Sergei i. Grivennikov
#165,218
Most Influential Person Now
Sergei i. Grivennikov's AcademicInfluence.com Rankings
Sergei i. Grivennikovphilosophy Degrees
Philosophy
#9697
World Rank
#13294
Historical Rank
Logic
#6665
World Rank
#8204
Historical Rank

Sergei i. Grivennikovbiology Degrees
Biology
#13351
World Rank
#16896
Historical Rank
Immunology
#924
World Rank
#948
Historical Rank

Download Badge
Philosophy Biology
Why Is Sergei i. Grivennikov Influential?
(Suggest an Edit or Addition)Sergei i. Grivennikov's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Immunity, Inflammation, and Cancer (2010) (8640)
- IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. (2009) (1888)
- Inflammation and colon cancer. (2010) (1750)
- Inflammation and Cancer: Triggers, Mechanisms, and Consequences. (2019) (1275)
- Adenoma-linked barrier defects and microbial products drive IL-23/IL-17-mediated tumour growth (2012) (1060)
- Carcinoma-produced factors activate myeloid cells through TLR2 to stimulate metastasis (2009) (1008)
- Dangerous liaisons: STAT3 and NF-kappaB collaboration and crosstalk in cancer. (2010) (969)
- Tumour-infiltrating regulatory T cells stimulate mammary cancer metastasis through RANKL–RANK signalling (2011) (598)
- JNK1 in hematopoietically derived cells contributes to diet-induced inflammation and insulin resistance without affecting obesity. (2007) (525)
- Interleukin-17 signaling in inflammatory, Kupffer cells, and hepatic stellate cells exacerbates liver fibrosis in mice. (2012) (521)
- Inflammatory cytokines in cancer: tumour necrosis factor and interleukin 6 take the stage (2011) (506)
- A gp130–Src–YAP module links inflammation to epithelial regeneration (2015) (483)
- Inflammation and colorectal cancer: colitis-associated neoplasia (2013) (456)
- Inflammation and oncogenesis: a vicious connection. (2010) (409)
- Autocrine IL-6 signaling: a key event in tumorigenesis? (2008) (363)
- B-cell-derived lymphotoxin promotes castration-resistant prostate cancer (2010) (359)
- Distinct and nonredundant in vivo functions of TNF produced by t cells and macrophages/neutrophils: protective and deleterious effects. (2005) (336)
- Fibroblast-specific protein 1 identifies an inflammatory subpopulation of macrophages in the liver (2010) (314)
- MicroRNA-135b Promotes Cancer Progression by Acting as a Downstream Effector of Oncogenic Pathways in Colon Cancer (2014) (273)
- Interleukin-17 receptor a signaling in transformed enterocytes promotes early colorectal tumorigenesis. (2014) (251)
- Tumor promotion via injury- and death-induced inflammation. (2011) (246)
- The unholy trinity: inflammation, cytokines, and STAT3 shape the cancer microenvironment. (2011) (242)
- Nonredundant Function of Soluble LTα3 Produced by Innate Lymphoid Cells in Intestinal Homeostasis (2013) (219)
- Distinct role of surface lymphotoxin expressed by B cells in the organization of secondary lymphoid tissues. (2002) (217)
- Cytokines, IBD, and Colitis-associated Cancer (2015) (200)
- B-cell-derived lymphotoxin promotes castration-resistant prostate cancer (2010) (183)
- Microbiome, Inflammation, and Cancer (2014) (170)
- TLR-signaling and proinflammatory cytokines as drivers of tumorigenesis. (2017) (132)
- Dissecting the role of lymphotoxin in lymphoid organs by conditional targeting (2003) (116)
- Interleukins 1 and 6 as main mediators of inflammation and cancer (2016) (104)
- Tumor necrosis factor is critical to control tuberculosis infection. (2007) (101)
- Prominent role for T cell-derived Tumour Necrosis Factor for sustained control of Mycobacterium tuberculosis infection (2013) (100)
- Intracellular signals and events activated by cytokines of the tumor necrosis factor superfamily: From simple paradigms to complex mechanisms. (2006) (100)
- An Interleukin‐23‐Interleukin‐22 Axis Regulates Intestinal Microbial Homeostasis to Protect from Diet‐Induced Atherosclerosis (2018) (100)
- Cell‐Type‐Specific Responses to Interleukin‐1 Control Microbial Invasion and Tumor‐Elicited Inflammation in Colorectal Cancer (2019) (98)
- Cellular source and molecular form of TNF specify its distinct functions in organization of secondary lymphoid organs. (2010) (96)
- Transcription factor T-bet regulates intraepithelial lymphocyte functional maturation. (2014) (95)
- Physiological functions of tumor necrosis factor and the consequences of its pathologic overexpression or blockade: mouse models. (2008) (92)
- Novel tumor necrosis factor‐knockout mice that lack Peyer's patches (2005) (85)
- Chemokines, cytokines and exosomes help tumors to shape inflammatory microenvironment. (2016) (82)
- Application of 3D tumoroid systems to define immune and cytotoxic therapeutic responses based on tumoroid and tissue slice culture molecular signatures (2017) (78)
- Membrane tumor necrosis factor confers partial protection to Listeria infection. (2005) (69)
- Redundancy in Tumor Necrosis Factor (TNF) and Lymphotoxin (LT) Signaling In Vivo: Mice with Inactivation of the Entire TNF/LT Locus versus Single-Knockout Mice (2002) (69)
- Membrane TNF confers protection to acute mycobacterial infection (2005) (68)
- Cutting Edge: IL-10–Mediated Tristetraprolin Induction Is Part of a Feedback Loop That Controls Macrophage STAT3 Activation and Cytokine Production (2012) (64)
- TNF in host resistance to tuberculosis infection. (2010) (63)
- Hepatic expression of HCV RNA-dependent RNA polymerase triggers innate immune signaling and cytokine production. (2012) (61)
- Ectodysplasin regulates the lymphotoxin-beta pathway for hair differentiation. (2006) (60)
- Implications of anti-cytokine therapy in colorectal cancer and autoimmune diseases (2012) (57)
- Critical role for IL-1β in DNA damage-induced mucositis (2014) (43)
- IL-11: a prominent pro-tumorigenic member of the IL-6 family. (2013) (42)
- Reactivation of tuberculosis by tumor necrosis factor neutralization. (2007) (42)
- β-Hydroxybutyrate suppresses colorectal cancer (2022) (41)
- Dangerous liaisons: STAT3 and NF- κ B collaboration and crosstalk in cancer (2010) (38)
- Novel Lymphotoxin Alpha (LTα) Knockout Mice with Unperturbed Tumor Necrosis Factor Expression: Reassessing LTα Biological Functions (2006) (36)
- Accelerated thymic atrophy as a result of elevated homeostatic expression of the genes encoded by the TNF/lymphotoxin cytokine locus (2009) (32)
- Colitis-Associated and Sporadic Colon Cancers: Different Diseases, Different Mutations? (2016) (27)
- Distinct mechanisms govern populations of myeloid-derived suppressor cells in chronic viral infection and cancer. (2021) (27)
- Novel lymphotoxin alpha (LTalpha) knockout mice with unperturbed tumor necrosis factor expression: reassessing LTalpha biological functions. (2006) (26)
- Targeting Stat3 signaling impairs the progression of bladder cancer in a mouse model. (2020) (20)
- Anti-inflammatory natural product goniothalamin reduces colitis-associated and sporadic colorectal tumorigenesis (2017) (19)
- Inflammation and colorectal cancer: colitis-associated neoplasia (2012) (18)
- TCR-Vγδ usage distinguishes protumor from antitumor intestinal γδ T cell subsets (2022) (17)
- Ablation of TNF or lymphotoxin signaling and the frequency of spontaneous tumors in p53-deficient mice. (2008) (17)
- Top Notch cancer stem cells by paracrine NF-κB signaling in breast cancer (2013) (16)
- IL-22 gets to the stem of colorectal cancer. (2014) (16)
- A Nonpyroptotic IFN-γ–Triggered Cell Death Mechanism in Nonphagocytic Cells Promotes Salmonella Clearance In Vivo (2018) (15)
- Modalities of experimental TNF blockade in vivo: mouse models. (2011) (14)
- Lymphotoxin-beta regulates periderm differentiation during embryonic skin development. (2007) (12)
- IL-17 signaling in inflammatory cells , Kupffer cells and Hepatic Stellate cells exacerbates liver fibrosis (2013) (12)
- Stratification of radiosensitive brain metastases based on an actionable S100A9/RAGE resistance mechanism (2022) (11)
- IFN-γ mediates Paneth cell death via suppression of mTOR (2021) (11)
- T cell‐derived TNF down‐regulates acute airway response to endotoxin (2007) (10)
- Effects of various N-terminal addressing signals on sorting and folding of mammalian CYP11A1 in yeast mitochondria. (2003) (10)
- Microbiome in cancer progression and therapy. (2020) (9)
- Microbiota-driven mechanisms at different stages of cancer development (2022) (7)
- Essential role of a ThPOK autoregulatory loop in the maintenance of mature CD4+ T cell identity and function (2021) (6)
- Fibroblast-recruited , tumor-infiltrating CD 4 + T cells stimulate mammary cancer metastasis through RANKL-RANK signaling (2011) (4)
- Ectodysplasin regulates the lymphotoxin- pathway for hair differentiation (2006) (4)
- Interleukins 1 and 6 as main mediators of inflammation and cancer (2016) (3)
- microRNA-135b promotes cancer progression acting as a downstream effector of oncogenic pathways in colon cancer (2013) (3)
- Reduced PD-1/PD-L1 expression in KRAS-mutant versus wild-type microsatellite instable (MSI-H) colorectal cancer (CRC) and association of wnt pathway corepressor TLE-3. (2015) (3)
- Physiologic Roles of Members of the TNF and TNF Receptor Families as Revealed by Knockout Models (2003) (3)
- On the effect of cholesterol on the fate of CYP11A1 imported into yeast mitochondria in vivo. (2000) (3)
- Interleukin-27 signaling serves as an immunological checkpoint for innate cytotoxic cells to promote hepatocellular carcinoma. (2022) (3)
- TET1 and TDG suppress intestinal tumorigenesis by down-regulating the inflammatory and immune response pathways (2019) (2)
- Keratinocyte-derived S100A9 modulates neutrophil infiltration and affects psoriasis-like skin and joint disease (2022) (2)
- Innate Immunity, Inflammation and Colorectal Cancer (2013) (2)
- LTα, TNF, and ILC3 in Peyer’s Patch Organogenesis (2022) (2)
- 149 Mice in which human TNF is mediating both beneficial and deleterious functions: A model comparison of different blockade strategies (2008) (2)
- Microbiota and cancer: a complex equation with a lot of exciting unknowns. (2017) (2)
- Microbiome Implications in Intestinal Tumorigenesis (2015) (1)
- N-glycosylation Regulates Intrinsic IFN-γ Resistance in Colorectal Cancer: Implications for Immunotherapy (2022) (1)
- The role of IL-6 and IL-23 in colitis associated cancer (2009) (1)
- IMPlicating Mesenchymal Imp1 in Colitis-Associated Cancer (2015) (1)
- Abstract 5045: Inflammation is upregulated in the normal colonic epithelium and stroma ofApc+/Min-FCCCmice with colon tumors (2018) (0)
- Interleukin 23 and Tumor‐Elicited Inflammation in Colitis‐Associated and Spontaneous Colon Cancer: P‐202 (2012) (0)
- Lymphoid Cells in Intestinal Homeostasis Produced by Innate 3 α Nonredundant Function of Soluble LT (2013) (0)
- Abstract 19582: Deletion of miRNA-146a Alters Host Immune Response to Coxsackievirus B3 with Activation of NK cells (2012) (0)
- Abstract 3130: IL-27 signaling regulates anti-cancer immune response in hepatocellular carcinoma (2022) (0)
- KLF5 governs sphingolipid metabolism and barrier function of the skin (2022) (0)
- IL-27R signaling serves as immunological checkpoint for NK cells to promote hepatocellular carcinoma (2020) (0)
- Abstract 1757: IFN-γ signaling in myeloid and fibroblastic cells regulates pancreatic cancer growth and metastasis (2021) (0)
- Abstract B14: Anti-miR-135b in colon cancer treatment (2012) (0)
- Abstract 3183: Role of danger signals in tumor elicited inflammation (2015) (0)
- Lymphoid organ specificity in the maintenance of secondary lymphoid tissues by TNF produced by B and T cells (95.26) (2007) (0)
- The role of danger signals in tumor elicited inflammation (TUM5P.934) (2014) (0)
- This information is current as STAT 3 Activation and Cytokine Production Feedback Loop That Controls Macrophage Tristetraprolin Induction Is Part of a Mediated − Cutting Edge : IL-10 (2012) (0)
- β-Hydroxybutyrate suppresses colorectal cancer (2022) (0)
- Author response: IFN-γ mediates Paneth cell death via suppression of mTOR (2021) (0)
- TET1 and TDG suppress inflammatory response in intestinal tumorigenesis: implications for colorectal tumors with the CpG Island Methylator Phenotype. (2023) (0)
- Abstract 150: Cytokine Signaling In Intestinal Epithelial Cells As A Regulator Of Microbiota, Inflammation And Atherosclerosis (2022) (0)
- Abstract 2799: Goniothalamin, a natural product, modulates the inflammatory microenvironment on colitis and colitis-associated cancer (2015) (0)
- Top Notch cancer stem cells by paracrine NF-κB signaling in breast cancer (2013) (0)
- Abstract 3459:PKD1regulates susceptibility to ulcerative colitis and colorectal cancer (2019) (0)
- CTCTGCAGCTCAGCC ATGGCTGCTTCTGCTGCT TCCTCAGAGACATCC ATCTGGTCCTACACGAAGCC TTCCCAGATCACAGA TCCAGAAGGCCCTCAGACTA GCAGCCTGAGTGTCT AATTCCAGAACCGCTCCAGT AGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA AAAGGTTTGGAAGCAG TGTGAAATGCCACCTTTTGA CAGGTCCTTCCTAAA GGAGAGCCCTGGATACCAAC TCTGGGCCATAGAACT CCACCACGCTCTTCTGTCTAC (2012) (0)
- Abstract 5162: Role of IFN-gamma-activation of distinct tumor and stromal cell populations in colorectal carcinoma pathogenesis (2019) (0)
- Vγ usage distinguishes pro- and anti-tumor intestinal γδ T cell subsets (2021) (0)
- Role of TNF in colon carcinogenesis (2008) (0)
- Novel Lymphotoxin Alpha (LT (cid:2) ) Knockout Mice with Unperturbed Tumor Necrosis Factor Expression: Reassessing LT (cid:2) Biological Functions† (2006) (0)
- The role of IL-6 and IL-23 in colitis associated cancer (88.30) (2009) (0)
- Abstract 419: PKD1 regulates susceptibility to ulcerative colitis and colorectal cancer (2020) (0)
- Abstract 1607: IL-27 signaling serves as an immunological checkpoint for NK cells to promote hepatocellular carcinoma in multiple murine models (2021) (0)
- in organization of secondary lymphoid organs Cellular source and molecular form of TNF specify its distinct functions (2010) (0)
- Abstract 2117: IFN-γ signaling in myeloid cells regulates pancreatic cancer growth and progression (2022) (0)
- The role of interleukin 23 in colitis-associated and spontaneous colon cancer: P-194. (2011) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Sergei i. Grivennikov?
Sergei i. Grivennikov is affiliated with the following schools: