiotensin II at(1a) receptor recruits the endogenous Galphaq/11 protein to the membrane and induces its specific internalization independently of receptor-g protein coupling in HEK-293 cells. (2001) (33)
Aldosterone stimulation by angiotensin II : influence of gender, plasma renin, and familial resemblance. (2000) (33)
Anti‐angiogenic properties of myo‐inositol trispyrophosphate in ovo and growth reduction of implanted glioma (2007) (33)
Antihypertensive effect of enalapril as first-step treatment of mild and moderate uncomplicated essential hypertension. Evaluation by two methods of blood pressure measurement. (1984) (33)
A live-cell assay for studying extracellular and intracellular endothelin-converting enzyme activity. (1997) (33)
Diagnosis and treatment of renin-secreting tumors. Report of three cases. (1984) (32)
Improved diagnosis of unilateral renal artery lesions after captopril administration. (1984) (32)
Immunocytochemical localization of renin in juxtaglomerular cells. (1985) (32)
Cloning and expression pattern of EPAS1 in the chicken embryo (1999) (32)
Renin storage and cell differentiation in juxtaglomerular cell tumors: an immunohistochemical and ultrastructural study of three cases. (1984) (32)
Ontogeny of angiotensin II type 1 receptor mRNAs in fetal and neonatal rat brain (2001) (31)
[The variability of blood pressure]. (1983) (31)
LPS activates ADAM9 dependent shedding of ACE from endothelial cells. (2012) (31)
Detection and localization of renin messenger RNA in human pathologic tissues using in situ hybridization. (1988) (31)
The renin-angiotensin system in pregnancy and parturition. (1986) (31)
Localization of renin gene expression to monkey ovarian theca cells by in situ hybridization. (1992) (30)
Isolation of renin-producing human cells by transfection with three simian virus 40 mutants. (1985) (30)
Urinary cyclic guanosine monophosphate as an indicator of experimental congestive heart failure in rats. (1990) (30)
Troponin T as a marker of differentiation revealed by proteomic analysis in renal arterioles (2004) (30)
A noninternalized nondesensitized truncated AT1A receptor transduces an amplified ANG II signal. (1998) (29)
Effect of labetalol on blood pressure and plasma catecholamine concentrations in patients with phaeochromocytoma. (1980) (29)
Inherited renal tubular dysgenesis: the first patients surviving the neonatal period (2008) (29)
Reduction of plasma and urinary vasopressin during treatment of severe hypertension by captopril (1981) (29)
Direct, simplified, and sensitive assay of angiotensin II in plasma extracts performed with a high-affinity monoclonal antibody. (1992) (29)
Synthesis of peptides related to the prosegment of mouse submaxillary gland renin precursor: an approach to renin inhibitors. (1984) (29)
Characterization of the first angiotensin-converting like enzyme in bacteria: Ancestor ACE is already active (2007) (29)
Vascular smooth muscle cells efficiently activate a new proteinase cascade involving plasminogen and fibronectin (2003) (28)
Segmental homology between the promoter region of the human renin gene and the mouse ren1 and ren2 promoter regions. (1986) (28)
Influence of observer's expectation on the placebo effect in blood pressure trials (1987) (28)
Rabbit testosterone-binding-globulin. I. Physico-chemical properties. (1973) (28)
Seven lessons from seven renin secreting tumors. (1988) (28)
Radioimmunoassay of urinary antidiuretic hormone in man: stimulation-suppression tests. (1974) (27)
Molecular genetics of the renin-angiotensin-aldosterone system in human hypertension (1995) (27)
Volume-dependent parameters in essential hypertension. (1977) (27)
Functional analysis of the human somatic angiotensin I-converting enzyme gene promoter. (1993) (27)
Human-chimpanzee DNA sequence variation in the four major genes of the renin angiotensin system. (2000) (27)
[Recent advances in the clinical study of the renin system. Reference values and conditions of validity]. (1989) (27)
Steroidogenesis in aldosterone-producing adenoma revisited by transcriptome analysis. (2005) (26)
Genetic, biochemical, and clinical studies of patients with A328V or R213C mutations in 11betaHSD2 causing apparent mineralocorticoid excess. (1999) (26)
ATP6AP2 variant impairs CNS development and neuronal survival to cause fulminant neurodegeneration. (2019) (26)
The Angiotensin I‐Converting Enzyme (Kininase II): Progress in Molecular and Genetic Structure (1990) (26)
Angiotensinogen production by rat hepatoma cells in culture and analysis of its regulation by techniques of somatic cell genetics (1983) (26)
New renin inhibitors homologous with pepstatin. (1981) (25)
Biochemical Similarity of Partially Purified Inactive Renins from Human Plasma and Kidney (1982) (25)
Rabbit testosterone-binding-globulin. II. Effect on androgen metabolism in-vivo. (1973) (25)
Production and characterization of human renin antibodies with region-oriented synthetic peptides. (1987) (25)
Recent developments in pheochromocytoma diagnosis and imaging. (1988) (25)
In vitro and in vivo inhibition of the 2 active sites of ACE by omapatrilat, a vasopeptidase inhibitor. (2000) (25)
Evidence for a single active site in the human angiotensin I-converting enzyme from inhibitor binding studies with [3H] RU 44 403: role of chloride. (1989) (25)
Migration‐stimulating factor displays HEXXH‐dependent catalytic activity important for promoting tumor cell migration (2005) (25)
Angiotensinogen impairs angiogenesis in the chick chorioallantoic membrane (2007) (24)
Differential effects of inflammation models on rat T-kininogen and rat angiotensinogen. (1988) (24)
Methodologic problems in plasma renin activity measurements. (1976) (24)
Angiotensin I-converting enzyme in amniotic fluid. (1984) (24)
Importance of the lactonic ring in the activity of steroidal antialdosterones. (1980) (24)
Toward a Role for Angiotensin‐Converting Enzyme in Insects (1998) (23)
Cortisol metabolism and excretion in the isolated perfused rat kidney (1977) (23)
Molecular cloning, expression and tissue distribution of a chicken angiotensin II receptor (1996) (23)
Characterization of a Human Angiotensinogen Cleaved in Its Reactive Center Loop by a Proteolytic Activity from Chinese Hamster Ovary Cells* (2000) (23)
Characterization of the first non-insect invertebrate functional angiotensin-converting enzyme (ACE): leech TtACE resembles the N-domain of mammalian ACE. (2004) (23)
Abnormal regulation of antidiuretic hormone in idiopathic edema. (1979) (23)
Cleavage of arginyl-arginine and lysyl-arginine from the C-terminus of pro-hormone peptides by human germinal angiotensin I-converting enzyme (ACE) and the C-domain of human somatic ACE. (1997) (23)
Acute antihypertensive effect and pharmacokinetics of a tablet preparation of nifedipine (2004) (23)
Identification of Endocrine Cell Populations Expressing the AT1B Subtype of Angiotensin II Receptors in the Anterior Pituitary. (1999) (22)
Regulation of human renin secretion and gene transcription in Calu‐6 cells (1997) (22)
Effects of selective and nonselective beta adrenergic agents on renin secretion in isolated perfused rat kidney. (1980) (22)
Aldosterone metabolism in isolated perfused rat kidney. (1978) (22)
The high‐molecular‐mass kininogen deficient rat expresses all kininogen mRNA species, but does not export the high‐molecular‐mass kininogen synthesized (1988) (22)
Hydrolysis of rat high molecular weight kininogen by purified rat urinary kallikrein: identification of bradykinin as the kinin formed. (1986) (22)
Renal damage induced in the clipped kidney of one-clip, two-kidney hypertensive rats during normalization of blood pressure by converting enzyme inhibition. (1987) (22)
Enhanced expression of ephrins and thrombospondins in the dermis of patients with early diffuse systemic sclerosis: potential contribution to perturbed angiogenesis and fibrosis. (2011) (22)
In vivo assessment of captopril selectivity of angiotensin I-converting enzyme inhibition: differential inhibition of acetyl-ser-asp-lys-pro and angiotensin I hydrolysis. (1999) (22)
Increased steroid metabolic clearance rate in anephric patients. (1974) (21)
Characterization of precursor and secreted forms of human angiotensinogen. (1985) (21)
Evaluation of slow release nicardipine in essential hypertension by casual and ambulatory blood pressure measurements. Effects of acute versus chronic administration. (1987) (21)
Evidence that renal and chorionic tissues contain similar nuclear binding proteins that recognize the human renin promoter. (1996) (21)
Influence of converting enzyme inhibition on the hormonal and renal adaptation to hyper- and hyponatraemic dehydration. (1986) (21)
Immunologic approaches to blockade of the renin-angiotensin system: a review. (1989) (21)
Biochemical and immunological characterization of ectopic tumoral renin. (1982) (20)
Effect of bradykinin and kininogens in isolated rat kidney vasoconstricted by angiotensin II. (1990) (20)
N-domain selectivity of angiotensin I-converting enzyme as assessed by structure-function studies of its highly selective substrate, N-acetyl-seryl-aspartyl-lysyl-proline. (1999) (20)
Angiotensinogen's role in ANG formation, renin release, and renal hemodynamics in isolated perfused kidney. (1989) (20)
Monoiodinated angiotensins: preparation and characterization by polyacrylamide gel electrophoresis and isoelectric focusing. (1973) (20)
Monoclonal antibody against human renin. (1981) (19)
Are mineralocorticoid receptors present in human renal adenocarcinoma? (1979) (19)
Regulation of human renin secretion and renin transcription by quantitative PCR in cultured chorionic cells: synergistic effect of cyclic AMP and protein kinase C. (1993) (19)
Maturation-dependent changes of angiotensin receptor expression in fowl. (2003) (19)
Inhibition of human plasma renin activity by pepstatin. (1976) (19)
Plasma renin activity in phaeochromocytoma: effects of beta-blockade and converting enzyme inhibition. (1988) (19)
Polymorphisms of the gamma subunit of the epithelial Na+ channel in essential hypertension. (1999) (19)
Calmodulin antagonists stimulate renin secretion and inhibit renin synthesis in vitro. (1992) (19)
Influence of converting-enzyme inhibition on rat des-angiotensin I-angiotensinogen. (1984) (19)
Antihypertensive effect of fractionated sublingual administration of nifedipine in moderate essential hypertension (2004) (19)
Expression of PC2 and PC1/PC3 in human pheochromocytomas (1994) (18)
[Angiotensin II receptor blockers: current status and future prospects]. (2002) (18)
Structure of the Mouse Submaxillary Gland Renin Precursor and a Model for Renin Processing: Arthur C. Corcoran Memorial Lecture (1983) (18)
Arginine vasopressin gene regulation in the homozygous Brattleboro rat. (1990) (18)
Identification of endocrine cell populations expressing the AT1B subtype of angiotensin II receptors in the anterior pituitary. (1999) (18)
The renin-angiotensin system in the rat brain (1988) (18)
Compared Properties of Trandolapril, Enalapril, and Their Diacid Metabolites (1994) (17)
Effects of the Selective Neutral Endopeptidase Inhibitor, Retrothiorphan, on Renal Function and Blood Pressure in Conscious Normotensive Wistar and Hypertensive DOCA-Salt Rats (1992) (17)
Partial characterization of hog renin purified by affinity chromatography. (1976) (17)
Stimulation by hCG of ovarian inactive renin synthesis in rabbit preovulatory theca cells. (1990) (17)
Rat high-molecular-weight kininogen: purification, production of antibodies and demonstration of lack of immunoreactive kininogen in a strain of brown Norway rats. (1985) (17)
Angiopoietin 2 Alters Pancreatic Vascularization in Diabetic Conditions (2012) (17)
Vaule of renin measurement, saralasin test, and acebutolol treatment in hypertension. (1979) (17)
Angiotensinogen production and consumption in the adrenalectomized rat. (1985) (17)
[Physiological angiogenesis]. (2001) (17)
[Genetic study of renal artery fibromuscular dysplasia]. (1998) (17)
Sodium balance and renin regulation in rats: role of intrinsic renal mechanisms. (1980) (17)
Effect of acid trypsin and cold treatment and of renin--plasma interaction on the activity of renin secreted by rat kidney. (1979) (17)
Anti-hypertensive adrenergic-blocking agents: effects on sodium balance, the renin-angiotensin system and haemodynamics. (1975) (17)
The Natural Mutation Y248C of Human Angiotensinogen Leads to Abnormal Glycosylation and Altered Immunological Recognition of the Protein (*) (1996) (17)
How much can blood pressure be lowered? (1983) (17)
Renal segmental infarction: a cause of reversible malignant hypertension. (1984) (17)
Effect of mestranol on cell proliferation and angiotensinogen production in HepG2 cells: relation with the cell cycle and action of tamoxifen. (1987) (16)
Molecular biology of the angiotensin I converting enzyme (1996) (16)
Immunological approach to blockade of the renin-substrate reaction (1989) (16)
Short report: HYPERGENE a clinical and genetic database for genetic analysis of human hypertension (1994) (16)
Phorbol ester inhibits erythropoietin production in human hepatoma cells (Hep G2). (1992) (16)
Effect of acute potassium loading on plasma renin and on urinary aldosterone in rats. (1977) (16)
Familial hyperkalemic hypertension (Gordon syndrome): evidence for phenotypic variability in a study of 7 families. (2001) (16)
A mutant renin gene in familial elevation of prorenin. (1994) (16)
Kinetic studies of rat renin and tonin on purified rat angiotensinogen. (1984) (16)
Earliest renin containing cell differentiation during ontogenesis in the rat (2004) (16)
The application of molecular genetics to the study of familial arterial hypertension. (1990) (15)
Abnormalities and drug-induced alterations of vasopressin in human hypertension. (1981) (15)
Regional mapping of the human renin gene to 1q32 by in situ hybridization. (1989) (15)
Comparative trial of labetalol and acebutolol, alone or associated with dihydralazine, in treatment of essential hypertension. (1980) (15)
Direct radioimmunoassay and immunocytochemical localization of renin in human kidneys. (1979) (15)
Fluorimetric assay of renin. (1978) (15)
Angiotensinogen Modulates Renal Vasculature Growth (2006) (15)
Binding and antimineralocorticoid activities of spirolactones in toad bladder. (1983) (15)
Liddle’s syndrome: Heritable human hypertension caused by mutations in the ß subnit of the epithelial sodium channel (1995) (15)
Aminopeptidase A activity and angiotensin III effects on [Ca2+]i along the rat nephron. (1999) (15)
Antisera to human renin normalize renin-dependent hypertension in the monkey: therapeutic implications. (1984) (14)
Acute antihypertensive and hormonal effects of a calcium antagonist in essential hypertension. (1982) (14)
Structural analysis and evaluation of the 11beta-hydroxysteroid dehydrogenase type 2 (11beta-HSD2) gene in human essential hypertension. (1998) (14)
Measurement of active renin by the 4G1 anti-human renin monoclonal antibody. (1987) (14)
Diminished number of renin-containing cells in kidney biopsy samples from hypertensive women immediately postpartum: an immunomorphologic study. (1984) (14)
Liver angiotensinogen synthesis and release during captopril treatment in sodium-depleted rats. (1987) (14)
Potentiation of [Ca2+]i response to angiotensin III by cAMP in cortical thick ascending limb. (2002) (14)
Relationship of plasma renin activity and aldosterone levels with hemodynamic functions in essential hypertension. (1977) (14)
Long-term experience of spironolactone in essential hypertension. (1988) (14)
Metabolism of radioactive 5a-androstane-3, 17-diol (1970) (14)
[Detection, diagnosis and localization of pheochromocytoma. 77 cases in a population of 21,420 hypertensive patients]. (1987) (14)
Multiple Forms of Human Renin (1979) (14)
Absence of cell surface expression of human ACE leads to perinatal death (2013) (13)
Functional study of the germinal angiotensin I-converting enzyme promoter. (1992) (13)
Advantages and drawbacks of AVP radioimmunoassay in plasma and urine of normal subjects. (1981) (13)
Molecular characterization of the mineralocorticoid receptor in pseudohypoaldosteronism (1995) (13)
Osmoregulation and renal effects of vasopressin in normal and mildly hypertensive subjects. (1984) (13)
Genetic Approaches to Coronary Heart Disease and Hypertension (1991) (13)
Selective recognition of M235T angiotensinogen variants and their determination in human plasma by monoclonal antibody-based immunoanalysis. (1996) (13)
Expression of endothelins in human cardiogenesis (2002) (13)
Loss-of-function point mutations associated with renal tubular dysgenesis provide insights about renin function and cellular trafficking. (2011) (12)
[Hyperaldosteronism sensitive to dexamethasone with adrenal adenoma. Clinical, biological and genetic study]. (1995) (12)
Characterization of five epitopes of human renin from a computer model. (1988) (12)
Blood pressure response to angiotensin II, low-density lipoprotein cholesterol and polymorphisms of the angiotensin II type 1 receptor gene in hypertensive sibling pairs (2001) (12)
Purification of neurophysins by affinity chromatography. (1974) (12)
In vitro and in vivo inhibition of human and primate renin by a new potent renin inhibitor: SR 42128. (1985) (12)
[Localization of primary hyperaldosteronism]. (1988) (12)
The angiotensin I-converting enzyme (kininase II): molecular and regulatory aspects. (1992) (12)
Investigation of the biochemical effects of renin inhibition in normal volunteers treated by an ACE inhibitor. (1992) (12)
Physicochemical properties of plasma renin substrate in normal, binephrectomized, and estrogen-treated rats. (1974) (12)
Atrial natriuretic factor as a marker in congestive heart failure. (1990) (12)
Expression and Characterization of Recombinant Human Angiotensin I-converting Enzyme (2001) (12)
Hyporeninemic hypoaldosteronism in infancy: a familial disease. (1984) (12)
Plasma angiotensin in binephrectomised mice. (1995) (12)
Molecular Biology as a Tool for Genetic Research in Hypertension: Application to the Renin Gene (1988) (12)
The kallikrein-kinin system in the rat hypothalamus (1991) (11)
The role of the renin-angiotensin system in blood pressure regulation in normotensive animals and man. (1984) (11)
Differential effects of nephrectomy and surgery on plasma kininogens and angiotensinogen in the rat. (1988) (11)
Dissection of silencer elements in first intron controlling the human renin gene. (1999) (11)
Role of cyclic AMP in renin secretion by human transfected juxtaglomerular cells. (1986) (11)
Expression of the endothelin-converting enzyme-1 isoforms in endothelial cells. (2000) (11)
RENIN SECRETION FROM MALIGNANT PULMONARY METASTATIC TUMOUR CELLS OF VASCULAR ORIGIN (1987) (11)
Synthesis and Renin Inhibitory Properties of a New Soluble Pepstatin Derivative (1980) (11)
Regulation of human renin gene transcription by cAMP. (1997) (11)
The enigma of pseudohypoaldosteronism (1994) (11)
Transcriptome Analysis of Human Reninomas as an Approach to Understanding Juxtaglomerular Cell Biology (2017) (11)
Effect of dexamethasone on kininogen production by a rat hepatoma cell line. (1988) (11)
The Peculiar Characteristics of the Amino Acid Sequence of Angiotensin I‐Converting Enzyme, as Determined by cDNA Cloning of the Human Endothelial Enzyme (1989) (11)
One-step separation of human plasma angiotensinogen from renin. (1974) (11)
Successful detection by in situ cDNA hybridization of three members of the serpin family: angiotensinogen, alpha 1 protease inhibitor, and antithrombin III in human hepatocytes. (1990) (11)
HYPERGENE: a clinical and genetic database for genetic analysis of human hypertension (1994) (11)
Desensitization of type 1 angiotensin II receptor subtypes in the rat kidney. (2001) (11)
Monoclonal antibodies to human angiotensinogen: development of an ELISA for measurement of hepatocyte cultured cells content. (1987) (11)
Effects of captopril on blood pressure, electrolytes, and certain hormones in hypertension (1981) (11)
Modulation of aldosterone receptors in rat kidney: effects of steroid treatment and potassium diet. (1984) (10)
Influence of previous diuretic intake on the humoral and hormonal profile of idiopathic oedema (1981) (10)
A monoclonal antibody for immunopurification of human renin. (1981) (10)
Effect of sex hormones on plasma T-kininogen in the rat. (1989) (10)
Angiotensin I-converting enzyme in a suprasellar germinoma. (1987) (10)
Direct radioimmunoassays of renin and renin substrate during converting-enzyme inhibition. (1982) (10)
Maturation-dependent neointima formation in fowl aorta. (2001) (10)
New therapeutic prospects of renin-angiotensin system inhibition. (1989) (10)
Production and properties of a recombinant soluble form of aminopeptidase A. (1998) (10)
The enigma of pseudohypoaldosteronism. (1994) (10)
Comparative effects of canrenoate-k and prorenoate-k upon aldosterone biosynthesis in perifused frog interrenal glands (1979) (10)
Crystallization of mouse submaxillary gland renin. (1982) (10)
Molecular structure and mechanisms of action of mammalian angiotensin II receptors (1995) (10)
Contraception in hypertensive women using a vaginal ring delivering estradiol and levonorgestrel. (1986) (10)
Simultaneous measurement of beta-endorphin, lipotrophins and met-enkephalin in phaeochromocytomas. (1982) (10)
Angiotensin receptor(s) in fowl. (2001) (9)
Dose Dependency of Captopril Effects in Severely Hypertensive Patients (1981) (9)
Exclusion of Angiotensin I-Converting Enzyme as a Candidate Gene Involved In Exudative Inflammatory Resistance in F344/N Rats (2000) (9)
Angiogenesis and Diabetes: Different Responses to Pro-Angiogenic Factors in the Chorioallantoic Membrane Assay (2008) (9)
Synthetic cDNA encoding the rat AT1a receptor: a useful tool for structure-function relationship analysis. (1994) (9)
Tumor-dependent hypertension. (1984) (9)
Dosage radioimmunologique de la vasopressine plasmatique. (1980) (9)
Effects of Transdermal Clonidine in Young and Elderly Patients with Mild Hypertension: Evaluation by Three Noninvasive Methods of Blood Pressure Measurement (1987) (9)
Prostaglandins and hypertension in chronic renal diseases. (1975) (9)
Several interesting phenotypes of the AT1 receptor produced by site-directed mutagenesis. (1999) (9)
Analysis of inactive renin by renin profragment monoclonal antibodies (1986) (9)
Mineralocorticoid receptors during normal kidney growth and compensatory renal hypertrophy. (1981) (8)
Angiotensin-I-converting enzyme in germinomas. (1988) (8)
Can inhibition of the renin-angiotensin system have a cardioprotective effect? (1985) (8)
RENIN INHIBITION: IMMUNOLOGICAL PROCEDURES AND RENIN INHIBITOR PEPTIDES (1988) (8)
Radioimmunoassay of prostaglandins A and B in human blood. (1976) (8)
Involvement of a pertussis toxin-sensitive G protein in the regulation of angiotensinogen production by an angiotensin II analog in HepG2 cells. (1990) (8)
Secretion of Renin–Angiotensin System (RAS) Components by Normal and Tumoral Lactotropes: A Comparative Study Using Reverse Hemolytic Plaque Assay (RHPA) and Immunoelectron Microscopy (2000) (8)
Testosterone: a specific competitive antagonist of aldosterone in the toad bladder. (1980) (8)
Renin localization in segmental renal hypoplasia (1981) (8)
Are angiotensin converting enzyme inhibition and aldosterone antagonism equivalent in hypertensive patients over fifty? (1991) (8)
Hypokalemia, aldosteronism, and renal cysts. (1990) (8)
ACE sets up fertilization (2005) (7)
- 1-CHARACTERIZATION OF THE EXPRESSION OF THE HYPOXIA-INDUCED GENES NEURITIN , TXNIP AND IGFBP 3 IN CANCER (2017) (7)
[Primary hyperaldosteronism: diagnostic value of the administration of a single dose of captopril]. (1983) (7)
Improved Diagnosis of Unilateral Renal Artery Lesions After Captopril Administration (1984) (7)
Expression of the chicken angiotensin II receptor: atypical pattern compared to its mammalian homologues (1999) (7)
Spirolactones: clinical and pharmacologic studies. (1977) (7)
Functional interactions of L-162,313 with angiotensin II receptor subtypes and mutants. (1998) (7)
Expression and characterization of recombinant human angiotensinogen in a heterologous eukaryotic cell line. (1988) (7)
A double-blind randomized evaluation of converting enzyme inhibition as the first-step treatment of mild to moderate hypertension. (1984) (7)
Soluble pepstatins: a new approach to blockade in vivo of the renin-angiotensin system. (1978) (7)
A noninternalized nondesensitized truncated AT1A receptor transduces an amplified ANG II signal. (1998) (6)
Tritiated 9α-fluorocortisol metabolism and binding in rat kidney (1977) (6)
[Radioimmunoassays of aldosterone and plasma renin activity. Application to the diagnosis of primary aldosteronism]. (1973) (6)
[Results of the surgical treatment of Conn's adenomas]. (1987) (6)
Purification of 125I-labelled lysine-vasopressin by affinity chromatography on sepharose-bound neurophysins. (1973) (6)
Aminopeptidase N during the ontogeny of the chick. (2006) (6)
Production and characterization of monoclonal antibodies to rat angiotensinogen. (1984) (6)
Hydrolysis by somatic angiotensin-I converting enzyme of basic dipeptides from a cholecystokinin/gastrin and a LH-RH peptide extended at the C-terminus with gly-Arg/Lys-arg, but not from diarginyl insulin. (1999) (6)
[A simple diagnostic test for primary hyperaldosteronism]. (1983) (6)
Mouse submaxillary renin: a useful model for the study of renal renin. (1983) (6)
A chicken model of pharmacologically-induced Hirschsprung disease reveals an unexpected role of glucocorticoids in enteric aganglionosis (2015) (6)
Inhibition of angiotensinogen production by angiotensin II analogues in human hepatoma cell line. (1989) (6)
Immunocytochemical localization of albumin, transferrin, angiotensinogen and kininogens during the initial stages of the rat liver differentiation (2004) (6)
Early expression of all components of the renin-angiotensin system in human development. (1998) (6)
Vascular effects and metabolism of angiotensins and their metabolites in the isolated perfused rat kidney. (1983) (6)
Synthesis, conformation, and antibody recognition of peptides built of the sequence of the flap of human renin (1988) (6)
Evaluation of the Spacelabs Ambulatory Blood Pressure Recorder: Comparison with the Remler M2000 (1986) (6)
Immunological characterization of rat kininogens with monoclonal antibodies to T-kininogen. Distinction between the different domains of T-kininogen and the multiple rat kininogens. (1992) (6)
Angiotensin I-converting enzyme in foetal membranes and chorionic cells in culture. (1984) (6)
Takayasu's aortitis with renovascular hypertension: successful complex revascularization. (1981) (6)
Dynamic study of antidiuretic hormone during benign mineralocorticoid and metacorticoid hypertension. (1980) (5)
Cytoplasmic and nuclear uptake of aldosterone in toad bladder: a mathematical modeling approach. (1985) (5)
Biologically active monoiodinated salmon calcitonin purified by polyacrylamide gel electrophoresis. (1973) (5)
Aminopeptidase A, generating one of the main effector peptides of the brain renin-angiotensin system, angiotensin III, plays a key role in central control of blood pressure. (2000) (5)
Enzymatic activity of renin in plasma of normal and uraemic subjects. (1984) (5)
Processing of rat and human angiotensinogen precursors by microsomal membranes (1985) (5)
Renin Purification and Cloning (1991) (5)
[Antihypertensive drugs during pregnancy]. (1975) (5)
Tonin as activator of renin. (1982) (5)
New developments in metabolic syndrome (2005) (5)
Activation of renin in an anaplastic pulmonary adenocarcinoma. (1981) (5)
Can we live without a functional renin-angiotensin system? (2008) (5)
Tyrosine kinase and mitogen-activated protein kinase/extracellularly regulated kinase differentially regulate intracellular calcium concentration responses to angiotensin II/III and bradykinin in rat cortical thick ascending limb. (2006) (5)
Renal arteriovenous fistula: a model for renovascular hypertension in rat. (1983) (5)
Effect of thyroidectomy on rat T-kininogen. (1988) (5)
Physicochemical properties of non-activated and activated renin from human amniotic fluid. (1979) (5)
Immunochemical differences between angiotensin I-forming enzymes in man. (1980) (5)
Renin Activity and the Response to Beta-Blockade (1981) (4)
Cleavage-secretion of angiotensin I-converting enzyme in yeast (1997) (4)
[Sexual side-effects of spironolactones. Possible mechanisms of their anti-androgen action]. (1976) (4)
Study of the Antigenic Determinants of Human Renin (1986) (4)
Noradrenaline producing phaeochromocytomas with absent pressor response to beta-blockade. (1979) (4)
Consequences of renal morphologic damage induced by inhibition of converting enzyme in rat renovascular hypertension. (1987) (4)
Effects of glucocorticoids and antiglucocorticoid on angiotensinogen production by hepatoma cells in culture (1984) (4)
Efficacy and influence on quality of life of enalapril as a first step treatment of hypertension. (1987) (4)
Epithelioid sarcoma of soft tissues: a case of extrarenal renin-secreting tumour. (1988) (4)
[Malignant adrenal cortex carcinoma revealed by an isolated picture of primary hyperaldosteronism]. (1988) (4)
INCREASED URATE EXCRETION AFTER o,p'-DDD (1978) (4)
[Recent advances in the investigation of the renin-angiotensin and cardiac natriuretic systems in patients with chronic heart insufficiency]. (1991) (4)
Acute effects of a pseudo-tetrapeptide as renin inhibitor on blood pressure and renin-angiotensin system of sodium-repleted and sodium-depleted hypertensive patients. (1993) (4)
Predictive Factors of the Blood Pressure Fall Induced by Intravenous Nicardipine (1989) (4)
The difficult challenge of cloning the angiotensin II receptor. (1990) (4)
[From the renin gene to renin inhibitors]. (1986) (3)
Solution synthesis of antigenic and inhibiting peptides of the human renin prosegment-1. [Tyr47, Nle53] preprorenin-(47-60) peptide methyl ester. (1986) (3)
Thyroid hormone receptors and stimulation of angiotensinogen production in HepG2 cells (2007) (3)
Test diagnostique simple de l'hyperaldostéronisme primaire. (1983) (3)
Frequency of a polymorphism of the alpha subunit of the epithelial NA channel in essential hypertension (1998) (3)
Human antirenin antibody: a new tool for studying the renin-angiotensin system. (1983) (3)
Compliance to Antihypertensive Therapy (1982) (3)
A rapid high-performance liquid chromatography purification method of iodinated polypeptide hormones. (1980) (3)
Molecular and Physiological Aspects of Angiotensin I Converting Enzyme (2011) (3)
Renin and cathepsin B in human pituitary lactotroph cells (2004) (3)
Binding of a Tritiated Pepstatin Analog to Human Renin (1987) (3)
[Scientific integrity: the need for a systemic approach]. (2017) (3)
[A meeting of clinical investigation centers]. (2004) (3)
The effects of converting enzyme inhibitors on plasma angiotensinogen and plasma aldosterone in sodium-depleted rats. (1983) (3)
Renin immunization and angiotensin converting enzyme inhibition in the normotensive marmoset. (1989) (3)
Antihypertensive and hormonal effects of single oral doses of Captopril and Nifedipine in essential hypertension (2004) (3)
[VEGF, anti-vEGF and diseases]. (2008) (3)
Co-expression of PC2 and proenkephalin in human tumoral adrenal medullary tissues. (1994) (3)
[Variations of the renin aldosterone system in Cushing's disease (author's transl)]. (1980) (2)
[The renin-angiotensin-aldosterone system in hypertensive patients. II. Diagnosis of primary hyperaldosteronism]. (1977) (2)
Effect of the circulating renin-angiotensin system on prolactin release in humans. (1990) (2)
[New data on mineralocorticoid hormones. Physiopathological implications]. (1995) (2)
[Antiandrogenic effect of spirolactones: different mechanisms of action (author's transl)]. (1976) (2)
A potent radiolabeled human renin inhibitor, [3H]SR42128: enzymatic, kinetic, and binding studies to renin and other aspartic proteases. (1987) (2)
15. Analytical study of gluco- and mineralocorticoid receptors in rat kidney. Dramatic protective effect of ligand on mineralocorticoid receptors (1975) (2)
[Hypertensive episodes initiated by sulpiride (Dogmatil)]. (1973) (2)
[Variability of arterial pressure during consultation. Effect of the physician and patient characteristics]. (1985) (2)
Report of the task force on carcinogenic potential. (1966) (2)
[Pharmacoclinical study of oral butofilolol in arterial hypertension. Effects on heart rate, blood pressure and the renin-angiotensin system]. (1983) (2)
The endothelin system and renin in human fetal membranes. (2005) (2)
[Sensitive radioimmunoassay for plasma arginine vasopressin (author's transl)]. (1980) (2)
Effects of circulating renin substrate on renal function in isolated perfused rat kidney. (1983) (2)
[Immunisation of spontaneously hypertensive rats against angiotensin I]. (1989) (2)
Adaptation to sodium restriction in renin-immunized spontaneously hypertensive and normotensive rats. (1992) (2)
Acute inhibition of the renin-angiotensin system: interest and limits to detect surgically curable hypertension. (1985) (2)
A recombinant form of angiotensin converting enzyme expressed from baculovirus-infected insect cells. (1994) (2)
[Equilibration of the treatment of severe arterial hypertension. Significance of d-1 propranolol]. (1975) (2)
chick embryo Role of the renin-angiotensin system in primitive erythropoiesis in the (2013) (2)
[Comparison of 3 methods of blood pressure measurement in obesity]. (1988) (2)
Direct radioimmunoassay for rat high molecular weight kininogen. Measurement of immunoreactive high molecular weight kininogen in normal and kininogen deficient plasma. (1987) (2)
Influence of beta-blockade on aldosterone metabolism under normal and low sodium diet in man. (1977) (2)
[Role of the renin-angiotensin system in arterial hypertension with aortic coarctation in young adults]. (1980) (2)
Renin inhibition: immunological procedures and renin inhibitor peptides. (1989) (2)
A7: Search for susceptibility loci to hypertension in a region on human chromosome 20Q, the homologous region to rat chromosome 3 (1997) (2)
In vitro biosynthesis of human renin: evidence for a high molecular weight form. (1982) (2)
[Predictive factors of resistance to antihypertensive treatment]. (1987) (2)
Potentials and limitations of angiotensin converting enzyme inhibition in the treatment of hypertension. (1984) (2)
A comparison of multiple forms of renin in rat renal perfusate with those in renal extract. (1980) (2)
[Progesterone, progestatins and water and sodium metabolism]. (1981) (2)
Circulating and tissue renin-angiotensin system: present and future. (1989) (2)
VEGF, anti-VEGF et pathologies (2008) (1)
Contributions cis-Regulatory Elements and transActing Factors Directing Basal and cAMP-Stimulated Human Renin Gene Expression in Chorionic Cells (2005) (1)
[Primary hyperaldosteronism due to bilateral adrenal hyperplasia of the adrenals. Study based upon one case and a review of the literature (author's transl)]. (1978) (1)
The future of hypertension and renin research. (1986) (1)
[A case of apparent mineralocorticoid excess caused by type 2 11 beta- hydroxysteroid dehydrogenase deficiency]. (1997) (1)
[Comparison of the effect of captopril and minoxidil on left ventricular mass. Results of a 6-month comparative double-blind test]. (1987) (1)
A new ACE on the table: ACE2 expression in human atherosclerosis. (2005) (1)
[Essential arterial hypertension. Effects of labetalol on blood pressure and renin-angiotensin system (author's transl)]. (1980) (1)
Molecular cloning and complete amino acid sequence of human angiotensin i converting enzyme (1988) (1)
B009: The type 1 Angiotensin II Receptor Gene (AT1R) is not involved in the genetic variability of aldosterone response to AII infusion (1998) (1)
[Phaeochromocytoma: localisation by computerised scanner tomography. 5 cases (author's transl)]. (1979) (1)
[Hypertensive episodes triggered by sulpiride]. (1974) (1)
β-Adrenoceptor Blocking Drugs and the Renin-Angiotensin System (1980) (1)
Angiotensin I-converting enzyme (ACE) gene structure and polymorphism: Relation to enzyme function and gene expression (2018) (1)
[A new diagnostic test for primary tumoral hyperaldosteronism]. (1983) (1)
[Plasma transport of androgens and its physiopathologic consequences]. (1971) (1)
[Parotid steroid excretion in relation to plasma cortisol variations]. (1973) (1)
Evaluation of the capacity of gel electrophoresis, steadystate and transient state electrofocusing to resolve native human des‐angiotensin‐I‐angiotensinogen from angiotensinogen (1985) (1)
[Double-blind evaluation of slow-release nicardipine using different methods of blood pressure measurement. Predictive value of the acute response to intravenous nicardipine]. (1987) (1)
THE ANTI-INFLAMMATORY OF GLYCYRRHETINIC ACID TO KIDNEY MINERALCORTICOID AND GLUCOCORTICOID RECEPTOR (1975) (1)
of the Renin System (1984) (1)
A018 Modulation of macrophage activation state protects tissue from necrosis during critical limb ischemia in thrombospondin-1-deficient mice (2009) (1)
[Transluminal angioplasty in renovascular hypertension with renal insufficiency]. (1988) (1)
The entire renin???angiotensin system exists in human adrenal glands (1992) (1)
[Evaluation of the antihypertensive effect of capsule and tablet forms of nifedipine in moderate hypertension]. (1985) (1)
Molecular mechanisms in renin control (1994) (1)
[Kallikrein-kinin system, the kidney and arterial pressure]. (1988) (1)
[Effect of apelin in cardiovascular system and water metabolism]. (2009) (1)
Circulating and tissular renin-angiotensin systems. (1989) (1)
Ontogeny of Angiotensin II Type 1 Receptor mRNAs in Fetal and Neonatal Rat Brain: Implications for Systemic Cardiovascular Control (1999) (1)
[Hemodynamic study, under hot and cold conditions, of the digital artery in arterial hypertension and the effects of cardioselective and non-cardioselective beta blocker treatment]. (1986) (1)
Special issue on proteolysis (2005) (1)
967. Angiotensinogen Inhibits Growth and Angiogenesis of Human Mammary Carcinoma and Prevents Pulmonary Metastasis of Murine Melanoma Cancer (2004) (1)
5. Single intravenous nicardipine dose: a new diagnosis test in renovascular hypertension (1991) (1)
[Left ventricular involvement in Conn adenoma, renovascular hypertension and pheochromocytoma before and after etiological treatment]. (1992) (1)
[Hypotensive effect of a human anti-renin monoclonal antibody (4G1D8) in the sodium-depleted alert marmoset]. (1986) (1)
[Renal tubular dysgenesis and mutations in the renin-angiotensin system genes]. (2014) (1)
Neural guidance molecules in vascular development (2006) (1)
relations between free fatty acids and protein metabolism in vivo (1992) (1)
[Proteomic analysis of proteins involved in the renal phenotype in renovascular hypertension]. (2004) (1)
Human Plasma and Kidney Inactive Renin is Prorenin (1986) (1)
[Effect of furosemide and ACTH on plasma renin, aldosterone and cortisol levels in normal man]. (1975) (1)
Molecular Genetics and Familial Arterial Hypertension (1991) (1)
[Acute response to calcium inhibitors in secondary arterial hypertension: does renin play a role?]. (1988) (1)
Solution synthesis of antigenic and inhibiting peptides of the human renin prosegment-2. [Tyr40] preprorenin-(40-50) peptide methyl ester. (1986) (1)
[The renin-angiotensin system in human brain and brain tumors: a function unrelated to blood pressure control?]. (2004) (1)
[Identification and characterization of neutral endopeptidase in endothelial cells of arterial or venous origin]. (1992) (1)
[Primary hyperaldosteronism - Conn's syndrome]. (1979) (1)
Effect of thyroidectomy on rat plasma T-kininogen concentration as demonstrated by a new and direct T-kininogen radioimmunoassay. (1989) (1)
EPIDEMIOLOGY OF RENIN (1983) (1)
Blood Pressure Variability: Influence of Physicians and of Some Patients?? Characteristics (1985) (1)
[Anti-hypertensive action of 3 drugs inhibiting the sympathetic nervous system. Hemodynamic and biological study]. (1974) (0)
[The role of anti-aldosterones in the treatment of arterial hypertension]. (1973) (0)
Transcriptional induction of the human renin gene by cAMP in cultured chorionic cells (1995) (0)
[Effect of estro-progestagens on arterial pressure] (1973) (0)
[The renin-angiotensin-aldosterone system in hypertensive subjects. III- The use of beta-blockers in reno-vascular hypertension (author's transl)]. (1977) (0)
[Role of scintigraphy in the localization of pheochromocytoma]. (1979) (0)
Abstract 1326: HIF Pathway is Associated with Progression and Neovascularization of Human Atherosclerosis (2006) (0)
[Immunologic approach of the blockage of the renin angiotensin system in vivo]. (1988) (0)
The Renin-Angiotensin-Aldosterone System and Atrial Natriuretic Factor (1990) (0)
Diagnosis of Unilateral Renal Artery Lesions After Captopril Administration-Reply (1985) (0)
Kallikrein Release by the Isolated Perfused Rat Kidney: Role of Perfusion Pressure and of the Renin-Angiotensin System (1985) (0)
Nucleic acid encoding the converting enzyme (ACE) human testicular and its applications, in particular for the in vitro detection of said enzyme in the body. (1990) (0)
[Effects of acebutolol on the renin-aldosterone system in essential arterial hypertension]. (1975) (0)
The Renin Gene: Structure and Processing of Renin (1984) (0)
[New therapeutic perspectives in the inhibition of the renin-angiotension system]. (1989) (0)
Progress in Medicine at the Dawn of the Twenty-First Century: What Achievements? (2009) (0)
Predictability and Prevention of Thiazide-induced Hypokalaemia (1985) (0)
Metabolism of radioactive 5 alpha-androstane-3 beta, 17 beta-diol. (1970) (0)
Contributions Tissue-Specific Expression of Type 1 Angiotensin II Receptor Subtypes An In Situ Hybridization Study (2005) (0)
[Anemia due to deficiency of glucose-6-phospahte dehydrogenase (G-6-P-D) and influenza-typhoid leptospirosis]. (1968) (0)
[The decision to treat moderate hypertension: repetition of office visits or ambulatory monitoring of arterial pressure?]. (1987) (0)
[How to advance antihypertensive therapy]. (1974) (0)
15th Meeting of the French Hypertension Society Palais des Congrès, Paris, 14–15 December 1995: Comparative study of traditional and endoscopic surgery of Conn's adenoma (1997) (0)
[Urinary excretion of antidiuretic hormone in normal man: search for the natremic and osmolar thresholds of A.D.H. liberation]. (1974) (0)
Haplotypes ofAngiotensinogen inEssential Hypertension (1997) (0)
Renin research: where are we now? (2008) (0)
VASCULAR GENE EXPRESSION IN PATIENTS WITH CRITICAL LEG ISCHEMIA: OVEREXPRESSION OF THROMBOSPONDIN 1 (2004) (0)
Characterization of a cell-specific human renin gene enhancer (1999) (0)
[Renin system inhibitors at the level of the renin-substrate reaction]. (1983) (0)
[Kinetic study of the metabolism and urinary excretion of cortisol in the isolated perfused rat kidney (author's transl) (proceedings)]. (1976) (0)
[Endocrine and nephro-urologic changes in hypertensive and toxemic pregnancy]. (1977) (0)
[Plasma renin and noradrenalin levels during hypotensive therapy using acebutolol (author's transl)]. (1979) (0)
The evolution of multiple angiotensin I-converting enzymes in Drosophila and their role in development (2000) (0)
[Molecular bases of tumor angiogenesis]. (2010) (0)
[How to carry out the complementary evaluation and supervisory examinations in arterial hypertension]. (1973) (0)
[Serge Haroche, a Nobel for tracking and trapping photons]. (2013) (0)
[Use of beta blockaders in the treatment of arterial hypertension]. (1975) (0)
What Can Be Learnt from the Results of the High Blood Pressure Trials (1985) (0)
Hypotensive Effect of a Human Anti-Renin Monoclonal Antibody (4G1D8) in the Sodium Depleted Conscious Marmoset (1986) (0)
Dithiobis 4,4-(3-aminobutane-1-sulfonates) and new compositions containing them. (2003) (0)
[Takayasu's disease in a thoraco-abdominal form and renovascular arterial hypertension: aortic, superior mesenteric and renal revascularization of a single kidney]. (1977) (0)
Evaluation of Anemia in Angiotensin Converting Enzyme (ACE) Knockout Mice. (2000) (0)
Introducing Marc Fontecave (2014) (0)
4,4 '-dithiobis- (3-aminobutane-1-sulfonate) derivatives and compositions containing them (2003) (0)
The (pro)renin receptor: biochemistry and ontogeny (2008) (0)
[Soaring science publications in Covid-19: Separate the wheat from the chaff]. (2021) (0)
Tritiated 9alpha-fluorocortisol metabolism and binding in rat kidney. (1977) (0)
Introducing Anne Cheng (2013) (0)
Identification and characterization of new genes involved in hypoxia/angiogenesis (2001) (0)
Noradrenaline producing phaeochromocytomas with (1979) (0)
B013 N-glycosylation of recombinant human angiotensinogen explains the heterogeneity of the protein and is not required for functional activity (1998) (0)
Menard and tolerance of spironolactone in essential hypertension. (1995) (0)
Risk Prevention in Medicine: from a Population-Based Approach to a Personalized Approach (2015) (0)
Scientific Contributions Tissue-Specific Expression of Type 1 Angiotensin II Receptor Subtypes An In Situ Hybridization Study (2005) (0)
ONTOGENY AND CELLULAR LOCALIZATION OF ANGIOTENSIN RECEPTORS IN ANTERIOR PITUITARY • 400 (1997) (0)
[18-Hydroxycorticosterone, 18-hydroxydesoxycorticosterone. Why, when, how to determine plasma levels in some adrenal pathologies]. (1990) (0)
[Hereditary factors of essential arterial hypertension]. (1990) (0)
[Arterial hypertension and renin producing tumors]. (1979) (0)
[Scientific integrity: code of conduct and failure]. (2016) (0)
[Iodo-methyl norcholesterol scintigraphy in the localization of primary hyperaldosteronism]. (1989) (0)
STRUCTURE-FUNCTION RELATIONSHIPS OF AMINOPEPTIDASE A (2000) (0)
P-11: Pilot study on self-adjustment of antihypertensive treatment, depending on the results home blood pressure measurement (Sethi study): Satisfaction of attending physicians (2003) (0)
33 Hypergene: a database for genetic analysis of hypertension (1993) (0)
Monoclonal antibodies against a human juxtaglomerular epithelioid granular cell tumour. (1991) (0)
A new ACE on the table (2005) (0)
[Problems posed by the treatment of neurologic and neuropsychic manifestations of systemic lupus erythematosus]. (1972) (0)
New derivatives of pepstatin, their preparation and pharmaceutical compositions containing them (1977) (0)
[Treatment of borderline arterial hypertension. Directives of the OMS and the International Society of Hypertension]. (1988) (0)
[Influence of diuretics on renal elimination of lithium]. (1976) (0)
International Society of Nephrology Forefronts in Nephrology (1994) (0)
Linkage studies in essential hypertension (1995) (0)
[Cell receptors: major concepts]. (1994) (0)
B12 - Regulation of AT1 receptor mRNA in rat tissues (1995) (0)
Nucleic acid encoding the angiotensin converting enzyme (ACE) human, and its applications, especially for the in vitro diagnosis of hypertension (1988) (0)
[Comparison of the cardiac, renal and endocrine effects of converting enzyme inhibition with those of a classical triple therapy in experimental renal hypertension]. (1984) (0)
Human Essential Hypertension: Role of the Genes of the Renin-Aldosterone System (2002) (0)
P-10: Pilot study on self-adjustment of antihypertensive treatment, depending on the results of patient home blood pressure measurements (Sethi study): Feasibility (2003) (0)
Assay of human plasma renin activity using the angiotensin radioimmunoassay. (1973) (0)
APPLICATION OF HUMAN RENIN ANTIBODIES (1983) (0)
[Problems posed by the treatment of neurologic and neuropsychic manifestations of systemic lupus erythematosus]. (1971) (0)
P-9: Pilot study on self-adjustment of antihypertensive treatment, depending on the results of home blood pressure measurement (Sethi study): patient acceptability and satisfaction (2003) (0)
[Uronephrologic and endocrine changes during normal pregnancy]. (1977) (0)
Predictive Factors of the Acute and Chronic Blood Pressure Fall Induced by the Calcium Antagonist Nicardipine (1988) (0)
[Action of beta blockaders in hypertension caused by isthmic aortic coarctation: a new proof in favor of renin-angiotensin system]. (1978) (0)
[Is it still necessary to look for the surgically-treatable causes of arterial hypertension?]. (1981) (0)
Duration of the Clinical and Biological Effects of Captoprll in Severely Hypertensive Patients on Chronic Treatment (1985) (0)
Hypertension Summer School 1992 (1993) (0)
[Clinical pharmacology. Pharmacokinetics and affinity of drugs for their receptors, Apropos of anti-aldosterone]. (1976) (0)
Nucleic acid encoding the angiotensin converting enzyme (ACE) human testicular, and its applications, especially for the in vitro screening of this enzyme in the body (1989) (0)
Introducing Philippe Sansonetti (2013) (0)
[Calcium inhibitors and treatment of arterial hypertension]. (1988) (0)
[Renin inhibition by peptides and pseudo-peptides]. (1989) (0)
The use of autirenin antibodies to investigate the renin-angiotensin system. (1984) (0)
[Arterial hypertension: risk factor in atheroma]. (1982) (0)
[Comparison of ambulatory blood pressure determinations using the Remler and Spacelabs devices]. (1986) (0)
R244C mutations of the 11HSD2 gene in a hypertensive patient with apparent mineralocorticoid excess (1997) (0)
[Being a medical doctor and a scientist, a constantly evolving challenge]. (2015) (0)
[What purpose does the renin-angiotensin-aldosterone system serve in man?]. (1988) (0)
4. Lipid metabolism disorders in 2738 hypertensive patients: analysis of a data base (1991) (0)
[Is it possible to predict the antihypertensive action of a beta-blocker by an anti-angiotensin?]. (1978) (0)
[Anticalcium agents : new antihypertensive agents?]. (1981) (0)
Detection and Localization ofRenin Messenger RNA in Human Pathologic Tissues Using In Situ Hybridization (2007) (0)
[Labile hypertension (author's transl)]. (1977) (0)
125. Potentiating effects of endogenous atrial natriuretic factor with retrothiorphan, a neutral endopeptidase inhibitor in normotensive and deoxycorticosterone acetate-salt hypertensive rats (1991) (0)
Gene and cell therapy in cardiovascular diseases: still a long way to go. (2004) (0)
129. The entire renin-angiotensin system exists in human normal and pathological adrenal tissues (1991) (0)
The Vascular Wall and Hormonal Control of Vasomotor Function (1989) (0)
Paris in America. Introduction (2011) (0)
[The 2000 years]. (2015) (0)
[Renovascular hypertension. Concepts and reality]. (1979) (0)
[Estrogens and vascular risk]. (1979) (0)
Introducing Serge Abiteboul (2012) (0)
Molecular Cloning of Submaxillary Renin cDNA (1984) (0)
[Arterial hypertension in heart transplant patients treated with cyclosporin]. (1985) (0)
Diagnosis and Treatment of Renin-Secreting T \ imors Report of Three Cases (2005) (0)
New pharmacological approaches in the treatment of mild hypertension. The potential role of converting enzyme inhibitors and calcium blocking agents (1984) (0)
Perspectives in oral contraception (authors transl) (1979) (0)
New peptides derived from the statin METHOD obtaining and pharmaceutical compositions containing them (1984) (0)
Introducing Barbara Romanowicz (2013) (0)
[A reasonable pretherapeutic evaluation of the hypertensive patient]. (1979) (0)
[An example of an acceptable combination in the treatment of arterial hypertension]. (1978) (0)
Gene variants of angiotensinogen and predisposition to hypertension (1993) (0)
[Predictability and prevention of hypokalemia induced by hydrochlorothiazide]. (1985) (0)
[With which drug should the general practitioner begin antihypertensive treatment: a diuretic of a beta blocker?]. (1977) (0)
[Proceedings: Role of endogenous and exogenous ACTH on aldosterone secretion (author's transl)]. (1975) (0)
From the renin gene to renin inhibitors. (1987) (0)
[Innovative therapies in arterial hypertension treatment]. (2014) (0)
[Intrapulmonary neurinoma associated with Recklinghausen's generalized neurofibromatosis]. (1968) (0)
Renin inhibition by synthetic peptides related to mouse and human renin prosegments. (1984) (0)
25 Testing a genetic linkage between the renin gene and arterial hypertension: analysis of 98 hypertensive sibling pairs (1991) (0)
[Action of cyproterone on plasma binding and metabolism of testosterone]. (1969) (0)
Short report: HYPERGENE (1994) (0)
[The evolution of treated hypertension in renal artery dysplasia in adults (author's transl)]. (1977) (0)
Introducing Jean-Pierre Brun (2013) (0)
[The treatment of essential hypertension (author's transl)]. (1973) (0)
Introducing Jean-Noël Robert (2013) (0)
[Inhibition of the renin-angiotensin system: a major breakthrough in the treatment of arterial hypertension?]. (1980) (0)
Genetic mechanisms and individual variability to antihypertensive treatment (1995) (0)
[Proceedings: Metabolic clearance and secretion of aldosterone in the anephric man]. (1974) (0)
[Blood pressure auto-measurement]. (1981) (0)
Electrophoretic characterization of active renin from human kidney and inactive renin from a human chorionic cell culture (1985) (0)
Conformation of the flap of human renin (1988) (0)
[Current clinical use of converting enzyme inhibitors]. (1982) (0)
[The renin-angiotensin system and its inhibition (author's transl)]. (1981) (0)
[Use of intravenous nicardipine for the diagnosis of renovascular hypertension]. (1991) (0)
[Effect of progesterone, and its derivatives, and of progestagens on the metabolism of salt water]. (1979) (0)
[Practical medical treatment of essential arterial hypertension]. (1973) (0)
[Numerical angiography in the evaluation of arterial hypertension]. (1983) (0)
Spectre clinique de lhyperaldostronisme primaire: tude dune cohorte franaise de 124 patients (1997) (0)
[Cellular information and communication: receptors coupled to g-proteins]. (1994) (0)
[Effect of a single dose of captopril on arterial pressure, electrolytes and hormonal parameters. Study in 20 patients with long-term treatment in 8 patients]. (1981) (0)
The Renin Gene (1987) (0)
An immunomorphologic study (1984) (0)
Immunodetection of M235T variants of human angiotensinogen (1997) (0)
[Definition and consequences of blocking the renin-angiotensin system by converting enzyme inhibition]. (1987) (0)
25. Ethinyl estradiol and hydrocortisone effect on cell proliferation and angiotensinogen Fao cells (1982) (0)
第26回日本腎臓学会総会招請講演I The use of antirenin and antibodies to investigate the renin-angiotensin system (1984) (0)
Sensitivity to Undernutrition-Programmed Hypertension in the Adult Rat Angiotensin-Converting Enzyme 2 ( ACE 2 ) and ACE Activities Display Tissue-Specific (2005) (0)
[Cerebral metastases in 178 cases of primary and secondary brocho-pulmonary cancer]. (1968) (0)
[Detection of silent ischemia in hypertensive subjects with high vascular risk using continuous electrocardiogram in real time]. (1989) (0)
Special Report on Claude Bernard (2014) (0)
Renal Damage Induced in the Clipped Kidney of the 2-K 1C Hypertensive Rats During Normalization of Blood Pressure by Converting Enzyme Inhibition (1986) (0)
[Origin and transport of androgens in hirsutism]. (1971) (0)
Plasma Renin Activity in the Renal Veins of Three Patients with Juxtaglomerular Cell Renin Tumors Treatment Case 1 Sodium depletion + beta-blockers Case 2 Sodium depletion Sodium depletion Captopril Captopril Case 3 Normal sodium intake Captopril Right renal vein (2005) (0)
[Mode of action of mineralocorticoides: their binding with transcortin and cytoselic renal receptors]. (1975) (0)
[Changes in angiotensinogen and des-angiotensin I-angiotensinogen in man and rat upon inhibition of converting enzyme]. (1982) (0)
Isolated Clinical Syndrome of Primary Aldosteronism in Four Patients With Adrenocortical Carcinoma (1988) (0)
[New methods of clinical exploration of aldosterone metabolism]. (1972) (0)
[Editorial: Mechanisms of the antihypertensive action of beta-blocking agents]. (1975) (0)
[Scientific integrity: the French proposals to implement the national charter]. (2016) (0)
Methods Patient Population Hypertensive Index Cases and Sibships With Multiple Hypertensive Subjects (2005) (0)
Introducing Claudine Tiercelin (2013) (0)
[Immunohistochemical localization of renin in segmental renal hypoplasia]. (1982) (0)
Hormonal control of arterial pressure and water electrolyte metabolism. 33rd International Henri-Pierre Klotz Days of Clinical Endocrinology. Paris, May 1990. (1991) (0)
[Development and application of the radioimmunologic assay of plasma aldosterone and renin activity]. (1972) (0)
Six Years as Administrateur (2015) (0)
Patient Compliance in Hypertension Care: The Critical Role of the Computer (1982) (0)
[Antialdosterone therapy]. (1975) (0)
[Contraception with continuous norgestrienone in hypertensive women: effects on blood pressure and blood lipid glucose and angiotensinogen levels (authors transl)] (1979) (0)
Gene hunting in cardiovascular diseases (2004) (0)
Immuno-chemical Recognition of Synthetic Peptides Based on the Sequence and Three-dimensional Structure of Human Renin: An Immuno-control of Renin Activity (1989) (0)
[Is angiotensin II a growth factor?]. (1992) (0)
[Vaginal ring contraception in hypertensive women]. (1985) (0)
432 – ANTI-HYPERTENSIVE ADRENERGIC BLOCKING AGENTS : EFFECTS ON SODIUM BALANCE, HEMODYNAMICS AND RENIN ANGI0TENSIN SYSTEM (1977) (0)
[History of the discovery of the renin-angiotensin system]. (2018) (0)
Means and methods for the study of genetic polymorphism of the angiotensin 1-converting enzyme. (1991) (0)
[Effectiveness of captopril in severe hypertension (author's transl)]. (1981) (0)
[Contraception in the hypertensive woman using a vaginal ring delivering estradiol and norgestrel]. (1985) (0)
Subject Index Vol. 38, 2001 (2001) (0)
The application of molecular genetics to the study of familial arterial hypertension. (1989) (0)
AT1 versus AT2 receptor (1998) (0)
Nucleic acid encoding for human testicular angiotensin converting enzyme (ACE), and its applications, especially for the in vitro detection of the enzyme in the organism (1990) (0)
Renin and prorenin in toxemic pregnancy. (1979) (0)
[Acebutolol test in moderate arterial hypertension. Action on systolic time intervals]. (1975) (0)
[Contraception and arterial hypertension]. (1977) (0)
[Ontogenesis of the renin system. Implication of this system in hematopoiesis]. (2004) (0)
[Metabolism of water and sodium during normal pregnancy and pregnancy toxemia]. (1972) (0)
[Cardiovascular risk, cholesterol and statins]. (2013) (0)
231. Mineralo-corticoid-like effect of glycyrrhetinic acid (1974) (0)
[Kallikrein secretion by the isolated perfused rat kidney. Role of perfusion pressure and the renin-angiotensin system]. (1985) (0)
Human chorionic cells: a model for studying renin secretion and renin gene expression (1990) (0)
[Application of the saralasin test to the treatment of malignant or accelerated arterial hypertension (author's transl)]. (1980) (0)
[Practical medical treatment of essential hypertension]. (1973) (0)
[Diuretics in arterial hypertension]. (1986) (0)
Angiotensin I-converting enzyme (ACE): Sequence and consequenses (1998) (0)
A Novel Aspect of Endothelium Dysfunction (2005) (0)
[Fundamentals of angiogenesis]. (2005) (0)
[Spirolactones and potassium-sparing diuretics]. (1978) (0)
[Application of affinity chromatography to the study of renin]. (1975) (0)
[Pharmacology of converting enzyme inhibitors (captopril and related products)]. (1982) (0)
Un exemple d'association acceptable dans le traitement de l'hypertension artérielle. (1978) (0)
[Study of rabbit testosterone-binding-globulin. An approach to the physiological role of this binding protein]. (1974) (0)
Brief Reviews Human Renin Inhibitor Peptides (2005) (0)
[The renin-angiotensin-aldosterone system in hypertensive subjects. I-Analytical study of 124 patients (author's transl)]. (1977) (0)
[Incidence of beta-blockers on plasma renin activity. Present status]. (1978) (0)
Contents Vol. 38, 2001 (2001) (0)
Vasopeptidase Inhibitor In Vitro and In Vivo Inhibition of the 2 Active Sites of ACE by Omapatrilat , a (2000) (0)
[Abnormal secretion of renin: theoretical and practical repercussions on renovascular hypertension]. (1974) (0)
Hypertension in Heart Transplant Patients Treated with Cyclosporin A (1985) (0)
PREDICTION OF HUMAN RENIN EPITOPES USING A NEW COMPUTER ALGORITHM (1987) (0)
GGGAGAAGGT GGGC TGGC CGCAGTACAAC TGGACGCC GAACTC CGCTCGCT CAGAAGGGGCCCCTC CCAGACAGCGGC CGCG TCAGCTTC CT GGGC CT GGAC CT GGAT GC GCAGCAGGCCCGCGTGGGCCAGTGG (0)
Introducing Jean-Paul Laumond (2012) (0)
Contraception with a Vaginal Ring in Hypertensive Women (1985) (0)

This paper list is powered by the following services:

Other Resources About Pierre Corvol

en.wikipedia.org

What Schools Are Affiliated With Pierre Corvol?

Pierre Corvol is affiliated with the following schools:

Image Attributions

Image Source for Pierre Corvol