Richard L. Stouffer
#145,877
Most Influential Person Now
Richard L. Stouffer's AcademicInfluence.com Rankings
Download Badge
Biology
Why Is Richard L. Stouffer Influential?
(Suggest an Edit or Addition)Richard L. Stouffer's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Human Embryonic Stem Cells Derived by Somatic Cell Nuclear Transfer (2013) (627)
- The science behind 25 years of ovarian stimulation for in vitro fertilization. (2006) (465)
- Towards germline gene therapy of inherited mitochondrial diseases (2012) (353)
- Current achievements and future research directions in ovarian tissue culture, in vitro follicle development and transplantation: implications for fertility preservation. (2010) (281)
- Immunocytochemical localization of estradiol and progesterone receptors in the monkey ovary throughout the menstrual cycle. (1988) (236)
- Rhesus monkeys produced by nuclear transfer. (1997) (225)
- Live birth after ovarian tissue transplant (2004) (198)
- Regulation and action of angiogenic factors in the primate ovary. (2001) (179)
- Encapsulated Three-Dimensional Culture Supports Development of Nonhuman Primate Secondary Follicles1 (2009) (172)
- Follicle-stimulating hormone and luteinizing hormone/chorionic gonadotropin stimulation of vascular endothelial growth factor production by macaque granulosa cells from pre- and periovulatory follicles. (1997) (169)
- Endocrinology: Follicle stimulating hormone alone supports follicle growth and oocyte development in gonadotrophin-releasing hormone antagonist-treated monkeys (1995) (165)
- Vascular endothelial growth factor (VEGF) and angiopoietin regulation by gonadotrophin and steroids in macaque granulosa cells during the peri-ovulatory interval. (1999) (165)
- Angiogenesis in ovarian follicular and luteal development. (2000) (158)
- In vitro fertilization and embryo transfer in the rhesus monkey. (1989) (156)
- Secondary follicle growth and oocyte maturation during encapsulated three-dimensional culture in rhesus monkeys: effects of gonadotrophins, oxygen and fetuin. (2011) (144)
- Midcycle administration of a progesterone synthesis inhibitor prevents ovulation in primates. (1996) (141)
- Impact of obesity on oral contraceptive pharmacokinetics and hypothalamic-pituitary-ovarian activity. (2009) (132)
- Progesterone as a mediator of gonadotrophin action in the corpus luteum: beyond steroidogenesis. (2003) (131)
- Survival, growth, and maturation of secondary follicles from prepubertal, young, and older adult rhesus monkeys during encapsulated three-dimensional culture: effects of gonadotropins and insulin. (2010) (124)
- The ovulatory gonadotrophin surge stimulates cyclooxygenase expression and prostaglandin production by the monkey follicle. (2001) (120)
- Proliferation of microvascular endothelial cells in the primate corpus luteum during the menstrual cycle and simulated early pregnancy. (1996) (116)
- In vitro fertilization‐embryo transfer in nonhuman primates: The technique and its applications (1990) (113)
- Follicular administration of a cyclooxygenase inhibitor can prevent oocyte release without alteration of normal luteal function in rhesus monkeys. (2002) (112)
- Vascular endothelial growth factor levels in serum and follicular fluid of patients undergoing in vitro fertilization. (1997) (109)
- Expression of matrix metalloproteinases and their tissue inhibitor messenger ribonucleic acids in macaque periovulatory granulosa cells: time course and steroid regulation. (1999) (106)
- Injection of Soluble Vascular Endothelial Growth Factor Receptor 1 into the Preovulatory Follicle Disrupts Ovulation and Subsequent Luteal Function in Rhesus Monkeys1 (2002) (105)
- Induction of luteal phase defects in rhesus monkeys by follicular fluid administration at the onset of the menstrual cycle. (1980) (101)
- Localization of androgen receptor in the follicle and corpus luteum of the primate ovary during the menstrual cycle. (1991) (101)
- Fibrin promotes development and function of macaque primary follicles during encapsulated three-dimensional culture. (2013) (98)
- Maturity at collection and the developmental potential of rhesus monkey oocytes. (1990) (98)
- Quantitative Analysis of the Hormone-induced Hyperacetylation of Histone H3 Associated with the Steroidogenic Acute Regulatory Protein Gene Promoter* (2001) (96)
- Molecular control of ovulation and luteinization in the primate follicle. (2007) (96)
- Enhancement of primate oocyte maturation and fertilization in vitro by inhibin A and activin A. (1996) (95)
- Follicle stimulating hormone alone supports follicle growth and oocyte development in gonadotrophin-releasing hormone antagonist-treated monkeys. (1996) (94)
- Modulation of progestin secretion in ovarian cells by 17beta-hydroxy-5alpha-androstan-3-one (dihydrotestosterone): a direct demonstration in monolayer culture. (1976) (94)
- Hormonal regulation of steroidogenic enzyme expression in granulosa cells during the peri-ovulatory interval in monkeys. (2000) (90)
- Vascular endothelial growth factor production by human luteinized granulosa cells in vitro. (1997) (90)
- The ratio of progesterone receptor isoforms changes in the monkey corpus luteum during the luteal phase of the menstrual cycle. (1997) (89)
- Dynamics of periovulatory steroidogenesis in the rhesus monkey follicle after ovarian stimulation. (1999) (88)
- Human Embryonic Stem Cells Derived by Somatic Cell Nuclear Transfer (2013) (88)
- Administration of an aromatase inhibitor during the late follicular phase of gonadotropin-treated cycles in rhesus monkeys: effects on follicle development, oocyte maturation, and subsequent luteal function. (1993) (87)
- Chronic treatment of cycling rhesus monkeys with low doses of the antiprogestin ZK 137 316: morphometric assessment of the uterus and oviduct. (1998) (85)
- Developmental potential of embryos produced by in-vitro fertilization from gonadotrophin-releasing hormone antagonist-treated macaques stimulated with recombinant human follicle stimulating hormone alone or in combination with luteinizing hormone. (1996) (84)
- Gonadotropin-sensitive progesterone production by rhesus monkey luteal cells in vitro: a function of age of the corpus luteum during the menstrual cycle. (1977) (79)
- Progesterone receptor, but not estradiol receptor, messenger ribonucleic acid is expressed in luteinizing granulosa cells and the corpus luteum in rhesus monkeys. (1994) (79)
- Titrating luteinizing hormone replacement to sustain the structure and function of the corpus luteum after gonadotropin-releasing hormone antagonist treatment in rhesus monkeys. (1999) (79)
- Dynamics of the transcriptome in the primate ovulatory follicle. (2011) (78)
- Changes in expression of vascular endothelial growth factor and angiopoietin-1 and -2 in the macaque corpus luteum during the menstrual cycle. (2000) (78)
- Progesterone production by monkey luteal cell subpopulations at different stages of the menstrual cycle: changes in agonist responsiveness. (1991) (77)
- Acute administration of a 3 beta-hydroxysteroid dehydrogenase inhibitor to rhesus monkeys at the midluteal phase of the menstrual cycle: evidence for possible autocrine regulation of the primate corpus luteum by progesterone. (1994) (73)
- Investigation of binding sites for follicle-stimulating hormone and chorionic gonadotropin in human ovarian cancers. (1984) (71)
- Phosphodiesterase 3 inhibitors selectively block the spontaneous resumption of meiosis by macaque oocytes in vitro. (2002) (69)
- Preserving female fertility following cancer treatment: Current options and future possibilities (2009) (68)
- Steroid reduction during ovarian stimulation impairs oocyte fertilization, but not folliculogenesis, in rhesus monkeys. (1994) (68)
- Elevated androgens during puberty in female rhesus monkeys lead to increased neuronal drive to the reproductive axis: a possible component of polycystic ovary syndrome. (2012) (68)
- Future Directions in Oncofertility and Fertility Preservation: A Report from the 2011 Oncofertility Consortium Conference. (2013) (66)
- Systemic and intraluteal infusion of inhibin A or activin A in rhesus monkeys during the luteal phase of the menstrual cycle. (1994) (66)
- Dynamic expression of mRNAs and proteins for matrix metalloproteinases and their tissue inhibitors in the primate corpus luteum during the menstrual cycle. (2002) (66)
- Titrating luteinizing hormone surge requirements for ovulatory changes in primate follicles. I. Oocyte maturation and corpus luteum function. (1991) (65)
- Titrating luteinizing hormone surge requirements for ovulatory changes in primate follicles. II. Progesterone receptor expression in luteinizing granulosa cells. (1991) (64)
- Systematic analysis of protease gene expression in the rhesus macaque ovulatory follicle: metalloproteinase involvement in follicle rupture. (2011) (64)
- Gonadotropin receptors of the primate corpus luteum. II. Changes in available luteinizing hormone- and chorionic gonadotropin-binding sites in macaque luteal membranes during the nonfertile menstrual cycle. (1982) (63)
- Progesterone Promotes Oocyte Maturation, but Not Ovulation, in Nonhuman Primate Follicles Without a Gonadotropin Surge1 (2004) (63)
- In. vitro evaluation of corpus luteum function of cycling and pregnant rhesus monkeys: Progesterone production by dispersed luteal cells (1976) (61)
- Insulin-Like Growth Factors-1 and -2, but not Hypoxia, Synergize with Gonadotropin Hormone to Promote Vascular Endothelial Growth Factor-A Secretion by Monkey Granulosa Cells from Preovulatory Follicles1 (2003) (61)
- Gonadotropin and Steroid Regulation of Matrix Metalloproteinases and Their Endogenous Tissue Inhibitors in the Developed Corpus Luteum of the Rhesus Monkey During the Menstrual Cycle1 (2004) (60)
- Expression of Estrogen Receptor α and β in the Rhesus Monkey Corpus Luteum during the Menstrual Cycle: Regulation by Luteinizing Hormone and Progesterone. (2000) (59)
- Disparate effects of prostaglandins on basal and gonadotropin-stimulated progesterone production by luteal cells isolated from rhesus monkeys during the menstrual cycle and pregnancy. (1979) (59)
- Endocrine and local control of the primate corpus luteum. (2013) (59)
- Initiation of periovulatory events in primate follicles using recombinant and native human luteinizing hormone to mimic the midcycle gonadotropin surge. (1994) (58)
- Progesterone receptor messenger ribonucleic acid in the primate corpus luteum during the menstrual cycle: possible regulation by progesterone. (1995) (58)
- Direct actions of androgens on the survival, growth and secretion of steroids and anti-Müllerian hormone by individual macaque follicles during three-dimensional culture. (2015) (58)
- Overriding follicle selection in controlled ovarian stimulation protocols: Quality vs quantity (2004) (57)
- Suppression of follicle-stimulating hormone-dependent folliculogenesis during the primate ovarian cycle. (1981) (57)
- Recombinant human inhibin-A administered early in the menstrual cycle alters concurrent pituitary and follicular, plus subsequent luteal, function in rhesus monkeys. (1996) (56)
- Insulin and insulin-like growth factor stimulation of vascular endothelial growth factor production by luteinized granulosa cells: comparison between polycystic ovarian syndrome (PCOS) and non-PCOS women. (2007) (56)
- Localization of steroidogenic enzymes in macaque luteal tissue during the menstrual cycle and simulated early pregnancy: immunohistochemical evidence supporting the two-cell model for estrogen production in the primate corpus luteum. (1997) (56)
- Gonadotropin and Steroid Control of Granulosa Cell Proliferation During the Periovulatory Interval in Rhesus Monkeys1 (2001) (56)
- Identification of an ovarian voltage-activated Na+-channel type: hints to involvement in luteolysis. (2000) (55)
- Initiation of periovulatory events in gonadotrophin-stimulated macaques with varying doses of recombinant human chorionic gonadotrophin. (1997) (55)
- Circulating levels of free and total vascular endothelial growth factor (VEGF)-A, soluble VEGF receptors-1 and -2, and angiogenin during ovarian stimulation in non-human primates and women. (2004) (54)
- Stimulatory and inhibitory effects of prostaglandins on the gonadotropin-sensitive adenylate cyclase in the monkey corpus luteum. (1987) (54)
- Isolation and characterization of cell subpopulations from the monkey corpus luteum of the menstrual cycle. (1989) (53)
- Proliferation of rhesus ovarian surface epithelial cells in culture: lack of mitogenic response to steroid or gonadotropic hormones. (2002) (52)
- Intraluteal infusions of prostaglandins of the E, D, I, and A series prevent PGF2 alpha-induced, but not spontaneous, luteal regression in rhesus monkeys. (1990) (52)
- Persistent versus transient stimulation of the macaque corpus luteum during prolonged exposure to human chorionic gonadotropin: a function of age of the corpus luteum. (1984) (52)
- Estrogen inhibition of basal and gonadotropin-stimulated progesterone production by rhesus monkey luteal cells in vitro. (1977) (52)
- Human recombinant activin-A alters pituitary luteinizing hormone and follicle-stimulating hormone secretion, follicular development, and steroidogenesis, during the menstrual cycle in rhesus monkeys. (1993) (51)
- Controlled ovulation of the dominant follicle: a critical role for LH in the late follicular phase of the menstrual cycle. (2003) (50)
- Structure, Function, and Regulation of the Corpus Luteum (2015) (48)
- In Vitro Fertilization and Embryo Transfer in Primates (1993) (47)
- High-dose estrogen and clinical selective estrogen receptor modulators induce growth arrest, p21, and p53 in primate ovarian surface epithelial cells. (2005) (47)
- Prostaglandin synthesis, metabolism, and signaling potential in the rhesus macaque corpus luteum throughout the luteal phase of the menstrual cycle. (2008) (47)
- Isolation and culture of microvascular endothelial cells from the primate corpus luteum. (1996) (47)
- Ca2+-activated, large conductance K+ channel in the ovary: identification, characterization, and functional involvement in steroidogenesis. (2002) (46)
- Local Role of Progesterone in the Ovary During the Periovulatory Interval (2004) (45)
- Intraovarian actions of anti-angiogenic agents disrupt periovulatory events during the menstrual cycle in monkeys. (2005) (45)
- Gonadotropin receptors of the primate corpus luteum. I. Characterization of 125I-labeled human luteinizing hormone and human chorionic gonadotropin binding to luteal membranes from the rhesus monkey. (1982) (45)
- Role of gonadotrophins and progesterone in the regulation of morphological remodelling and atresia in the monkey peri-ovulatory follicle. (2000) (45)
- Primate follicular development and oocyte maturation in vitro. (2013) (45)
- Injection of antiangiogenic agents into the macaque preovulatory follicle (2007) (44)
- Changes in (125I) labeled human chorionic gonadotropin (hCG) binding to porcine granulosa cells during follicle development and cell culture. (1976) (44)
- Differential effects of estrogen and progesterone on development of primate secondary follicles in a steroid-depleted milieu in vitro. (2015) (44)
- The Primate Ovary (1987) (43)
- Local Delivery of Angiopoietin-2 into the Preovulatory Follicle Terminates the Menstrual Cycle in Rhesus Monkeys1 (2005) (42)
- Effects of hyperandrogenemia and increased adiposity on reproductive and metabolic parameters in young adult female monkeys. (2014) (42)
- Amphiregulin promotes the maturation of oocytes isolated from the small antral follicles of the rhesus macaque. (2012) (41)
- Administration of human luteinizing hormone (hLH) to macaques after follicular development: further titration of LH surge requirements for ovulatory changes in primate follicles. (1992) (40)
- Progesterone receptor messenger ribonucleic acid and protein in luteinized granulosa cells of rhesus monkeys are regulated in vitro by gonadotropins and steroids. (1996) (39)
- Vascular Endothelial Growth Factor (VEGF) Production by the Monkey Corpus Luteum During the Menstrual Cycle: Isoform-Selective Messenger RNA Expression In Vivo and Hypoxia-Regulated Protein Secretion In Vitro1 (2005) (38)
- Adenylate cyclase in human ovarian cancers: sensitivity to gonadotropins and nonhormonal activators. (1985) (38)
- Systematic determination of differential gene expression in the primate corpus luteum during the luteal phase of the menstrual cycle. (2008) (37)
- Intraluteal infusion of a prostaglandin synthesis inhibitor, sodium meclofenamate, causes premature luteolysis in rhesus monkeys. (1988) (37)
- Nonhuman Primates: A Vital Model for Basic and Applied Research on Female Reproduction, Prenatal Development, and Women's Health. (2017) (36)
- Activin-A inhibits progesterone production by macaque luteal cells in culture. (1992) (36)
- Evaluation of antral follicle growth in the macaque ovary during the menstrual cycle and controlled ovarian stimulation by high‐resolution ultrasonography (2009) (36)
- Chronic treatment of female rhesus monkeys with low doses of the antiprogestin ZK 137 316: establishment of a regimen that permits normal menstrual cyclicity (1998) (36)
- Ovarian cycle-specific regulation of adipose tissue lipid storage by testosterone in female nonhuman primates. (2013) (36)
- Comparison of different regimens of human gonadotropins for superovulation of rhesus monkeys: Ovulatory response and subsequent luteal function (1989) (35)
- Knockdown of Progesterone Receptor (PGR) in Macaque Granulosa Cells Disrupts Ovulation and Progesterone Production (2016) (35)
- A bolus of recombinant human follicle stimulating hormone at midcycle induces periovulatory events following multiple follicular development in macaques. (1998) (34)
- Native and modified (acetylated) low density lipoprotein-supported steroidogenesis by macaque granulosa cells collected before and after the ovulatory stimulus: correlation with fluorescent lipoprotein uptake. (1993) (34)
- Gonadotropin and steroid regulation of steroid receptor and aryl hydrocarbon receptor messenger ribonucleic acid in macaque granulosa cells during the periovulatory interval. (1999) (34)
- ADAMTS-1/METH-1 and TIMP-3 expression in the primate corpus luteum: divergent patterns and stage-dependent regulation during the natural menstrual cycle. (2004) (33)
- Expression of estrogen receptor alpha and beta in the rhesus monkey corpus luteum during the menstrual cycle: regulation by luteinizing hormone and progesterone. (2000) (32)
- Perspectives on the corpus luteum of the menstrual cycle and early pregnancy (1988) (32)
- Adenylate cyclase in the corpus luteum of the rhesus monkey. III. Changes in basal and gonadotropin-sensitive activities during the luteal phase of the menstrual cycle. (1985) (32)
- Adenylate cyclase in the corpus luteum of the rhesus monkey. II. Sensitivity to nucleotides, gonadotropins, catecholamines, and nonhormonal activators. (1985) (31)
- Induction of relaxin secretion in rhesus monkeys by human chorionic gonadotropin: dependence on the age of the corpus luteum of the menstrual cycle. (1984) (31)
- Gonadotropin surge increases fluorescent-tagged low-density lipoprotein uptake by macaque granulosa cells from preovulatory follicles. (1992) (31)
- Dynamic expression of caspase-2, -3, -8, and -9 proteins and enzyme activity, but not messenger ribonucleic acid, in the monkey corpus luteum during the menstrual cycle. (2005) (31)
- The effects of luteinizing hormone ablation/replacement versus steroid ablation/replacement on gene expression in the primate corpus luteum (2007) (30)
- Vascular endothelial growth factor and angiopoietin production by primate follicles during culture is a function of growth rate, gonadotrophin exposure and oxygen milieu. (2013) (30)
- Chronic treatment of female rhesus monkeys with low doses of the antiprogestin ZK 137 316: establishment of a regimen that permits normal menstrual cyclicity. (1998) (30)
- Antibody production in rhesus monkeys following prolonged administration of human chorionic gonadotropin. (1985) (29)
- A prostaglandin E2 receptor antagonist prevents pregnancies during a preclinical contraceptive trial with female macaques. (2014) (29)
- Dynamics of Myc/Max/Mad expression during luteinization of primate granulosa cells in vitro: association with periovulatory proliferation. (2003) (29)
- Chronic hyperandrogenemia in the presence and absence of a western-style diet impairs ovarian and uterine structure/function in young adult rhesus monkeys (2018) (29)
- Corpus Luteum Function and Dysfunction (1990) (29)
- Adenylate cyclase in the primate corpus luteum during chorionic gonadotropin treatment simulating early pregnancy: homologous versus heterologous desensitization. (1988) (28)
- Existence of the lymphatic system in the primate corpus luteum. (2008) (28)
- Oxytocin receptors in the primate ovary: molecular identity and link to apoptosis in human granulosa cells. (2010) (28)
- The phosphodiesterase 3 inhibitor ORG 9935 inhibits oocyte maturation in the naturally selected dominant follicle in rhesus macaques. (2008) (28)
- Gonadotropin versus steroid regulation of the corpus luteum of the rhesus monkey during simulated early pregnancy. (1997) (28)
- Chronic combined hyperandrogenemia and western-style diet in young female rhesus macaques causes greater metabolic impairments compared to either treatment alone (2017) (27)
- The phosphodiesterase 3 inhibitor ORG 9935 inhibits oocyte maturation during gonadotropin-stimulated ovarian cycles in rhesus macaques. (2004) (26)
- Dynamics of the primate ovarian surface epithelium during the ovulatory menstrual cycle. (2011) (26)
- Chronic hyperandrogenemia and western-style diet beginning at puberty reduces fertility and increases metabolic dysfunction during pregnancy in young adult, female macaques (2018) (26)
- Markers of growth and development in primate primordial follicles are preserved after slow cryopreservation. (2010) (26)
- D1-Receptor, DARPP-32, and PP-1 in the primate corpus luteum and luteinized granulosa cells: evidence for phosphorylation of DARPP-32 by dopamine and human chorionic gonadotropin. (2000) (25)
- Measurement of periimplantational relaxin concentrations in the macaque using a homologous assay. (1993) (25)
- Direct actions of androgen, estrogen and anti-Müllerian hormone on primate secondary follicle development in the absence of FSH in vitro (2017) (25)
- Discovery of LH-regulated genes in the primate corpus luteum. (2004) (25)
- Insulin-like growth factor binding proteins in sera of pregnant nonhuman primates. (1993) (25)
- CHAPTER 12 – Structure, Function, and Regulation of the Corpus Luteum (2006) (25)
- The refractory state of luteal cells isolated from rhesus monkeys after prolonged exposure to chorionic gonadotropin during early pregnancy. (1978) (24)
- Evaluation of the phosphodiesterase 3 inhibitor ORG 9935 as a contraceptive in female macaques: initial trials. (2010) (24)
- Cumulus-Oocyte Complexes from Small Antral Follicles During the Early Follicular Phase of Menstrual Cycles in Rhesus Monkeys Yield Oocytes That Reinitiate Meiosis and Fertilize In Vitro1 (2010) (24)
- Changes in available gonadotropin receptors in the corpus luteum of the rhesus monkey during simulated early pregnancy. (1984) (24)
- Decorin is a part of the ovarian extracellular matrix in primates and may act as a signaling molecule. (2012) (23)
- Trophoblast Cells (1993) (23)
- The Sulawesi Crested Black Macaque (Macaca nigra) menstrual cycle: changes in perineal tumescence and serum estradiol, progesterone, follicle-stimulating hormone, and luteinizing hormone levels. (1992) (23)
- Role of the DLL4-NOTCH System in PGF2alpha-Induced Luteolysis in the Pregnant Rat1 (2010) (23)
- Serum estradiol and progesterone during pregnancy and the status of the corpus luteum at delivery in cynomolgus monkeys (Macaca fascicularis ) (1977) (23)
- Comparison of the species specificity of gonadotropin binding to primate and nonprimate corpora lutea. (1981) (23)
- Estrogen production by luteal cells isolated from rhesus monkeys during the menstrual cycle: correlation with spontaneous luteolysis. (1980) (23)
- Progesterone synthesis and fine structure of dissociated monkey (Macaca mulatta) luteal cells maintained in culture. (1979) (22)
- Expression of caspase-2, -3, -8 and -9 proteins and enzyme activity in the corpus luteum of the rat at different stages during the natural estrous cycle. (2006) (22)
- In vitro effects of ethanol on primate luteal membranes: exposure of additional gonadotropin receptor sites. (1982) (22)
- Characterization of corpora lutea in monkeys after superovulation with human menopausal gonadotropin or follicle-stimulating hormone. (1986) (22)
- Chronically elevated androgen and/or consumption of a Western-style diet impairs oocyte quality and granulosa cell function in the nonhuman primate periovulatory follicle (2019) (21)
- Local effects of the sphingosine 1‐phosphate on prostaglandin F2alpha‐induced luteolysis in the pregnant rat (2009) (21)
- Dynamic expression and regulation of the corticotropin-releasing hormone/urocortin-receptor-binding protein system in the primate ovary during the menstrual cycle. (2006) (21)
- The Functions and Regulation of Cell Populations Comprising the Corpus Luteum during the Ovarian Cycle (2003) (21)
- Stimulation of primate luteal function by recombinant human chorionic gonadotropin and modulation of steroid, but not relaxin, production by an inhibitor of 3 beta-hydroxysteroid dehydrogenase during simulated early pregnancy. (1996) (21)
- Androgen production by monkey luteal cell subpopulations at different stages of the menstrual cycle. (1996) (20)
- Androgen receptor mRNA expression in the rhesus monkey ovary (1999) (20)
- Comparison of the steroidogenic response of luteinized granulosa cells from rhesus monkeys to luteinizing hormone and chorionic gonadotropin. (1991) (20)
- Receptors for chorionic gonadotropin in the corpus luteum of the rhesus monkey during simulated early pregnancy: lack of down-regulation. (1986) (20)
- A comparison of blood spot vs. plasma analysis of gonadotropin and ovarian steroid hormone levels in reproductive-age women. (2007) (20)
- Expression and role of the corticotropin-releasing hormone/urocortin-receptor-binding protein system in the primate corpus luteum during the menstrual cycle. (2007) (20)
- Glycoprotein Hormones (1994) (20)
- Differential uptake of fluorescent-tagged low density lipoprotein by cells from the primate corpus luteum: isolation and characterization of subtypes of small and large luteal cells. (1991) (19)
- Exposure of female macaques to Western-style diet with or without chronic T in vivo alters secondary follicle function during encapsulated 3-dimensional culture. (2015) (19)
- Expression and regulation of tumor necrosis factor (TNF) and TNF‐receptor family members in the macaque corpus luteum during the menstrual cycle (2009) (19)
- Adenylate cyclase in the corpus luteum of the rhesus monkey. I. General properties and optimal assay conditions. (1985) (19)
- Analysis of microarray data from the macaque corpus luteum; the search for common themes in primate luteal regression. (2011) (19)
- Ovulation in the Absence of the Ovarian Surface Epithelium in the Primate1 (2010) (18)
- Are human luteinizing granulosa cells a site of action for progesterone and relaxin? (1990) (18)
- Individualized gonadotropin regimens for follicular stimulation in macaques during in vitro fertilization (IVF) cycles (1994) (18)
- Endocrinology of the Transition from Menstrual Cyclicity to Establishment of Pregnancy in Primates (1998) (17)
- Expression of the beta-2 adrenergic receptor (ADRB-2) in human and monkey ovarian follicles: a marker of growing follicles? (2015) (17)
- Dissociation of relaxin and progesterone secretion from the primate corpus luteum by acute administration of a 3 beta-hydroxysteroid dehydrogenase inhibitor during the menstrual cycle. (1995) (17)
- Microarray analysis of the primate luteal transcriptome during chorionic gonadotrophin administration simulating early pregnancy. (2012) (17)
- Steroid receptors and action in the primate follicle (1996) (17)
- A chronic, low-dose regimen of the antiprogestin ZK 137 316 prevents pregnancy in rhesus monkeys. (1998) (16)
- Activity and expression of different members of the caspase family in the rat corpus luteum during pregnancy and postpartum. (2007) (16)
- Cellular approaches to understanding the function and regulation of the primate corpus luteum (1991) (16)
- Receptors for sex steroids in the primate corpus luteum New insight into gonadotropin and steroid action (1995) (16)
- Estrogen inhibits cell cycle progression and retinoblastoma phosphorylation in rhesus ovarian surface epithelial cell culture (2003) (16)
- Luteal function following ovarian stimulation in rhesus monkeys for in vitro fertilization: atypical response to human chorionic gonadotropin treatment simulating early pregnancy. (1988) (15)
- Follicular fluid treatment during the follicular versus luteal phase of the menstrual cycle: effects on corpus luteum function. (1984) (15)
- Characteristics and regulation of the ovarian cycle in vervet monkeys (Chlorocebus aethiops) (2007) (15)
- Maternal high-fat diet consumption and chronic hyperandrogenemia are associated with placental dysfunction in female rhesus macaques. (2019) (14)
- Dynamics of Immune Cell Types Within the Macaque Corpus Luteum During the Menstrual Cycle: Role of Progesterone1 (2015) (14)
- SYSTEMATIC DETERMINATION OF DIFFERENTIAL GENE EXPRESSION IN THE PRIMATE CORPUS LUTEUM DURING THE LUTEAL PHASE OF THE MENSTRUAL CYCLE (2007) (14)
- Pre-ovulatory events in the rhesus monkey follicle during ovulation induction. (2002) (14)
- Thermoregulatory ability and the thyroid gland: their development in embryonic Japanese quail (Coturnix c. japonica). (1972) (14)
- Inhibin production by macaque granulosa cells from pre- and periovulatory follicles: regulation by gonadotropins and prostaglandin E2. (1992) (14)
- Radioligand binding assay of progesterone receptors in the primate corpus luteum after in vivo treatment with the 3 beta-hydroxysteroid dehydrogenase inhibitor, trilostane. (1994) (14)
- Erratum: Human embryonic stem cells derived by somatic cell nuclear transfer (Cell (2013) 153 (1228-1238)) (2013) (14)
- Isolation of ovine luteal cell subpopulations by flow cytometry. (1993) (14)
- Progesterone production by luteal cells isolated from cynomolgus monkeys: Effects of gonadotropin and prolactin during acute incubation and cell culture (1980) (14)
- Stimulation of Follicle and Oocyte Development in Macaques for IVF Procedures (1993) (13)
- Disparate effects of the prostaglandin synthesis inhibitors, meclofenamate, and flurbiprofen on monkey luteal tissue in vitro. (1990) (13)
- Comparison of functional response of rat, macaque, and human ovarian cells in hormonally defined medium. (1993) (13)
- REGULATION OF THE PRIMATE CORPUS LUTEUM DURING EARLY PREGNANCY (1987) (13)
- Evaluation of the vervet (Clorocebus aethiops) as a model for the assisted reproductive technologies (2007) (13)
- Corpus luteum function during the early postpartum interval in lactating rhesus monkeys: In vivo and in vitro response to exogenous gonadotropin (1977) (12)
- Ovarian surface epitheliectomy in the non-human primate: continued cyclic ovarian function and limited epithelial replacement. (2011) (12)
- Identification and Characterization of an Ovary-Selective Isoform of Epoxide Hydrolase1 (2005) (12)
- Gonadotrophic and local control of the developing corpus luteum in rhesus monkeys. (1993) (12)
- Modulation of membrane fluidity in the primate (Macaca mulatta) corpus luteum: correlation with changes in gonadotropin binding. (1985) (11)
- Changes in circulating levels and ratios of angiopoietins during pregnancy but not during the menstrual cycle and controlled ovarian stimulation. (2010) (11)
- Expression of mRNA and proteins for GnRH I and II and their receptors in primate corpus luteum during menstrual cycle (2008) (10)
- Western-style diet, with and without chronic androgen treatment, alters the number, structure, and function of small antral follicles in ovaries of young adult monkeys. (2016) (10)
- Comparisons of gonadotropin binding sites and progesterone concentrations among the corpora lutea of individual pigs. (1984) (10)
- Expression of LGR7 in the Primate Corpus Luteum Implicates the Corpus Luteum as a Relaxin Target Organ (2009) (10)
- Induction of proliferation in the primate ovarian surface epithelium in vivo. (2008) (10)
- Low-dose antiprogestin treatment prevents pregnancy in rhesus monkeys and is reversible after 1 year of treatment. (2003) (10)
- Evidence for two populations of masked gonadotropin-binding sites in the corpus luteum of the rhesus monkey (Macaca mulatta). (1985) (10)
- Anti‐human gonadotropin antibodies generated during in vitro fertilization (IVF)‐related cycles: Effect on fertility of rhesus macaques (1995) (10)
- Chronic low-dose antiprogestin impairs preimplantation embryogenesis, but not oocyte nuclear maturation or fertilization in rhesus monkeys (2002) (9)
- Induction of proliferation in the primate ovarian surface epithelium in vivo (2007) (9)
- The effect of intraluteal infusion of deglycosylated human chorionic gonadotropin on the corpus luteum in rhesus monkeys. (1990) (9)
- Changes in immune cell distribution and their cytokine/chemokine production during regression of the rhesus macaque corpus luteum† (2017) (9)
- The function and regulation of the primate corpus luteum during the fertile menstrual cycle. (1989) (8)
- Quantification of dynamic changes to blood volume and vascular flow in the primate corpus luteum during the menstrual cycle (2014) (8)
- IVF-ET in Old World Monkeys (1993) (7)
- Steroid Receptors in Health and Disease (1988) (7)
- Oocyte maturation and in vitro hormone production in small antral follicles (SAFs) isolated from rhesus monkeys (2013) (7)
- Chronic exposure of the developing corpus luteum in monkeys to chorionic gonadotropin: persistent progesterone production despite desensitization of adenylate cyclase. (1988) (7)
- Sphingosine-1-Phosphate Inhibits Apoptosis in Rhesus Monkey Ovarian Tissue In Vitro and May Improve Reproductive Function in Xenografts (2005) (6)
- The Role of Scientists and Clinicians in Raising Public Support for Animal Research in Reproductive Biology and Medicine1 (2013) (6)
- Recent Progress in Mammalian Cloning (1998) (6)
- Dynamic Expression of Apelin and Its Receptor in the Primate Preovulatory Follicle and Corpus Luteum During the Menstrual Cycle. (2012) (5)
- Subcutaneous ovarian tissue transplantation in nonhuman primates: duration of endocrine function and normalcy of subsequent offspring as demonstrated by reproductive competence, oocyte production, and telomere length (2017) (5)
- Impact of obesity on oral contraceptive pharmacokinetics and hypothalamic-pituitary-ovarian activity: a mechanism for contraceptive failure? (2007) (5)
- Use of controlled ovulation of the dominant follicle to assess oocyte maturation during natural menstrual cycles in rhesus macaques. (2005) (4)
- Circulating levels of total angiopoietin-2 and the soluble Tie-2 receptor in women during ovarian stimulation and early gestation. (2006) (4)
- Duration, Amplitude, and Specificity of the Midcycle Gonadotropin Surge in Nonhuman Primates (2000) (4)
- Selection and Maturation of the Dominant Follicle and Its Ovum in the Menstrual Cycle (1983) (4)
- Cellular Localization of Estrogen and Progestin Receptors in the Macaque Reproductive System (1989) (3)
- The role of estradiol in primate ovarian function (2000) (3)
- Culture of preantral follicles from prepubertal and adult rhesus monkeys in a three-dimensional (3D) alginate matrix: FSH required for growth to early antral stage (2008) (3)
- Birth of a rhesus monkey after transplantation of ovarian tissue (2003) (3)
- Effects of steroid ablation and progestin replacement on the transcriptome of the primate corpus luteum during simulated early pregnancy. (2014) (3)
- Insulin-like growth factor-2 (IGF2) production and regulation in macaque preantral follicles during 3-dimensional culture (2016) (3)
- Dynamic Expression of the SLIT-ROBO Pathway in the Periovulatory Follicle and Corpus Luteum in Primates. (2010) (3)
- Insulin-like growth factor 2 is produced by antral follicles and promotes preantral follicle development in macaques† (2020) (3)
- Gonadotropin- and lipoprotein-supported progesterone production by primate luteal cell types in culture (1995) (3)
- Corpus Luteum in Primates (2003) (3)
- Primate preantral follicles produce vascular endothelial growth factor (VEGF) during three-dimensional (3D) culture as a function of growth rate (2009) (3)
- Cumulus-Oocyte Expansion in Rhesus Macaques: A Critical Role for Prostaglandin E2 (PGE2) and the PGE2 Receptor Subtype-2 (PTGER2). (2011) (3)
- Elevated androgen and/or consumption of a western-style diet has detrimental effects on rhesus monkey ovulatory follicles and oocytes (2017) (2)
- Circulating vascular endothelial growth factor (VEGF) levels in nonhuman primates and women: species differences and relevance to ovarian hyperstimulation syndrome. (2001) (2)
- Microarray Analysis of the Transcriptome in the Primate Corpus Luteum During Chorionic Gonadotropin Administration Simulating Early Pregnancy. (2010) (1)
- In vitro exposure to inhibitors of phosphodiesterase (PDE) 3, but not PDE 4, prevent spontaneous resumption of meiosis in rhesus macaque oocytes. (2001) (1)
- 207: The intestinal microbiome is regulated by diet in a novel primate model of polycystic ovarian syndrome (PCOS) (2016) (1)
- Chronically elevated androgen with or without a western-style diet reduces the pregnancy rate and early placental vascularization in young adult rhesus monkeys (2017) (1)
- Testosterone promotes survival and growth of primate preantral follicles cultured individually in a three-dimensional matrix (2012) (1)
- Elution and rebinding of gonadotropins to receptors in corpora lutea: comparisons among treatments and species. (1987) (1)
- Endocrine and Local Control of the Primate Corpus Luteum: 1973 to Today.Richard L. Stouffer, Ph.D. (2009) (1)
- Anti-müllerian hormone (AMH) alters preantral follicle survival and growth, plus inhibits steroid production in antral follicles during encapsulated 3-dimensional (3D) culture in primates (2012) (1)
- Severe endometriosis in rhesus macaques consuming a western-style diet (WSD) and chronically treated with androgen (2019) (1)
- Production of anti-müllerian hormone (AMH) as a function of rhesus monkey follicle fate and growth rate during three-dimensional culture (2008) (1)
- Insulin and insulin-like growth factors (IGFs) promote vascular endothelial growth factor (VEGF) secretion by macaque granulosa cells from preovulatory follicles. (2001) (1)
- MICROARRAY ANALYSIS OF GENE EXPRESSION IN THE PRIMATE OVULATORY FOLLICLE: VALIDATION OF SELECTED GENE TRANSCRIPTS BY REAL-TIME PCR (2007) (1)
- 125I-luteinizing hormone (LH) binding to soluble receptors from the primate (Macaca mulatta) corpus luteum: effects of ethanol exposure. (1988) (1)
- Contraception with Low-Dose Antiprogestin in Rhesus Monkeys Is Reversible after One Year of Treatment (2000) (1)
- Western-style diet (WSD) with and without testosterone (T) exposure changes follicular structure-function in young adult, female rhesus monkeys (2013) (1)
- Local Delivery of an Anti-Lymphangiogenic Agent Suppresses Ovulation in the Monkey. (2009) (1)
- Studies on anti-müllerian hormone production, action, and regulation in the primate ovary: Insight into human folliculogenesis (2016) (1)
- Controlled Ovarian Stimulation of Rhesus Monkeys Using Macaque Recombinant Gonadotropins. (2008) (1)
- A distinct cervicovaginal microbiome dysbiosis precedes adverse reproductive outcomes in a primate model of PCOS: 999 (2019) (1)
- Basic and applied biology of the primate reproductive tract – a symposium in honor of the career of Dr Robert M Brenner: Preface (2006) (1)
- Hyperandrogenemia plus western style diet (WSD) attenuates decidualization in rhesus macaques (2012) (1)
- Exposure of peripubertal macaques to western-style diet (WSD) and chronic testosterone (T) in vivo alters secondary follicle function during encapsulated 3-dimensional (3D) culture (2013) (1)
- Comparative primate biology, Volume 3: Reproduction and development. Edited By W. R. Dukelow and J. Erwin. New York: Alan R. Liss, Inc. 1986. xii + 497 pp., tables, figures, indexes. $120.00 (cloth) (1987) (1)
- Dose-Dependent Effects of Gonadotropin, Oxygen, and Fetuin on Macaque Follicle Survival, Growth, and Maturation During Encapsulated Three-Dimensional Culture. (2009) (1)
- Erratum: Vascular endothelial growth factor (VEGF) and angiopoietin regulation by gonadotrophin and steroids in macaque granulosa cells during the peri-ovulatory interval (Molecular Human Reproduction 5 (1115-1121)) (2000) (1)
- Endocrine, Paracrine, and Autocrine Regulators of the Macaque Corpus Luteum (1991) (1)
- INDUCTION OF PROLIFERATION IN THE PRIMATE OVARIAN SURFACE EPITHELIUM (2007) (1)
- Contraceptive trial testing a prostaglandin E2 receptor (EP2) antagonist in female monkeys (2012) (1)
- Elevated testosterone in the presence or absence of a western-style diet attenuates MMP26, TIMP3 and glucose transporter expression in the macaque secretory endometrium (2017) (1)
- Luteinizing hormone modulates human melanoma tumor stem cell expression and binds to human melanoma cells (1981) (1)
- Effects of Steroid Ablation on the Luteal Transcriptome During Simulated Early Pregnancy in Rhesus Macaques. (2011) (1)
- Use of novel intravascular contrast reagents to define vascular parameters in rhesus macaque ovaries during controlled ovarian stimulation (2010) (1)
- Identification and Characterization of an Ovary-Selective Isoform of Epoxide Hydrolase 1 (2005) (0)
- Controlled ovulation of the dominant follicle: a model for examining periovulatory events in the natural menstrual cycle. (2001) (0)
- Molecular, Cellular and Systems Approaches to Study Ovarian Function in a Primate (Macaque) Model: Implications for Fertility Control. (2011) (0)
- O-98: The phosphodiesterase 3 inhibitor ORG 9935 inhibits oocyte maturation in the naturally-selected dominant follicle in rhesus macaques (2006) (0)
- Local Effects of the Sphingosine 1-phosphate on PGF2alpha-induced Luteolysis in the Pregnant Rat. (2008) (0)
- Marked changes in the circulating levels and ratios of angiopoietins during pregnancy, compared to natural menstrual cycles and controlled ovarian stimulation (2007) (0)
- Endocrine and local control of the preovulatory follicle and developing corpus luteum in primates (2005) (0)
- Using DCE-MRI to Determine Vascular Properties of Female Rhesus Macaque Reproductive Tissue : Pharmacokinetic Model Considerations (2009) (0)
- A prostaglandin E2 receptor type 3 antagonist prevents ovulation in rhesus macaques (2015) (0)
- Chronic hyper androgenemia and western-style diet in adolescent female monkeys: A model for onset of PCOS in young women (2015) (0)
- Steroid Ablation Suppresses the Development of Primate Preantral Follicles Cultured Individually in a Three-Dimensional Matrix. (2011) (0)
- Reply: The fimbria/ovarian surface junction (2011) (0)
- 72: Dysbiosis of the cervicovaginal microbiome and decreased fertility occur in a nonhuman primate model of PCOS (2018) (0)
- Evaluation of antral follicle growth, selection and luteal structure-function in the macaque ovary during the menstrual cycle by high-resolution ultrasonography (2007) (0)
- Relaxin Secretion by the Primate Corpus Luteum During Simulated Early Pregnancy in Hyperstimulated Menstrual Cycles (1991) (0)
- 387 RAISING PERIPUBERTAL TESTOSTERONE LEVELS IN FEMALE MACAQUES: FIRST PHASE OF A PROSPECTIVE STUDY TO EVALUATE THE ROLE OF PERIPUBERTAL HYPERANDROGENEMIA IN THE PATHOGENESIS OF POLYCYSTIC OVARY SYNDROME. (2007) (0)
- Applications of novel, non-invasive imaging techniques to the uterus of rhesus macaques: measuring vascular parameters (2008) (0)
- The phosphodiesterase 3 inhibitor ORG 9935 prevents pregnancy in cynomolgus macaques (2008) (0)
- Systematic identification of protease genes that are differentially expressed in the primate follicle during the periovulatory interval (2007) (0)
- The metalloproteinase inhibitor Galardin (GM6001) interferes with follicle rupture, but not subsequent luteal phase length or progesterone synthesis in primates (2008) (0)
- Synchronization of recipients for embryo transfer: a novel method using a gonadotropin releasing hormone (GnRH) antagonist in rhesus monkeys (2002) (0)
- Primate Granulosa and Luteal Cells Secrete Angiopoietin-2 (angpt-2) in a Gonadotropin-and Hypoxia-independent Manner (2005) (0)
- Quantification of Immune Cells in the Primate Corpus Luteum During the Menstrual Cycle; Increases During the Late Luteal Phase Indicate a Potential Role in Luteolysis. (2012) (0)
- Dynamic Expression of Vascular Endothelial Growth Factor-B Isoform in the Primate Corpus Luteum during the Menstrual Cycle (2005) (0)
- Quantification of blood volume and vascular perfusion in the corpus luteum of rhesus macaques during the menstrual cycle (2012) (0)
- Amphiregulin stimulates cumulus-oocyte expansion and oocyte maturation in rhesus macaques (2010) (0)
- Testosterone and western-style diet induce changes in ovarian structure-function of young adult, female rhesus monkeys (2012) (0)
- 200 Hormonal receptors in endometrial and ovarian carcinoma (1983) (0)
- Delivery of vascular endothelial growth factor (VEGF) to sham ovarian tissue autografts in non-human primates: optimal method of delivery and dose (2010) (0)
- Corpus Luteum Rescue in Nonhuman Primates and Women (2017) (0)
- MON-LB037 The Impact of Maternal Testosterone and Western-Style Diet on the Fetal Hypothalamic-Pituitary-Gonadal Axis (2019) (0)
- First Evidence for the Dynamic Expression and Regulation of the Corticotropin Releasing Hormone-Receptor-Binding Protein (CRH-R-BP) System in the Primate Corpus Luteum (CL) of the Menstrual Cycle (2005) (0)
- Long-term followup of autologous, non-human primate ovarian tissue translants and reproductive competence in offspring born from ovarian tissue transplantation (2010) (0)
- Laboratory instrument interface system (LIIS): a unit for the acquisition, temporary storage and transfer of data to a microcomputer. (1985) (0)
- Survival, Growth, and Maturation of Secondary Follicles from Rhesus Monkeys During Encapsulated Three-dimensional Culture: Effects of Age and Insulin. (2010) (0)
- On the Horizon: Nonsteroidal Contraceptive Targets in the Female Ovary and Reproductive Tract. (2008) (0)
- Western-style diet (WSD) in the presence and absence of elevated circulating androgen alters hormone responsiveness in the rhesus macaque endometrium (2016) (0)
- Androgen and estrogen promote macaque preantral follicle survival and growth in the absence of fsh during 3-dimensional culture (2016) (0)
- Fertility control A prostaglandin E 2 receptor antagonist prevents pregnancies during a preclinical contraceptive trial with female macaques (2014) (0)
- Western-style diet (WSD) in the presence and absence of elevated circulating androgen alters ovarian structure-function in young adult rhesus monkeys (2016) (0)
- 384 binding sites for 125I-human luteinizing hormone (hLH) on murine and human melanoma cells (1983) (0)
- Non-Invasive Methods to Investigate Vascular Permeability in Rhesus Macaque Ovaries; Possible Applications for Management of Ovarian Hyperstimulation Syndrome. (2009) (0)
- Transcriptome in small antral follicles of monkeys on a western-style diet with/without testosterone (2014) (0)
- The effect of exogenous recombinant human activin A on pituitary and ovarian hormone secretion and ovarian folliculogenesis in female rats and monkeys. (1994) (0)
- RESEARCH ARTICLE Evaluation of the Vervet (Clorocebus aethiops) as a Model for the Assisted Reproductive Technologies (2007) (0)
- Local luteotropic role of the corticotropin releasing hormone/urocortin-receptor-binding protein (CRH/UCN-R-BP) system in the primate corpus luteum (CL) (2007) (0)
- Fibrinogen in the 3-Dimensional Matrix Promotes In Vitro Development of Primate Primary, but Not Secondary, Follicles with Estradiol/Vascular Endothelial Growth Factor Production and Oocyte Maturation. (2012) (0)
- Steroid Sensitivity and Proliferative Potential of the Primate Ovarian Surface Epithelium (2005) (0)
- An Alginate Matrix Supports the Three-dimensional Architecture of the Nonhuman Primate Follicle and Permits Coordinated Development of Preantral Follicles to Small Antral Follicles in Vitro. (2008) (0)
- RNAi-Knockdown of genomic progesterone receptor in nonhuman primate granulosa cells and preovulatory follicles (2014) (0)
- Novel imaging technique for quantitating ovarian vascular permeability in rhesus macaques undergoing controlled ovarian stimulation (2008) (0)
- Addition of fibrinogen to the 3-Dimensional (3D) matrix promotes in vitro development of primate primary, but not secondary, follicles with anti-müllerian hormone (AMH) production (2011) (0)
- Intraovarian Control of Ovulation: Lessons from Steroid Ablation/Replacement in Monkeys (2000) (0)
- Differential Regulation of Vascular Endothelial Growth Factor (VEGF-A) Secretion by Insulin and Insulin-Like Growth Factors (IGF) in Human Luteinizing Granulosa Cells (LGC) Following Controlled Ovarian Stimulation (COS) in a Polycystic Ovarian (PCOS) Population (2005) (0)
- Estrogen Regulation of Ovarian Surface Epithelial Dynamics and Matrix Remodeling in Rhesus Macaques. (2011) (0)
- CGTGGCCCCTATGCTCAT CACAAGGCCAACGTT TGATAACGTGTGTGCCCTTGTC CYP 19 A CCTCGCACCCAGATGAGACT TCTTTACCCCCAGAAAC GACCAGCCTTCTCTAGTGTTCCA AREG GGAATGGACCGCAATGACA CGTGAACCATTTTC CACTTCTTGAGGTAACCTCAAATCC EREG TGACATGAATGGCTACTGTTTGC TGGACAGTGCATCTAC CGGACACCAGTATAACCCACTTC HSA 2 AGGGTCCCGGTGAGACAGAT CGCAACA (2011) (0)
- 497: The cervical microbiome is hormonally responsive (2016) (0)
- SELECTED ORAL COMMUNICATION SESSION, SESSION 22: FERTILITY PRESERVATION – BASIC, Monday 4 July 2011 15:15 – 16:30 (2011) (0)
- Corticotropin-Releasing Hormone/Urocortin-Receptor Actions Modulate Cell Numbers and Progesterone Production by Primate Luteinizing Granulosa Cells In Vitro. (2009) (0)
- The Ovarian Surface Epithelium and Ovulation. (2009) (0)
- Menstrual Cycle But Not Messenger Ribonucleic Acid, in the Monkey Corpus Luteum during the Dynamic Expression of Caspase-2, -3, -8, and -9 Proteins and Enzyme Activity, (2005) (0)
- O-166 A chronic, low dose regimen of the antiprogestin ZK 137 316 permits normal ovarian/menstrual cyclicity, but prevents pregnancy, in rhesus monkeys (1997) (0)
- Dynamics of growth and differentiation factor-9 and inhibin B production in macaque developing follicles during 3-dimensional culture (2017) (0)
- The steroid inhibitor trilostane decreases gonadotropin-, but not prostaglandin e2-, stimulated haluronic acid expression by macaque cumulus-oocyte-complexes during culture (2014) (0)
- Microarray analysis of gene expression in the primate ovulatory follicle: Selected gene transcripts involved in cumulus–oocyte expansion (2007) (0)
- Validation of Blood Spot Sampling for Gonadotropins and Ovarian Hormone Levels in Reproductive Age Women (2005) (0)
- Insulin and Insulin-Like Growth Factors (IGFs) promote Vascular Endothelial Growth Factor (VEGF-A) secretion by human luteinizing granulosa cells following Controlled Ovarian Stimulation (COS) (2003) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Richard L. Stouffer?
Richard L. Stouffer is affiliated with the following schools:
