Stephen B. Baylin
#46,695
Most Influential Person Now
Cancer researcher
Stephen B. Baylin's AcademicInfluence.com Rankings
Stephen B. Baylinlaw Degrees
Law
#699
World Rank
#929
Historical Rank
Common Law
#5
World Rank
#5
Historical Rank

Stephen B. Baylinbiology Degrees
Biology
#1574
World Rank
#2600
Historical Rank
Genetics
#96
World Rank
#131
Historical Rank

Download Badge
Law Biology
Stephen B. Baylin's Degrees
- PhD Biochemistry Duke University
Why Is Stephen B. Baylin Influential?
(Suggest an Edit or Addition)According to Wikipedia, Stephen Bruce Baylin is the deputy director and associate director for research at the Sidney Kimmel Comprehensive Cancer Center and Virginia and D.K. Ludwig Professor for Cancer Research and medicine and chief of cancer biology of the Johns Hopkins University School of Medicine. His research focus is epigenetics in the development of cancer, and he was one of the first researchers in this field in the 1980s.
Stephen B. Baylin's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Comprehensive molecular portraits of human breast tumors (2012) (7791)
- Integrated Genomic Analyses of Ovarian Carcinoma (2011) (6411)
- Comprehensive molecular characterization of human colon and rectal cancer (2012) (6141)
- Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. (1996) (5875)
- Comprehensive genomic characterization defines human glioblastoma genes and core pathways (2008) (5775)
- The fundamental role of epigenetic events in cancer (2002) (5593)
- Comprehensive molecular characterization of gastric adenocarcinoma (2014) (4496)
- The Epigenomics of Cancer (2007) (4303)
- Comprehensive molecular profiling of lung adenocarcinoma (2014) (4095)
- Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. (2013) (3821)
- Integrated genomic characterization of endometrial carcinoma (2013) (3708)
- Gene silencing in cancer in association with promoter hypermethylation. (2003) (3338)
- Comprehensive genomic characterization of squamous cell lung cancers (2012) (2998)
- Comprehensive genomic characterization of head and neck squamous cell carcinomas (2015) (2860)
- Mutations in the p53 gene occur in diverse human tumour types (1989) (2806)
- The Immune Landscape of Cancer (2018) (2766)
- A decade of exploring the cancer epigenome — biological and translational implications (2011) (2494)
- CpG island methylator phenotype in colorectal cancer. (1999) (2332)
- Comprehensive, Integrative Genomic Analysis of Diffuse Lower-Grade Gliomas. (2015) (2211)
- A gene hypermethylation profile of human cancer. (2001) (2156)
- Genomic Classification of Cutaneous Melanoma (2015) (2143)
- Identification of a CpG island methylator phenotype that defines a distinct subgroup of glioma. (2010) (2121)
- Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. (2000) (2115)
- 5′ CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers (1995) (2108)
- Alterations in DNA methylation: a fundamental aspect of neoplasia. (1998) (2064)
- Integrated Genomic Characterization of Papillary Thyroid Carcinoma (2014) (2007)
- Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. (1998) (2005)
- Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer (1999) (1933)
- Comprehensive molecular characterization of urothelial bladder carcinoma (2014) (1748)
- Comprehensive molecular characterization of clear cell renal cell carcinoma (2013) (1724)
- DNA hypermethylation in tumorigenesis: epigenetics joins genetics. (2000) (1685)
- Oncogenic Signaling Pathways in The Cancer Genome Atlas (2018) (1646)
- Epigenetic gene silencing in cancer – a mechanism for early oncogenic pathway addiction? (2006) (1644)
- Comprehensive and Integrative Genomic Characterization of Hepatocellular Carcinoma (2017) (1514)
- Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. (1995) (1490)
- Molecular Profiling Reveals Biologically Discrete Subsets and Pathways of Progression in Diffuse Glioma (2016) (1474)
- Comprehensive Molecular Characterization of Muscle-Invasive Bladder Cancer (2017) (1446)
- Comprehensive Characterization of Cancer Driver Genes and Mutations (2018) (1360)
- DNMT1 and DNMT3b cooperate to silence genes in human cancer cells (2002) (1259)
- Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon (1994) (1253)
- Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. (1999) (1244)
- Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. (2000) (1188)
- DNA methylation and gene silencing in cancer (2005) (1140)
- A stem cell–like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing (2007) (1100)
- Hedgehog signalling within airway epithelial progenitors and in small-cell lung cancer (2003) (1095)
- Integrated Genomic Characterization of Pancreatic Ductal Adenocarcinoma. (2017) (1092)
- DNMT1 binds HDAC2 and a new co-repressor, DMAP1, to form a complex at replication foci (2000) (1081)
- Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer (2004) (1075)
- Aberrant methylation of p16(INK4a) is an early event in lung cancer and a potential biomarker for early diagnosis. (1998) (1004)
- Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients. (1999) (982)
- Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer. (2001) (939)
- Comprehensive Molecular Characterization of Papillary Renal-Cell Carcinoma. (2016) (931)
- Dysfunctional KEAP1–NRF2 Interaction in Non-Small-Cell Lung Cancer (2006) (931)
- A genomic screen for genes upregulated by demethylation and histone deacetylase inhibition in human colorectal cancer (2002) (877)
- E-cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas. (1995) (876)
- Predicting lung cancer by detecting aberrant promoter methylation in sputum. (2000) (850)
- Distinct patterns of somatic genome alterations in lung adenocarcinomas and squamous cell carcinomas (2016) (826)
- Targeting the cancer epigenome for therapy (2016) (805)
- Integrated genomic and molecular characterization of cervical cancer (2017) (762)
- Inhibiting DNA Methylation Causes an Interferon Response in Cancer via dsRNA Including Endogenous Retroviruses (2015) (750)
- Cancer epigenetics: tumor heterogeneity, plasticity of stem-like states, and drug resistance. (2014) (740)
- Epigenetic Determinants of Cancer. (2016) (690)
- Abrogation of the Rb/p16 tumor-suppressive pathway in virtually all pancreatic carcinomas. (1997) (673)
- Tumor Suppressor HIC1 Directly Regulates SIRT1 to Modulate p53-Dependent DNA-Damage Responses (2005) (658)
- Hypermethylation-associated inactivation indicates a tumor suppressor role for p15INK4B. (1996) (649)
- Aging and DNA methylation in colorectal mucosa and cancer. (1998) (649)
- Evolution of Neoantigen Landscape during Immune Checkpoint Blockade in Non-Small Cell Lung Cancer. (2017) (601)
- Comprehensive and Integrated Genomic Characterization of Adult Soft Tissue Sarcomas (2017) (577)
- Analysis of adenomatous polyposis coli promoter hypermethylation in human cancer. (2000) (574)
- Combination epigenetic therapy has efficacy in patients with refractory advanced non-small cell lung cancer. (2011) (569)
- Hematopoietic stem cells convert into liver cells within days without fusion (2004) (563)
- DNA methylation markers and early recurrence in stage I lung cancer. (2008) (561)
- Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. (1999) (558)
- Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis. (2000) (549)
- Transient low doses of DNA-demethylating agents exert durable antitumor effects on hematological and epithelial tumor cells. (2012) (548)
- Hypermethylation-associated inactivation of p14(ARF) is independent of p16(INK4a) methylation and p53 mutational status. (2000) (523)
- MLH1 promoter hypermethylation is associated with the microsatellite instability phenotype in sporadic endometrial carcinomas (1998) (522)
- Inhibiting DNA Methylation Causes an Interferon Response in Cancer via dsRNA Including Endogenous Retroviruses (2016) (516)
- Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. (1994) (516)
- Identification of differentially methylated sequences in colorectal cancer by methylated CpG island amplification. (1999) (508)
- Pathogenic Germline Variants in 10,389 Adult Cancers (2018) (501)
- Combined DNA methyltransferase and histone deacetylase inhibition in the treatment of myeloid neoplasms. (2006) (490)
- CpG methylation is maintained in human cancer cells lacking DNMT1 (2000) (484)
- Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the major types of hematological malignancies. (1997) (472)
- Comprehensive Analysis of Alternative Splicing Across Tumors from 8,705 Patients (2018) (471)
- Dnmt3a and Dnmt3b Are Transcriptional Repressors That Exhibit Unique Localization Properties to Heterochromatin* (2001) (462)
- DNA methylation patterns in hereditary human cancers mimic sporadic tumorigenesis. (2001) (461)
- Oxidative damage targets complexes containing DNA methyltransferases, SIRT1, and polycomb members to promoter CpG Islands. (2011) (459)
- Notch signaling induces cell cycle arrest in small cell lung cancer cells. (2001) (452)
- p53 activates expression of HIC-1, a new candidate tumour suppressor gene on 17p13.3 (1995) (447)
- Histone modifications and silencing prior to DNA methylation of a tumor suppressor gene. (2003) (436)
- Butyrate Greatly Enhances Derivation of Human Induced Pluripotent Stem Cells by Promoting Epigenetic Remodeling and the Expression of Pluripotency‐Associated Genes (2010) (423)
- The cancer epigenome--components and functional correlates. (2006) (416)
- DNA methylation, chromatin inheritance, and cancer (2001) (411)
- Inhibition of SIRT1 Reactivates Silenced Cancer Genes without Loss of Promoter DNA Hypermethylation (2006) (406)
- Methylation Patterns of the E-cadherin 5′ CpG Island Are Unstable and Reflect the Dynamic, Heterogeneous Loss of E-cadherin Expression during Metastatic Progression* (2000) (399)
- Methylation-associated silencing of the tissue inhibitor of metalloproteinase-3 gene suggest a suppressor role in kidney, brain, and other human cancers. (1999) (397)
- An achaete-scute homologue essential for neuroendocrine differentiation in the lung (1997) (394)
- Inactivation of glutathione S-transferase P1 gene by promoter hypermethylation in human neoplasia. (1998) (388)
- Dependence of histone modifications and gene expression on DNA hypermethylation in cancer. (2002) (379)
- Promoter hypermethylation of multiple genes in sputum precedes lung cancer incidence in a high-risk cohort. (2006) (378)
- Patterns of somatic structural variation in human cancer genomes (2020) (377)
- Double Strand Breaks Can Initiate Gene Silencing and SIRT1-Dependent Onset of DNA Methylation in an Exogenous Promoter CpG Island (2008) (361)
- Comparing the DNA Hypermethylome with Gene Mutations in Human Colorectal Cancer (2007) (358)
- Ornithine decarboxylase is important in intestinal mucosal maturation and recovery from injury in rats. (1980) (354)
- Establishment of continuous, clonable cultures of small-cell carcinoma of lung which have amine precursor uptake and decarboxylation cell properties. (1980) (351)
- Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis. (2001) (349)
- Mapping Patterns of CpG Island Methylation in Normal and Neoplastic Cells Implicates Both Upstream and Downstream Regions inde Novo Methylation* (1997) (347)
- Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies. (1999) (346)
- In situ detection of the hypermethylation-induced inactivation of the p16 gene as an early event in oncogenesis. (1999) (345)
- Immune regulation by low doses of the DNA methyltransferase inhibitor 5-azacitidine in common human epithelial cancers (2014) (344)
- Alterations of immune response of non-small cell lung cancer with Azacytidine (2013) (335)
- Demethylation of the estrogen receptor gene in estrogen receptor-negative breast cancer cells can reactivate estrogen receptor gene expression. (1995) (328)
- Increased cytosine DNA-methyltransferase activity during colon cancer progression. (1993) (326)
- Association between CpG island methylation and microsatellite instability in colorectal cancer. (1997) (324)
- Effects of dietary folate and alcohol intake on promoter methylation in sporadic colorectal cancer: the Netherlands cohort study on diet and cancer. (2003) (321)
- hMLH1 promoter hypermethylation is an early event in human endometrial tumorigenesis. (1999) (315)
- De novo methylation of CpG island sequences in human fibroblasts overexpressing DNA (cytosine-5-)-methyltransferase (1996) (314)
- High expression of the DNA methyltransferase gene characterizes human neoplastic cells and progression stages of colon cancer. (1991) (313)
- Transcriptional silencing of the p73 gene in acute lymphoblastic leukemia and Burkitt's lymphoma is associated with 5' CpG island methylation. (1999) (308)
- Familial medullary thyroid carcinoma without associated endocrinopathies: A distinct clinical entity (1986) (307)
- Hypermethylation of the DNA repair gene O(6)-methylguanine DNA methyltransferase and survival of patients with diffuse large B-cell lymphoma. (2002) (305)
- Conservation of the Drosophila lateral inhibition pathway in human lung cancer: a hairy-related protein (HES-1) directly represses achaete-scute homolog-1 expression. (1997) (301)
- Epigenetic Therapy Ties MYC Depletion to Reversing Immune Evasion and Treating Lung Cancer (2017) (296)
- The future of epigenetic therapy in solid tumours—lessons from the past (2013) (295)
- Silenced tumor suppressor genes reactivated by DNA demethylation do not return to a fully euchromatic chromatin state. (2006) (294)
- Short double-stranded RNA induces transcriptional gene silencing in human cancer cells in the absence of DNA methylation (2005) (292)
- Hypermethylation can selectively silence individual p16ink4A alleles in neoplasia. (1998) (291)
- Inhibition of DNA methylation and histone deacetylation prevents murine lung cancer. (2003) (286)
- Altered methylation patterns in cancer cell genomes: cause or consequence? (2002) (283)
- Methylation of estrogen and progesterone receptor gene 5' CpG islands correlates with lack of estrogen and progesterone receptor gene expression in breast tumors. (1996) (280)
- Inhibition of lysine-specific demethylase 1 by polyamine analogues results in reexpression of aberrantly silenced genes (2007) (280)
- Cancer epigenetics: linking basic biology to clinical medicine (2011) (270)
- Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells. (1993) (270)
- Gene amplification of c-myc and N-myc in small cell carcinoma of the lung. (1986) (269)
- Epigenetic Therapeutics: A New Weapon in the War Against Cancer. (2016) (264)
- Switch from monoallelic to biallelic human IGF2 promoter methylation during aging and carcinogenesis. (1996) (263)
- Hypomethylation of pericentromeric DNA in breast adenocarcinomas (1998) (263)
- Breast Cancer Methylomes Establish an Epigenomic Foundation for Metastasis (2011) (260)
- GATA-4 and GATA-5 Transcription Factor Genes and Potential Downstream Antitumor Target Genes Are Epigenetically Silenced in Colorectal and Gastric Cancer (2003) (258)
- Increased cytosine DNA-methyltransferase activity is target-cell-specific and an early event in lung cancer. (1996) (258)
- Isolation and characterization of the cDNA encoding human DNA methyltransferase. (1992) (258)
- Methylation of p16(INK4a) promoters occurs in vivo in histologically normal human mammary epithelia. (2003) (247)
- Ornithine decarboxylase as a biologic marker in familial colonic polyposis. (1984) (246)
- p15(INK4B) CpG island methylation in primary acute leukemia is heterogeneous and suggests density as a critical factor for transcriptional silencing. (1999) (243)
- Frequent epigenetic inactivation of Wnt antagonist genes in breast cancer (2008) (236)
- A DNA hypermethylation module for the stem/progenitor cell signature of cancer (2011) (235)
- Abnormal patterns of DNA methylation in human neoplasia: potential consequences for tumor progression. (1991) (233)
- Frequent microsatellite instability in primary small cell lung cancer. (1994) (232)
- The fundamental role of epigenetics in hematopoietic malignancies. (2006) (231)
- Sensitive and specific monoclonal antibody recognition of human lung cancer antigen on preserved sputum cells: a new approach to early lung cancer detection. (1988) (229)
- Combining Epigenetic and Immunotherapy to Combat Cancer. (2016) (226)
- Prognostic importance of promoter hypermethylation of multiple genes in esophageal adenocarcinoma. (2003) (225)
- DNA methylation patterns of the calcitonin gene in human lung cancers and lymphomas. (1986) (224)
- De novo CpG island methylation in human cancer cells. (2006) (220)
- Methylation of TFPI2 in stool DNA: a potential novel biomarker for the detection of colorectal cancer. (2009) (212)
- Heterozygous disruption of Hic1 predisposes mice to a gender-dependent spectrum of malignant tumors (2003) (210)
- Diamine oxidase (histaminase). A circulating marker for rat intestinal mucosal maturation and integrity. (1980) (206)
- Provocative Agents and the Diagnosis of Medullary Carcinoma of the Thyroid Gland (1978) (205)
- PcG Proteins, DNA Methylation, and Gene Repression by Chromatin Looping (2008) (205)
- Tying It All Together: Epigenetics, Genetics, Cell Cycle, and Cancer (1997) (204)
- Moving AHEAD with an international human epigenome project (2008) (202)
- hTERT is expressed in cancer cell lines despite promoter DNA methylation by preservation of unmethylated DNA and active chromatin around the transcription start site. (2007) (200)
- Comprehensive molecular characterization of mitochondrial genomes in human cancers (2017) (197)
- Management of Pheochromocytomas in Patients with Multiple Endocrine Neoplasia Type 2 Syndromes (1993) (197)
- The short arm of chromosome 11 is a "hot spot" for hypermethylation in human neoplasia. (1988) (197)
- Novel Oligoamine Analogues Inhibit Lysine-Specific Demethylase 1 and Induce Reexpression of Epigenetically Silenced Genes (2009) (196)
- Epigenetic inactivation of LKB1 in primary tumors associated with the Peutz-Jeghers syndrome (2000) (194)
- The emerging role of epigenetic therapeutics in immuno-oncology (2019) (193)
- Polyamines differentially modulate the transcription of growth-associated genes in human colon carcinoma cells. (1989) (193)
- Changes in morphologic and biochemical characteristics of small cell carcinoma of the lung. A clinicopathologic study. (1979) (192)
- Pan-Cancer Analysis of lncRNA Regulation Supports Their Targeting of Cancer Genes in Each Tumor Context (2018) (188)
- Deletional, mutational, and methylation analyses of CDKN2 (p16/MTS1) in primary and metastatic prostate cancer (1997) (182)
- Methylation-specific PCR simplifies imprinting analysis. (1997) (182)
- Variable content of histaminase, L-dopa decarboxylase and calcitonin in small-cell carcinoma of the lung. Biologic and clinical implications. (1978) (181)
- GATA4 and GATA5 are Potential Tumor Suppressors and Biomarkers in Colorectal Cancer (2009) (180)
- Identification of a human achaete-scute homolog highly expressed in neuroendocrine tumors. (1993) (180)
- Epigenetic inactivation of the canonical Wnt antagonist SRY-box containing gene 17 in colorectal cancer. (2008) (177)
- Methylation of the estrogen receptor CpG island in lung tumors is related to the specific type of carcinogen exposure. (1996) (177)
- Promoter-region hypermethylation and gene silencing in human cancer. (2000) (175)
- Tumor-specific down-regulation of the tumor necrosis factor-related apoptosis-inducing ligand decoy receptors DcR1 and DcR2 is associated with dense promoter hypermethylation. (2002) (175)
- Ectopic (inappropriate) hormone production by tumors: mechanisms involved and the biological and clinical implications. (1980) (175)
- Epigenetic therapy activates type I interferon signaling in murine ovarian cancer to reduce immunosuppression and tumor burden (2017) (173)
- Early Detection of Lung Cancer Using DNA Promoter Hypermethylation in Plasma and Sputum (2016) (173)
- Expression of CD44 in human lung tumors. (1994) (172)
- Epigenetic and genetic loss of Hic1 function accentuates the role of p53 in tumorigenesis. (2004) (170)
- Promoter Hypermethylation of Resected Bronchial Margins (2004) (169)
- The estrogen receptor CpG island is methylated in most hematopoietic neoplasms. (1996) (169)
- Distinct patterns of E-cadherin CpG island methylation in papillary, follicular, Hurthle's cell, and poorly differentiated human thyroid carcinoma. (1998) (166)
- DNA methylation changes in hematologic malignancies: biologic and clinical implications. (1997) (165)
- Surgical resection of limited disease small cell lung cancer in the new era of platinum chemotherapy: Its time has come. (2005) (163)
- Infection with Human Immunodeficiency Virus Type 1 Upregulates DNA Methyltransferase, Resulting in De Novo Methylation of the Gamma Interferon (IFN-γ) Promoter and Subsequent Downregulation of IFN-γ Production (1998) (162)
- Abnormal DNA methylation of CD133 in colorectal and glioblastoma tumors. (2008) (161)
- Distinct hypermethylation patterns occur at altered chromosome loci in human lung and colon cancer. (1992) (161)
- Epigenetic therapy inhibits metastases by disrupting premetastatic niches (2020) (160)
- Methylation of the HIC-1 candidate tumor suppressor gene in human breast cancer (1998) (159)
- Mutation affecting the 12th amino acid of the c-Ha-ras oncogene product occurs infrequently in human cancer. (1983) (159)
- Mechanisms of inactivation of E-cadherin in breast cancer cell lines. (1998) (158)
- Frequent aberrant methylation of p16INK4a in primary rat lung tumors (1997) (158)
- Hypermethylation-associated Inactivation of the Cellular Retinol-Binding-Protein 1 Gene in Human Cancer. (2002) (157)
- Inactivation of CACNA1G, a T-type calcium channel gene, by aberrant methylation of its 5' CpG island in human tumors. (1999) (157)
- E-cadherin expression is silenced by 5' CpG island methylation in acute leukemia. (2000) (156)
- Role of Estrogen Receptor Gene Demethylation and DNA Methyltransferase·DNA Adduct Formation in 5-Aza-2′deoxycytidine-induced Cytotoxicity In Human Breast Cancer Cells* (1997) (155)
- Relationship of tissue carcinoembryonic antigen and calcitonin to tumor virulence in medullary thyroid carcinoma. An immunohistochemical study in early, localized, and virulent disseminated stages of disease (1984) (153)
- Deletions of chromosome 8p and loss of sFRP1 expression are progression markers of papillary bladder cancer (2004) (152)
- Vitamin C increases viral mimicry induced by 5-aza-2′-deoxycytidine (2016) (151)
- Convergence of Mutation and Epigenetic Alterations Identifies Common Genes in Cancer That Predict for Poor Prognosis (2008) (150)
- Phase I trial and pharmacokinetic studies of alpha-difluoromethylornithine--an inhibitor of polyamine biosynthesis. (1984) (148)
- Levels of creatine kinase and its BB isoenzyme in lung cancer specimens and cultures. (1981) (148)
- Targeting CDK9 Reactivates Epigenetically Silenced Genes in Cancer (2018) (145)
- Absence of E-Cadherin Expression Distinguishes Noncohesive from Cohesive Pancreatic Cancer (2008) (144)
- Genomic and Epigenomic Integration Identifies a Prognostic Signature in Colon Cancer (2011) (143)
- Prognostic value of CpG island methylator phenotype among colorectal cancer patients: a systematic review and meta-analysis. (2014) (143)
- Roles of trk family neurotrophin receptors in medullary thyroid carcinoma development and progression. (1999) (142)
- Hypermethylation of the GATA Genes in Lung Cancer (2004) (142)
- p14ARF silencing by promoter hypermethylation mediates abnormal intracellular localization of MDM2. (2001) (140)
- RREB-1, a novel zinc finger protein, is involved in the differentiation response to Ras in human medullary thyroid carcinomas (1996) (140)
- A novel 6C assay uncovers Polycomb-mediated higher order chromatin conformations. (2008) (140)
- Chronic Cigarette Smoke-Induced Epigenomic Changes Precede Sensitization of Bronchial Epithelial Cells to Single-Step Transformation by KRAS Mutations. (2017) (139)
- 5-azacytidine reduces methylation, promotes differentiation and induces tumor regression in a patient-derived IDH1 mutant glioma xenograft (2013) (139)
- Activated Raf-1 causes growth arrest in human small cell lung cancer cells. (1998) (137)
- Aberrant methylation of gene promoters in cancer---concepts, misconcepts, and promise. (2000) (136)
- Activities of L-dopa decarboxylase and diamine oxidase (histaminase) in human lung cancers and decarboxylase as a marker for small (oat) cell cancer in cell culture. (1980) (133)
- Delayed Diagnosis and Elevated Mortality in an Urban Population With HIV and Lung Cancer: Implications for Patient Care (2006) (133)
- Mice deficient in the candidate tumor suppressor gene Hic1 exhibit developmental defects of structures affected in the Miller-Dieker syndrome. (2000) (132)
- MS-qFRET: a quantum dot-based method for analysis of DNA methylation. (2009) (131)
- Epigenetic alteration of Wnt pathway antagonists in progressive glandular neoplasia of the lung. (2008) (130)
- Polyamines are necessary for the survival of human small-cell lung carcinoma in culture. (1981) (129)
- Methylation-specif ic PCR simplifies imprinting analysis (1997) (128)
- HIC1 hypermethylation is a late event in hematopoietic neoplasms. (1997) (127)
- Harnessing the potential of epigenetic therapy to target solid tumors. (2014) (126)
- Enhancing the Cytotoxic Effects of PARP Inhibitors with DNA Demethylating Agents - A Potential Therapy for Cancer. (2016) (124)
- Consistent association of 1p loss of heterozygosity with pheochromocytomas from patients with multiple endocrine neoplasia type 2 syndromes. (1992) (124)
- Defining a chromatin pattern that characterizes DNA-hypermethylated genes in colon cancer cells. (2008) (123)
- Association of diamine oxidase and ornithine decarboxylase with maturing cells in rapidly proliferating epithelium. (1978) (123)
- Expression of the c-myb oncogene in human small cell lung carcinoma. (1985) (121)
- Stress and the epigenetic landscape: a link to the pathobiology of human diseases? (2010) (121)
- Medullary Thyroid Carcinoma: Relationship of Method of Diagnosis to Pathologic Staging (1978) (121)
- Constitutive achaete-scute homologue-1 promotes airway dysplasia and lung neuroendocrine tumors in transgenic mice. (2000) (120)
- Novel Methylation Biomarker Panel for the Early Detection of Pancreatic Cancer (2013) (120)
- Elevated histaminase activity in medullary carcinoma of the thyroid gland. (1970) (119)
- Cooperation between the Hic1 and Ptch1 tumor suppressors in medulloblastoma. (2008) (117)
- Treatment of advanced medullary thyroid carcinoma with a combination of cyclophosphamide, vincristine, and dacarbazine (1994) (117)
- Homozygous deletion on chromosome 9p and loss of heterozygosity on 9q, 6p, and 6q in primary human small cell lung cancer. (1994) (117)
- Introduction of v-Ha-ras oncogene induces differentiation of cultured human medullary thyroid carcinoma cells. (1987) (116)
- Promoter methylation of genes in and around the candidate lung cancer susceptibility locus 6q23-25. (2008) (116)
- DNA methylation and complete transcriptional silencing of cancer genes persist after depletion of EZH2. (2007) (116)
- CHD4 Has Oncogenic Functions in Initiating and Maintaining Epigenetic Suppression of Multiple Tumor Suppressor Genes. (2017) (112)
- Multimodal genomic features predict outcome of immune checkpoint blockade in non-small-cell lung cancer (2020) (111)
- The NuRD complex cooperates with DNMTs to maintain silencing of key colorectal tumor suppressor genes (2014) (110)
- Polyamines and intestinal growth--increased polyamine biosynthesis after jejunectomy. (1983) (109)
- Hypermethylation of the 5' region of the calcitonin gene is a property of human lymphoid and acute myeloid malignancies. (1987) (109)
- Ornithine decarboxylase: essential in proliferation but not differentiation of human promyelocytic leukemia cells. (1982) (108)
- The Methyl-CpG Binding Protein MBD1 Interacts with the p150 Subunit of Chromatin Assembly Factor 1 (2003) (108)
- DNMT1 modulates gene expression without its catalytic activity partially through its interactions with histone-modifying enzymes (2012) (107)
- Stem Cell Chromatin Patterns: An Instructive Mechanism for DNA Hypermethylation? (2007) (107)
- New 5′ Regions of the Murine and Human Genes for DNA (Cytosine-5)-methyltransferase* (1996) (107)
- Inhibiting DNA Methylation Causes an Interferon Response in Cancer via dsRNA Including Endogenous Retroviruses (2017) (106)
- Acetylation Enhances TET2 Function in Protecting against Abnormal DNA Methylation during Oxidative Stress. (2017) (103)
- Polycomb CBX7 promotes initiation of heritable repression of genes frequently silenced with cancer-specific DNA hypermethylation. (2009) (103)
- Regional DNA hypermethylation at D17S5 precedes 17p structural changes in the progression of renal tumors. (1993) (101)
- Hedgehog Signaling: Progenitor Phenotype in Small-Cell Lung Cancer (2003) (101)
- Combination Epigenetic Therapy in Advanced Breast Cancer with 5-Azacitidine and Entinostat: A Phase II National Cancer Institute/Stand Up to Cancer Study (2016) (99)
- Plasma postheparin diamine oxidase. Sensitive provocative test for quantitating length of acute intestinal mucosal injury in the rat. (1983) (99)
- Mechanisms underlying epigenetically mediated gene silencing in cancer. (2002) (96)
- Histaminase activity: a biochemical marker for medullary carcinoma of the thyroid. (1972) (96)
- Early diagnosis and treatment of medullary thyroid carcinoma. (1985) (95)
- Defining a Gene Promoter Methylation Signature in Sputum for Lung Cancer Risk Assessment (2012) (94)
- Hypermethylation of ASC/TMS1 is a sputum marker for late-stage lung cancer. (2006) (94)
- The prognostic and biological significance of cellular heterogeneity in medullary thyroid carcinoma: a study of calcitonin, L-dopa decarboxylase, and histaminase. (1982) (93)
- Structure and expression of a gene encoding human calcitonin and calcitonin gene related peptide. (1984) (93)
- CpG island hypermethylation is maintained in human colorectal cancer cells after RNAi-mediated depletion of DNMT1 (2004) (92)
- Vasoactive intestinal peptide and its relationship to ganglion cell differentiation in neuroblastic tumors. (1979) (91)
- Epigenetic Regulation of WNT Signaling Pathway Genes in Inflammatory Bowel Disease (IBD) Associated Neoplasia (2008) (91)
- Angiostatic activity of DNA methyltransferase inhibitors (2006) (90)
- Inhibition of intestinal epithelial DNA synthesis and adaptive hyperplasia after jejunectomy in the rat by suppression of polyamine biosynthesis. (1984) (89)
- Effective long-term palliation of symptomatic, incurable metastatic medullary thyroid cancer by operative resection. (1998) (89)
- Linking cell signaling and the epigenetic machinery (2010) (88)
- Erratum: Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles (Cell Reports (2017) 18(11) (2780–2794) (S2211124717302140) (10.1016/j.celrep.2017.02.033)) (2017) (88)
- Frequent epigenetic silencing of the bone morphogenetic protein 2 gene through methylation in gastric carcinomas (2006) (88)
- Clonal analysis of insulin and somatostatin secretion and L-dopa decarboxylase expression by a rat islet cell tumor. (1983) (87)
- p21WAF1/CIP1 induction by 5-azacytosine nucleosides requires DNA damage (2008) (87)
- RET proto-oncogene mutations in inherited and sporadic medullary thyroid cancer. (1994) (86)
- Phase II trials of alpha-difluoromethylornithine, an inhibitor of polyamine synthesis, in advanced small cell lung cancer and colon cancer. (1986) (86)
- Effect of polyamine depletion on c-myc expression in human colon carcinoma cells. (1988) (85)
- Aging-like Spontaneous Epigenetic Silencing Facilitates Wnt Activation, Stemness, and BrafV600E-Induced Tumorigenesis. (2019) (84)
- Localization of histamine (diamine oxidase) in rat small intestinal mucosa: site of release by heparin. (1977) (84)
- An Effective Epigenetic-PARP Inhibitor Combination Therapy for Breast and Ovarian Cancers Independent of BRCA Mutations (2018) (84)
- Clonal origin of inherited medullary thyroid carcinoma and pheochromocytoma. (1976) (83)
- DNA hypermethylation is associated with 17p allelic loss in neural tumors. (1993) (83)
- Concordant methylation of the ER and N33 genes in glioblastoma multiforme (1998) (81)
- Abnormal methylation of the calcitonin gene in human colonic neoplasms. (1989) (81)
- Cyclic AMP and phorbol esters separately induce growth inhibition, calcitonin secretion, and calcitonin gene transcription in cultured human medullary thyroid carcinoma. (1986) (81)
- Tumor cell heterogeneity : origins and implications (1982) (81)
- Abnormal methylation of the calcitonin gene marks progression of chronic myelogenous leukemia. (1991) (79)
- Stabilization of DNA methyltransferase levels and CpG island hypermethylation precede SV40-induced immortalization of human fibroblasts. (1994) (79)
- Targeting Calcium Signaling Induces Epigenetic Reactivation of Tumor Suppressor Genes in Cancer. (2016) (78)
- Functional DNA demethylation is accompanied by chromatin accessibility (2013) (78)
- Hypermethylation of a Small CpGuanine-Rich Region Correlates with Loss of Activator Protein-2α Expression during Progression of Breast Cancer (2004) (77)
- Aberrant Promoter Methylation of the Transcription Factor Genes PAX5 α and β in Human Cancers (2003) (77)
- Anaplastic variants of medullary thyroid carcinoma: A light‐microscopic and immunohistochemical study (1980) (76)
- Targeting epigenetic regulators for cancer therapy (2014) (76)
- Differential requirement for DNA methyltransferase 1 in maintaining human cancer cell gene promoter hypermethylation. (2006) (74)
- v-Ha-ras oncogene insertion: a model for tumor progression of human small cell lung cancer. (1988) (74)
- Cancer-related epigenome changes associated with reprogramming to induced pluripotent stem cells. (2010) (73)
- Concomitant promoter methylation of multiple genes in lung adenocarcinomas from current, former and never smokers. (2009) (73)
- Hypermethylation of the GATA gene family in esophageal cancer (2006) (72)
- Differential response to treatment with the bis(ethyl)polyamine analogues between human small cell lung carcinoma and undifferentiated large cell lung carcinoma in culture. (1989) (72)
- DNA Methylation Patterns Separate Senescence from Transformation Potential and Indicate Cancer Risk. (2018) (71)
- Inherited medullary thyroid carcinoma: a final monoclonal mutation in one of multiple clones of susceptible cells. (1978) (70)
- Phorbol esters increase calcitonin gene transcription and decrease c-myc mRNA levels in cultured human medullary thyroid carcinoma. (1985) (70)
- Elevated histaminase (diamine oxidase) activity in small-cell carcinoma of the lung. (1975) (68)
- Inhibiting DNA methylation activates cancer testis antigens and expression of the antigen processing and presentation machinery in colon and ovarian cancer cells (2017) (67)
- Human induced pluripotent cells resemble embryonic stem cells demonstrating enhanced levels of DNA repair and efficacy of nonhomologous end-joining. (2011) (67)
- Mismatch repair proteins recruit DNA methyltransferase 1 to sites of oxidative DNA damage. (2016) (67)
- Watery diarrhea syndrome in an adult with ganglioneuroma‐pheochromocytoma. Identification of vasoactive intestinal peptide, calcitonin, and catecholamines and assessment of their biologic activity (1977) (67)
- A bird's eye view of global methylation (2000) (66)
- 6 – Inhibitors of Polyamine Biosynthesis: Cellular and in Vivo Effects on Tumor Proliferation (1987) (66)
- Low incidence of loss of chromosome 10 in sporadic and hereditary human medullary thyroid carcinoma. (1989) (66)
- Combination therapy with vidaza and entinostat suppresses tumor growth and reprograms the epigenome in an orthotopic lung cancer model. (2011) (66)
- Aberrant gene silencing in tumor progression: implications for control of cancer. (2005) (66)
- Defining UHRF1 Domains that Support Maintenance of Human Colon Cancer DNA Methylation and Oncogenic Properties. (2019) (66)
- Inhibitors of DNA Methylation, Histone Deacetylation, and Histone Demethylation: A Perfect Combination for Cancer Therapy. (2016) (64)
- Tankyrase inhibition promotes a stable human naïve pluripotent state with improved functionality (2016) (64)
- Expression and function of Trk-C in favourable human neuroblastomas. (1997) (63)
- Resistance, epigenetics and the cancer ecosystem (2011) (63)
- Dual Inhibition of DNA and Histone Methyltransferases Increases Viral Mimicry in Ovarian Cancer Cells. (2018) (63)
- Tissue-specific expression of human achaete-scute homologue-1 in neuroendocrine tumors: transcriptional regulation by dual inhibitory regions. (1997) (62)
- Aberrant promoter methylation of the transcription factor genes PAX5 alpha and beta in human cancers. (2003) (62)
- Functional Identification of Cancer-Specific Methylation of CDO1, HOXA9, and TAC1 for the Diagnosis of Lung Cancer (2014) (61)
- Combination epigenetic therapy in metastatic colorectal cancer (mCRC) with subcutaneous 5-azacitidine and entinostat: a phase 2 consortium/stand Up 2 cancer study (2017) (61)
- Biomarkers for detection and prognosis of breast cancer identified by a functional hypermethylome screen (2012) (60)
- Cigarette smoke induces epithelial to mesenchymal transition and increases the metastatic ability of breast cancer cells (2013) (59)
- Human medullary thyroid carcinoma in culture provides a model relating growth dynamics, endocrine cell differentiation, and tumor progression. (1984) (59)
- Frequent Inactivation of Cysteine Dioxygenase Type 1 Contributes to Survival of Breast Cancer Cells and Resistance to Anthracyclines (2013) (59)
- Integrated Genomic, Epigenomic, and Expression Analyses of Ovarian Cancer Cell Lines (2018) (58)
- Molecular markers of neuroendocrine development and evidence of environmental regulation. (1987) (58)
- A requirement for DICER to maintain full promoter CpG island hypermethylation in human cancer cells. (2008) (58)
- Enzymatic regional methylation assay: a novel method to quantify regional CpG methylation density. (2002) (56)
- Endocrine-related biochemistry in the spectrum of human lung carcinoma. (1981) (56)
- Serum histaminase and calcitonin levels in medullary carcinoma of the thyroid. (1972) (55)
- Successful treatment with DL-alpha-difluoromethylornithine in established human small cell variant lung carcinoma implants in athymic mice. (1983) (54)
- Polyamines and intestinal growth: absolute requirement for ODC activity in adaptation during lactation. (1984) (54)
- The cancer epigenome: its origins, contributions to tumorigenesis, and translational implications. (2012) (54)
- Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells. (2017) (54)
- Management of small cell carcinoma of the lung. Therapy, staging, and biochemical markers (1976) (53)
- Discovery of a first-in-class reversible DNMT1-selective inhibitor with improved tolerability and efficacy in acute myeloid leukemia (2021) (53)
- Sequence-specific DNA Binding Activity of RNA Helicase A to thep16INK4a Promoter* (2001) (53)
- Transitions between lung cancer phenotypes--implications for tumor progression. (1991) (53)
- Heterochromatin: stable and unstable invasions at home and abroad. (2003) (52)
- Epigenetic therapy for solid tumors: from bench science to clinical trials. (2015) (52)
- Calcitonin and histaminase in C-cell hyperplasia and medullary thyroid carcinoma. A light microscopic and immunohistochemical study. (1978) (52)
- Analysis of cell surface proteins delineates a differentiation pathway linking endocrine and nonendocrine human lung cancers. (1983) (52)
- Hypermethylation of chromosome 17P locus D17S5 in human prostate tissue. (1996) (52)
- Sessile serrated adenomas and classical adenomas: An epigenetic perspective on premalignant neoplastic lesions of the gastrointestinal tract (2011) (51)
- Characterization of a peptide alpha-amidation activity in human plasma and tissues. (1985) (51)
- Relationships between neuroendocrine differentiation and sensitivity to gamma-radiation in culture line OH-1 of human small cell lung carcinoma. (1982) (51)
- v-rasH induces non-small cell phenotype, with associated growth factors and receptors, in a small cell lung cancer cell line. (1990) (51)
- DNA methyltransferase inhibitors induce a BRCAness phenotype that sensitizes NSCLC to PARP inhibitor and ionizing radiation (2019) (51)
- Ret gene silencing is associated with Raf-1-induced medullary thyroid carcinoma cell differentiation. (1995) (50)
- Growth-inhibitory effects of DL-alpha-difluoromethylornithine in the spectrum of human lung carcinoma cells in culture. (1982) (50)
- Methylation of p 16 INK 4 a Promoters Occurs in Vivo in Histologically Normal Human Mammary Epithelia 1 (2003) (50)
- Methylation of the Claudin 1 Promoter Is Associated with Loss of Expression in Estrogen Receptor Positive Breast Cancer (2013) (50)
- DFMO and 5-azacytidine increase M1 macrophages in the tumor microenvironment of murine ovarian cancer. (2019) (48)
- Insertion of the v-Ha-ras oncogene induces differentiation of calcitonin-producing human small cell lung cancer. (1989) (48)
- Differentiation of medullary thyroid cancer by C-Raf-1 silences expression of the neural transcription factor human achaete-scute homolog-1. (1996) (48)
- Binding of diamine oxidase activity to rat and guinea pig microvascular endothelial cells. Comparisons with lipoprotein lipase binding. (1985) (48)
- Single-tube analysis of DNA methylation with silica superparamagnetic beads. (2010) (47)
- Promoter hypermethylation--can this change alone ever designate true tumor suppressor gene function? (2001) (47)
- Erratum: Inhibiting DNA Methylation Causes an Interferon Response in Cancer via dsRNA Including Endogenous Retroviruses (Cell (2015) 162(5) (974–986) (S009286741500848X) (10.1016/j.cell.2015.07.011)) (2017) (46)
- Genomic biology: The epigenomic era opens (2007) (46)
- DNA methylation analysis on a droplet-in-oil PCR array. (2009) (46)
- The molecular biology of medullary thyroid carcinoma. A model for cancer development and progression. (1989) (46)
- Can we improve the cytologic examination of malignant pleural effusions using molecular analysis? (2005) (45)
- Diamine oxidase as a plasma marker of rat intestinal mucosal injury and regeneration after administration of 1-beta-D-arabinofuranosylcytosine. (1981) (45)
- CpG Island Methylator Phenotype–Positive Tumors in the Absence of MLH1 Methylation Constitute a Distinct Subset of Duodenal Adenocarcinomas and Are Associated with Poor Prognosis (2012) (45)
- Plasma immunoreactive calcitonin in lung cancer. (1980) (45)
- Response of plasma histaminase activity to small doses of heparin in normal subjects and patients with hyperlipoproteinemia. (1973) (44)
- Cancer as a manifestation of aberrant chromatin structure. (2007) (43)
- A unique cell-surface protein phenotype distinguishes human small-cell from non-small-cell lung cancer. (1982) (43)
- Characterization of an endogenous RNA transcript with homology to the antisense strand of the human c-myc gene. (1992) (43)
- Transcriptional regulation of Wnt inhibitory factor-1 by Miz-1/c-Myc (2010) (43)
- Discordance between plasma calcitonin and tumor-cell mass in medullary thyroid carcinoma. (1979) (43)
- The human calcitonin gene is located on the short arm of chromosome 11. (1984) (42)
- A potential tumor suppressor role for Hic1 in breast cancer through transcriptional repression of ephrin-A1 (2010) (42)
- Methylation of TFPI 2 in Stool DNA : A Potential Novel Biomarker for the Detection of Colorectal Cancer (2009) (42)
- Cytoskeleton-associated proteins of human lung cancer cells. (1983) (42)
- Protein kinase C-beta 2 inhibits cycling and decreases c-myc-induced apoptosis in small cell lung cancer cells. (1997) (42)
- Extraction and processing of circulating DNA from large sample volumes using methylation on beads for the detection of rare epigenetic events. (2013) (41)
- Sex differences in oncogenic mutational processes (2019) (41)
- Molecular cloning of the cDNA for human TrkC (NTRK3), chromosomal assignment, and evidence for a splice variant. (1994) (40)
- Distribution of beta-endorphin immunoreactivity in normal human pituitary. (1979) (39)
- Medullary carcinoma of the thyroid in the multiple endocrine neoplasia IIA syndrome (1981) (39)
- DNA methylation and epigenetic mechanisms of carcinogenesis. (2001) (39)
- Inactivation of the tissue inhibitor of metalloproteinases-2 gene by promoter hypermethylation in lymphoid malignancies (2005) (38)
- Cytotoxic response of the relatively difluoromethylornithine-resistant human lung tumor cell line NCI H157 to the polyamine analogue N1,N8-bis(ethyl)spermidine. (1987) (36)
- Effects of dibutyryl cyclic adenosine 3':5'-monophosphate on the growth of cultured human small-cell lung carcinoma and the specific cellular activity of L-dopa decarboxylase. (1983) (36)
- Mammalian DNA Methyltransferase 1: Inspiration for New Directions (2004) (36)
- Reversal of gene silencing as a therapeutic target for cancer--roles for DNA methylation and its interdigitation with chromatin. (2004) (35)
- Epigenetic biomarkers. (2012) (35)
- The multiple endocrine neoplasia syndromes: implications for the study of inherited tumors. (1978) (34)
- Transcriptional and posttranscriptional modulation of calcitonin gene expression by sodium n-butyrate in cultured human medullary thyroid carcinoma. (1988) (34)
- A Phase I Trial of a Guadecitabine (SGI-110) and Irinotecan in Metastatic Colorectal Cancer Patients Previously Exposed to Irinotecan (2018) (34)
- Combined Methyltransferase/Histone Deacetylase Inhibition with 5-Azacitidine and MS-275 in Patients with MDS, CMMoL and AML: Clinical Response, Histone Acetylation and DNA Damage. (2006) (34)
- Methylation-specific PCR. (2001) (33)
- Aberrant silencing of cancer-related genes by CpG hypermethylation occurs independently of their spatial organization in the nucleus. (2010) (33)
- In vitro and in vivo growth characteristics of two different cell populations in an established line of human neuroblastoma. (1983) (33)
- Ectopic adrenocorticotrophic (ACTH) syndrome and small cell carcinoma of the lung—assessment of clinical implications in patients on combination chemotherapy (1981) (33)
- Medullary carcinoma of the thyroid gland: use of biochemical parameters in detection and surgical management of the tumor. (1974) (32)
- Changes in plasma histaminase activity during normal early human pregnancy and pregnancy disorders. (1975) (32)
- Genome-wide unmasking of epigenetically silenced genes in lung adenocarcinoma from smokers and never smokers. (2014) (32)
- Medullary thyroid carcinomas secrete a noncalcitonin peptide corresponding to the carboxyl-terminal region of preprocalcitonin. (1983) (32)
- Unraveling the molecular pathways of DNA-methylation inhibitors: human endogenous retroviruses induce the innate immune response in tumors (2016) (32)
- Epigenetic silencing of neurofilament genes promotes an aggressive phenotype in breast cancer (2015) (32)
- Human calcitonin gene regulation by helix-loop-helix recognition sequences (1992) (32)
- Enzymatic Incorporation of Multiple Dyes for Increased Sensitivity in QD‐FRET Sensing for DNA Methylation Detection (2009) (32)
- Altered chromosomal methylation patterns accompany oncogene-induced transformation of human bronchial epithelial cells. (1993) (31)
- Advances in Brief Inactivation of the DNA Repair Gene O 6-Methylguanine-DNA Methyltransferase by Promoter Hypermethylation is a Common Event in Primary Human Neoplasia 1 (1999) (31)
- Post-transcriptional silencing of RET occurs, but is not required, during raf-1 mediated differentiation of medullary thyroid carcinoma cells (1998) (31)
- Use of radiolabeled monofluoromethyl-Dopa to define the subunit structure of human L-Dopa decarboxylase. (1983) (31)
- Polyamine biosynthesis is required for the maintenance of peripheral blood cell elements in the rat. (1983) (30)
- The second human calcitonin/CGRP gene is located on chromosome 11 (2004) (30)
- Thyroid Venous Catheterization in the Early Diagnosis of Familial Medullary Thyroid Carcinoma (1982) (29)
- Methylation-induced silencing of ASC/TMS1, a pro-apoptotic gene, is a late-stage event in colorectal cancer (2007) (29)
- CIMPle origin for promoter hypermethylation in colorectal cancer? (2006) (29)
- Immunohistochemical localization of histaminase (diamine oxidase) in decidual cells of human placenta. (1978) (28)
- Regulation of hematopoiesis II: the role of polyamine inhibition on helper or suppressor influences of the thymus. (1983) (28)
- Epigenetic Therapy for Epithelioid Sarcoma (2020) (28)
- The Sociobiologic Integrative Model (SBIM): Enhancing the Integration of Sociobehavioral, Environmental, and Biomolecular Knowledge in Urban Health and Disparities Research (2007) (28)
- Spectrin Repeat Containing Nuclear Envelope 1 and Forkhead Box Protein E1 Are Promising Markers for the Detection of Colorectal Cancer in Blood (2014) (28)
- Role of miR-2392 in driving SARS-CoV-2 infection (2021) (28)
- Purification of histaminase (diamine oxidase) from human pregnancy plasma by affinity chromatography. (1975) (28)
- A KDM5 Inhibitor Increases Global H3K4 Trimethylation Occupancy and Enhances the Biological Efficacy of 5-Aza-2'-Deoxycytidine. (2018) (27)
- Improved antigen detection in ethanol‐fixed cytologic specimens. A modified avidin‐biotin‐peroxidase complex (ABC) method (1985) (27)
- Origin of human small cell lung cancer. (1985) (27)
- Differential utilization of calcitonin gene regulatory DNA sequences in cultured lines of medullary thyroid carcinoma and small-cell lung carcinoma (1990) (26)
- c-myc gene-induced alterations in protein kinase C expression: a possible mechanism facilitating myc-ras gene complementation. (1991) (26)
- Cytogenetic studies of a human medullary thyroid carcinoma cell line. (1987) (25)
- Levels of histaminase and L‐dopa decarboxylase activity in the transition from C‐cell hyperplasia to familial medullary thyroid carcinoma (1979) (25)
- Loss of a single Hic1 allele accelerates polyp formation in ApcΔ716 mice (2011) (24)
- IGFBP-3 Gene Methylation in Primary Tumor Predicts Recurrence of Stage II Colorectal Cancers (2016) (24)
- Evaluation of azacitidine and entinostat as sensitization agents to cytotoxic chemotherapy in preclinical models of non-small cell lung cancer (2014) (24)
- Cloning and chromosomal localization of the human BARX2 homeobox protein gene. (2000) (24)
- Epigenetics and human disease (1996) (24)
- Histaminase (diamine oxidase) activity in human tumors: an expression of a mature genome. (1977) (23)
- Expression of prokaryotic HhaI DNA methyltransferase is transforming and lethal to NIH 3T3 cells. (1996) (23)
- Changes in Promoter Methylation and Gene Expression in Patients with MDS and MDS-AML Treated with 5-Azacitidine and Sodium Phenylbutyrate. (2004) (22)
- Retrospective evaluation of whole exome and genome mutation calls in 746 cancer samples (2020) (22)
- Long-term maintenance therapy of established human small cell variant lung carcinoma implants in athymic mice with a cyclic regimen of difluoromethylornithine. (1986) (22)
- Inactivation of Tumor Suppressor Genes: Choice Between Genetic and Epigenetic Routes (2005) (22)
- Performance assessment of copy number microarray platforms using a spike-in experiment (2011) (22)
- Control of polypeptide hormones by enzymatic degradation. (1973) (22)
- Changes in calcitonin gene RNA processing during growth of a human medullary thyroid carcinoma cell line. (1989) (22)
- Genome-wide positioning of bivalent mononucleosomes (2016) (21)
- DNA methylation in senescence, aging and cancer (2019) (21)
- Advances in Brief Inactivation of the DNA Repair Gene O 6-Methylguanine-DNA Methyltransferase by Promoter Hypermethylation Is Associated with G to A Mutations in Kras in Colorectal Tumorigenesis 1 (2000) (21)
- Preoperative localization of occult medullary carcinoma of the thyroid gland with single-photon emission tomography dimercaptosuccinic acid. (1993) (21)
- Abnormal regional hypermethylation in cancer cells. (1992) (20)
- Stem cells, cancer, and epigenetics (2009) (20)
- Computational analysis of structural and energetic consequences of DNA methylation. (1989) (20)
- Disseminated calcitonin-poor medullary thyroid carcinoma in a patient with calcitonin-rich primary tumor. (1986) (20)
- Pharmacologic induction of innate immune signaling directly drives homologous recombination deficiency (2020) (20)
- Biochemical Studies and Molecular Dynamic Simulations Reveal the Molecular Basis of Conformational Changes in DNA Methyltransferase-1. (2018) (19)
- A new immunohistochemistry prognostic score (IPS) for recurrence and survival in resected pancreatic neuroendocrine tumors (PanNET) (2016) (19)
- Multiple forms of human tumor calcitonin demonstrated by denaturing polyacrylamide gel electrophoresis and lectin affinity chromatography. (1981) (19)
- The effects of L-dopa on in vitro and in vivo calcitonin release from medullary thyroid carcinoma. (1979) (18)
- DNA Methylation and Complete Transcriptional Silencing of Cancer Genes Persist after Depletion of EZH 2 (2007) (18)
- Use of the polymerase chain reaction to detect hypermethylation in the calcitonin gene. A new, sensitive approach to monitor tumor cells in acute myelogenous leukemia. (1992) (18)
- Epigenetic abnormalities in cancer find a "home on the range". (2013) (18)
- Time-dependent changes in human tumors: implications for diagnosis and clinical behavior. (1982) (18)
- Phase I trial and pharmacokinetic study of intravenous and oral α-Difluoromethylornithine (2004) (18)
- DNA methyltransferase levels and altered CpG methylation in the total genome and in the GSTP1 gene in human glioma cells transfected with sense and antisense DNA methyltransferase cDNA (2000) (17)
- A histological survey of green fluorescent protein expression in ‘green’ mice: implications for stem cell research (2007) (17)
- A Gene Hypermethylation Profile of Human Cancer 1 (2001) (17)
- The clinical, biochemical, and familial presentation of type V hyperlipoproteinemia in childhood. (1977) (17)
- Neuroendocrine-related biochemistry in the spectrum of human lung cancers. (1982) (17)
- Human lung tumor sensitivity to difluoromethylornithine as related to ornithine decarboxylase messenger RNA levels. (1986) (17)
- Bacterial-driven inflammation and mutant BRAF expression combine to promote murine colon tumorigenesis that is sensitive to immune checkpoint therapy. (2021) (16)
- 9 Hormone production by tumours: Biological and clinical aspects (1985) (16)
- Comprehensive genomic characterization of squamous cell carcinoma of the lung. (2012) (16)
- Cell-substratum interactions mediate oncogene-induced phenotype of lung cancer cells. (1996) (16)
- Hormone-mediated watery diarrhea in a family with multiple endocrine neoplasms. (1979) (16)
- Degradation of human calcitonin in human plasma (1977) (15)
- Phase I trial and pharmacokinetic study of intravenous and oral alpha-difluoromethylornithine. (1987) (15)
- Ectopic hormone production--biological and clinical implications. (1984) (15)
- Human Cancers Associated with Aberrant DNA Methylation in All Common Gene Is Frequently CDKN 2 / p 16 / MTS 1 Inactivation of the Updated (2006) (15)
- Abstract NG01: Evolution of neoantigen landscape during immune checkpoint blockade in non-small cell lung cancer (2017) (14)
- Frequent epigenetic inactivation of Wnt antagonist genes in breast cancer (2008) (14)
- Polyamines in biology and medicine. (1985) (14)
- The tumor suppressor Hic1 maintains chromosomal stability independent of Tp53 (2018) (14)
- v-Haras oncogene insertion : A model for tumor progression of human small cell lung cancer (14)
- TARGETED DOWN REGULATION OF CORE MITOCHONDRIAL GENES DURING SARS-COV-2 INFECTION (2022) (14)
- CpG Island Methylation ′ Associated with 5 Lymphoblastic Leukemia and Burkitt ' s Lymphoma Is Gene in Acute p 73 Transcriptional Silencing of the Updated Version (1999) (13)
- Tumors with unmethylated MLH1 and the CpG island methylator phenotype are associated with a poor prognosis in stage II colorectal cancer patients (2016) (13)
- RREB1, a ras responsive element binding protein, maps to human chromosome 6p25. (1997) (13)
- Plasma immunoreactive calcitonin in lung cancer. (1980) (13)
- Phase I trial of 5-azacitidine (5AC) and SNDX-275 in advanced lung cancer (NSCLC) (2008) (12)
- Interim analysis of a phase II trial of 5-azacitidine (5AC) and entinostat (SNDX-275) in relapsed advanced lung cancer (NSCLC). (2009) (12)
- Anchorage dependency effects on difluoromethylornithine cytotoxicity in human lung carcinoma cells. (1986) (12)
- Neuroendocrine differentiation: a prognostic feature of non-small-cell lung cancer? (1989) (12)
- Transcription factor levels in medullary thyroid carcinoma cells differentiated by Harvey ras oncogene: c-jun is increased. (1990) (12)
- Breast Cancer Research and Treatment 2001 Reviewers (2004) (12)
- A microassay for measuring cytosine DNA methyltransferase activity during tumor progression. (1995) (11)
- A recombinant reporter system for monitoring reactivation of an endogenously DNA hypermethylated gene. (2014) (11)
- Epigenetic networks and miRNAs in stem cells and cancer. (2010) (11)
- Evaluating the impact of age on immune checkpoint therapy biomarkers (2021) (11)
- Abstract 4666: A phase 2 study investigating the safety, efficacy and surrogate biomarkers of response of 5-azacitidine (5-AZA) andentinostat (MS-275) in patients with triple-negative advanced breast cancer. (2013) (11)
- 31st Annual Meeting and Associated Programs of the Society for Immunotherapy of Cancer (SITC 2016): part one (2016) (10)
- “APUD” cells fact and fiction (1990) (10)
- Ectopic Production of Hormones and Other Proteins by Tumors (1975) (10)
- A murine xenograft model of spontaneous metastases of human lung adenocarcinoma. (2011) (10)
- Hypermethylation of ASC / TMS 1 Is a Sputum Marker for Late-Stage Lung Cancer (2006) (10)
- Retention of unmethylated CpG island alleles in human diploid fibroblast x fibrosarcoma hybrids expressing high levels of DNA methyltransferase. (1996) (10)
- CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas (2014) (9)
- Small cell carcinoma of the lung: altered morphological, bio- logical and biochemical characteristics in long term cultures and heterotransplanted tumors. Abstr. (1980) (9)
- Role of nuclear architecture in epigenetic alterations in cancer. (2010) (9)
- Phase I clinical trial of DNA methyltransferase inhibitor decitabine and PARP inhibitor talazoparib combination therapy in relapsed/refractory acute myeloid leukemia. (2022) (9)
- Age-Related Abnormalities of Circulating Polyamines and Diamine Oxidase Activity in Cystic Fibrosis Heterozygotes and Homozygotes (1980) (9)
- Management of hereditary medullary thyroid carcinoma. (1981) (9)
- Response of plasma histaminase activity to heparin in normal subjects and in patients with small cell carcinoma of the lung. (1978) (9)
- Cancer-like epigenetic derangements of human pluripotent stem cells and their impact on applications in regeneration and repair. (2014) (8)
- In living color: DNA methyltransferase caught in the act (2005) (8)
- OT3-01-06: A Phase 2 Study Investigating the Safety, Efficacy and Surrogate Biomarkers of Response of 5-Azacitidine (5-AZA) and Entinostat (MS-275) in Patients with Advanced Breast Cancer. (2011) (7)
- Carcinoembryonic antigen and calcitonin as markers of malignancy in medullary thyroid carcinoma. (1979) (7)
- Relationship of metastatic medullary thyroid carcinoma to calcitonin content of pheochromocytomas an immunohistochemical study (1980) (7)
- ACharacterize the Major Types of Hematological Malignancies 1 (2006) (7)
- Methylation of MGMT Is Associated with Poor Prognosis in Patients with Stage III Duodenal Adenocarcinoma (2016) (7)
- Epigenetic Therapies in Ovarian Cancer Alter Repetitive Element Expression in a TP53-Dependent Manner (2021) (7)
- Epigenetics and Cancer (2008) (7)
- Deletion of p16INK4A/CDKN2 and p15INK4B in human somatic cell hybrids and hybrid-derived tumors. (1999) (6)
- Oncogene expression in human small cell lung carcinoma. (1985) (6)
- Insertion of the v-Haras Oncogene Induces Differentiation of Calcitonin-producing Human Small Cell Lung Cancer (6)
- Abstract 4779: DNMT3B (a de novo DNA methyltransferase) epigenetically regulates gene expression, independent of its DNA methyltransferase activity (2014) (6)
- Breaching the boundaries that safeguard against repression. (2009) (5)
- DNA Demethylating Agents Generate a Brcaness Effect in Multiple Sporadic Tumor Types: Prediction for Sensitivity to PARP Inhibitors in AML (2017) (5)
- Advances in Brief Dependence of Histone Modifications and Gene Expression on DNA Hypermethylation in Cancer 1 , 2 (2002) (5)
- Abstract 380: Discovery of new epigenetic drugs among FDA-approved drug libraries (2014) (4)
- Myelodysplastic syndromes (MDSs) and acute myelogenous leukemia (AML) comprise a closely linked continuum of malignant hematologic diseases. Introduction. (2005) (4)
- The Great Deceiver: miR-2392’s Hidden Role in Driving SARS-CoV-2 Infection (2021) (4)
- Hormone production by tumours: biological and clinical aspects. (1985) (4)
- Reply to Haffner et al.: DNA hypomethylation renders tumors more immunogenic (2018) (4)
- Selective CDK9 Inhibition by Natural Compound Toyocamycin in Cancer Cells (2022) (4)
- Ret oncogene responsible for MEN2A (1993) (4)
- Advances in Brief p 14 ARF Silencing by Promoter Hypermethylation Mediates Abnormal Intracellular Localization of MDM 21 (2001) (4)
- Apoptotic Death of Tumor Cells Correlates with Chemosensitivity , Independent of p 53 or Bcl-2 (2005) (4)
- The spectrum of human lung cancer cells in culture: a potential model for studying molecular determinants of tumor progression and metastasis. (1983) (4)
- Cytotoxic Response of the Relatively Difluoromethylornithine-resistant Human Lung Tumor Cell Line NCI HI 57 to the Polyamine Analogue (1987) (4)
- The interplay between lncRNAs, RNA-binding proteins and viral genome during SARS-CoV-2 infection reveals strong connections with regulatory events involved in RNA metabolism and immune response (2022) (4)
- Increase in food consumption and growth after treatment with aminoguanidine (1975) (4)
- Abstract 995: Transient low doses of DNA demethylating agents exert durable antitumor effects on hematological and epithelial tumor cells (2012) (4)
- Degradation of human calcitonin in human plasmas. (1977) (3)
- Molecular abnormalities in tumors associated with multiple endocrine neoplasia type 2. (1994) (3)
- Endocrine Markers of Cancer (1982) (3)
- P15INK4B is not mutated in adult familial myelodysplastic syndromes (2002) (3)
- Beyond the genetic lesions: gene inactivation by promoter hypermethylation in human cancer (2000) (3)
- Inhibiting DNA methylation improves antitumor immunity in ovarian cancer (2022) (3)
- 13 – CONCEPTS FOR DERIVING SPECIFIC INHIBITORS OF POLYAMINE BIOSYNTHESIS–HUMAN LUNG CANCER CELLS AS A MODEL SYSTEM (1989) (3)
- Tumor cell origin of histaminase activity in ascites fluid from patients with ovarian carcinoma (1980) (3)
- Stem Cell Epigenetics (2009) (3)
- Phase 2 study investigating the safety, efficacy, and surrogate biomarkers of response to 5-azacitidine (5-AZA) and entinostat in advanced breast cancer. (2014) (3)
- Subclassification of microsatellite-unstable tumors in colorectal cancer (2007) (3)
- Abstract 94: Epigenetic silencing of CDO1 sustains viability of breast cancer cells via the reduction of cellular ROS (2012) (3)
- Abstract CT017: A phase I study of guadecitabine (GUA) combined with irinotecan (IRI) in previously treated metastatic colorectal cancer (mCRC) patients (2016) (2)
- A phase II study of combination epigenetic therapy in metastatic colorectal cancer (mCRC): A phase II consortium (P2C)/Stand Up 2 Cancer (SU2C) study. (2013) (2)
- Interview with Stephen B Baylin. (2015) (2)
- Betacoronavirus-specific alternate splicing (2022) (2)
- Origin and Mechanisms of DNA Methylation Dynamics in Cancers (2019) (2)
- Correlation of exosome concentrations in the plasma of lung cancer patients with disease stage. (2016) (2)
- Abstract 4619: Epigenetic therapy and sensitization of lung cancer to immunotherapy. (2013) (2)
- Aging interacts with tumor biology to produce major changes in the immune tumor microenvironment (2020) (2)
- Metabolism of human calcitonin in vitro in the dog (1973) (2)
- The Promise of Epigenetic Therapy (2007) (2)
- ATP Concentration and Localization of Sites of Epinephrine Induced Renal Artery Constriction.∗ (1966) (2)
- Biomarkers for EGFR-Antagonist Response: In the Genes and on the Genes! (2012) (2)
- Activating STING1-dependent immune signaling in TP53 mutant and wild-type acute myeloid leukemia (2022) (2)
- Inactivation of Glutathione 5-Transferase PI Gene by Promoter Hypermethylation in Human Neoplasia1 (1998) (2)
- 12LBA A Plasma-based colorectal cancer (CRC) screening assay using DNA methylation markers - first results of multicenter studies (2009) (2)
- Pathobiology of the C-cells. (1993) (2)
- Human immunodeficiency virus and lung cancer: differences in presentation and clinical course. (2005) (2)
- Correction: Inhibiting DNA methylation activates cancer testis antigens and expression of the antigen processing and presentation machinery in colon and ovarian cancer cells (2020) (2)
- Combined 3C-ChIP-cloning (6C) assay: a tool to unravel protein-mediated genome architecture. (2009) (2)
- Q&A: Stephen Baylin and Peter Jones on team science by Suzanne Rose. (2011) (2)
- Sequence-specific DNA Binding Activity of RNA Helicase A to the p16 INK4a Promoter* (2000) (2)
- Abstract 2848: Combination of DNA methyltransferase and PARP inhibitors as a novel therapy strategy for poor prognosis acute myeloid leukemia (2015) (1)
- Clinical Significance of Plasma CD9-Positive Exosomes in HIV Seronegative and Seropositive Lung Cancer Patients (2021) (1)
- Abstract 4273: Oncogenic BRAFV600E drives stem cell niche factors-independent growth and tumorigenic transformation in colon organoids (2016) (1)
- Abstract 4701: A phenotypic cell-based screen to identify novel potential epigenetic anti-cancer drugs from natural compounds (2016) (1)
- Correction: Hypomethylating agents synergize with irinotecan to improve response to chemotherapy in colorectal cancer cells (2020) (1)
- Mapping Networks of Protein‐Mediated Physical Interactions Between Chromatin Elements (2010) (1)
- Abstract 6301: DNA methyltransferase inhibitors increase ERV reactivation and STING-dependent interferon/inflammasome signaling in TP53 mutant AML (2022) (1)
- Correction: A new immunohistochemistry prognostic score (IPS) for recurrence and survival in resected pancreatic neuroendocrine tumors (PanNET) (2017) (1)
- Genome‐wide RNA‐ and MBD‐sequencing in HCT116 and DKO cells as a global re‐expression model (2012) (1)
- Abstract LB-386: The NuRD complex cooperates with DNMTs to maintain silencing of colorectal tumor suppressor genes. (2012) (1)
- A Light Microscopic and Immunohistochemical Study (2007) (1)
- The cancer epigenome as a prevention/therapy target (2007) (1)
- Hypermethylation Can Selectively Silence Individual pltfnk4A Alà elesin Neoplasia1 (2006) (1)
- Decitabine-induced apoptosis is p53-independent and mediated through reactive oxygen species (ROS) production and caspase activation (2007) (1)
- Watery diarrhea mediated by different hormones in a multiple endocrine neoplasia type I kindred (1978) (1)
- A phase I trial of oral 5-azacitidine in combination with romidepsin in advanced solid tumors with an expansion cohort in virally mediated cancers and liposarcoma. (2015) (1)
- Renal Conditioning (1963) (1)
- Deletion of p 16 INK 4 A / CDKN 2 and p 15 INK 4 B in Human Somatic Cell Hybrids and Hybrid-derived Tumors 1 (1998) (1)
- Preclinical research in early lung cancer: breakout group report. (1992) (1)
- Essential role of ornithine decarboxylase (ODC) in intestinal mucosal growth and recovery shown by inhibition with α-difluoromethylornithine (DFMO) (1980) (1)
- Betacoronavirus-specific alternate splicing (2021) (1)
- Polyamine metabolism regulates hepatic regeneration: Effects of ornithine decarboxylase inhibition and putrescine administration (1980) (1)
- Histaminase activity in human tumors and placenta, the product of a mature genome (1977) (1)
- Novel score to predict outcome in resected pancreatic neuroendocrine tumors (pNET). (2015) (1)
- Stem Cell Chromatin Patterns and DNA Hypermethylation (2009) (1)
- Successful treatment with dl-alpha-difluoromethyl ornithine (dfmo) of established human small cell lung carcinoma implants in athymic mice. Abstr. (1983) (1)
- Medullary thyroid carcinoma in Sipple syndrome. (1979) (1)
- Prognosis CpG Island Methylator Phenotype – Positive Tumors in the Absence of MLH 1 Methylation Constitute a Distinct Subset of Duodenal Adenocarcinomas and Are Associated with Poor Prognosis (2012) (1)
- Abstract LB-185: Oxidative damage targets complexes containing DNA methyltransferases, SIRT1 and polycomb members to promoter CpG islands (2011) (1)
- Author Correction: Pan-cancer analysis of whole genomes (2023) (1)
- Abstract B43: Early detection biomarker of pancreatic cancer using a nanoparticle-based methylation assay (2011) (1)
- Abstract LB-411: A phase II study of combination epigenetic therapy in advanced non-small cell lung cancer (2011) (1)
- Abstract A55: Human endogenous retroviruses differentially regulate immune checkpoints and modulation of immune responses in serous ovarian carcinoma. (2017) (1)
- Modulation of the Immune System by Epigenetic Therapy: A Rationale for Combined Use of DNA Methyltransferase Inhibitors and Immune Checkpoint Inhibitors (2017) (1)
- Evaluating the impact of age on immune checkpoint therapy biomarkers. (2021) (1)
- Abstract IA13: Combination of DNA methyltransferase and PARP inhibitors as a novel therapy strategy for multiple cancers: Key data in AML and triple negative breast cancer (2017) (1)
- Abstract 4907: Epigenetic treatment of ovarian cancer cells increases immune cell recruitment to the tumor microenvironment: implications for response to immune checkpoint therapy (2016) (0)
- Abstract LB-81: Conditional deletion of the tumor suppressor Hic1 results in aneuploidy and single-step transformation (2014) (0)
- CHAPTER 10:Dosing – When Less is More (2015) (0)
- Comprehensivemolecularcharacterization of human colon and rectal cancer (2012) (0)
- Methylation inactivates critical pathways in tumourgenesis (1999) (0)
- Analysis of immune checkpoint blockade biomarkers in elderly patients using large-scale cancer genomics data. (2021) (0)
- Cancer esearch or and Stem Cell Biology cer-Related Epigenome Changes Associated with R rogramming to Induced Pluripotent Stem Cells (2010) (0)
- SF-079-1 Using DNA methylation markers to predict early recurrence and to re-stage patients with stage I lung cancer (2008) (0)
- Figure 2, Model of epigenetic and genetic abnormalities leading to early abnormal activation of the canonical Wnt pathway in the progression of colon, and other, human cancers. (2009) (0)
- DNA Hypermethylation in Cancer Dependence of Histone Modifications and Gene Expression on (2002) (0)
- Abstract 1600: A xenograft model of spontaneous metastases in NOD SCID mice of human non-small cell lung cancer (2011) (0)
- Dr Alan P Wolffe 1959–2001 (2001) (0)
- Abstract B27: Epigenetic regulation of stem cell fate in leukemic subpopulations. (2015) (0)
- Monoclonal antibody identification of pre neoplastic bronchial epithelial atypias (1987) (0)
- Safety, outcomes and T cell characteristics in patients with relapsed or refractory MDS or CMML treated with atezolizumab in combination with guadecitabine. (2022) (0)
- Abstract ED03-04: Using epigenetic biomarkers as prognostic and predictive markers in non-small cell lung cancer (NSCLC) and the promise of epigenetic therapy (2011) (0)
- Stable Reversion of Conventional Human Pluripotent Stem Cells to a Mouse ESC-like Naïve Ground State Erases Somatic Donor Epigenetic Memory and Significantly Improves Their Hemato-Vascular Differentiation Potency (2016) (0)
- Syne1 Promoter Hypermethylation as a Predictor of Tumor Aggressiveness in Primary Breast Cancer (2008) (0)
- Interview with Stephen B Baylin. (2021) (0)
- Methylation of the estrogen receptor CpG island distinguishes spontaneous and plutonium-induced tumors from nitrosamine-induced lung tumors (1995) (0)
- In Vitro and in Vivo Growth Characteristics of Two Different Cell Populations in an Established Line of Human Neuroblastoma1 (2006) (0)
- Thyroid VenousCatheterization intheEarlyDiagnosis of Familial Medullary Thyroid Carcinoma (1982) (0)
- SPORE Executive Committee (Article in 4/10/08 issue) (2008) (0)
- Abstract 947: Defining UHRF1 domains that support maintenance of human colon cancer DNA methylation and tumorigenicity (2019) (0)
- Histone deacetylase inhibitors and demethylating agents (2015) (0)
- Abstract 3280: Combination of MYC and class IIa HDAC inhibition potentiates anti-tumor efficacy in non-small cell lung cancer (2022) (0)
- Genome-wide positioning of bivalent mononucleosomes (2016) (0)
- Abstract 4473: DNMT and PARP inhibitor combination therapy induces an interferon-driven homologous recombination defect in triple-negative breast cancers and acute myeloid leukemia (2019) (0)
- Demethylating Agents Reprogram Myelodysplastic Syndrome and Leukemia Cells, Sensitizing Them To Poly-(ADP)-Ribose Polymerase Inhibitors (2013) (0)
- Abstract 2107: Transcription factor repertoire basis for epigenetic and consensus molecular subtypes of colorectal cancer (2021) (0)
- Abstract CT121: A Phase II trial of guadecitabine (G) plus atezolizumab (A) in patients with metastatic urothelial carcinoma (UC) progressing after initial checkpoint inhibitor therapy (2021) (0)
- Oncogene chd4 and uses thereof in the diagnosis and treatment of cancer (2018) (0)
- 42. Utilization of Genomic Approaches to Identify the Hypermethylome of Colorectal Cancer - A Strategy for Biomarker Discovery (2008) (0)
- Figure 1, Key genes for stem/progenitor cell control which are frequently, and often concordantly, aberrantly silenced, in association with promoter CpG island DNA hypermethylation in pre-invasive colon lesions. (2009) (0)
- Abstract 200: Methylation of GATA4 and GATA5 transcription factor genes in gastric cancers (2010) (0)
- In vitro degradation of human calcitonin in human plasma (1973) (0)
- GATA4 and GATA5 act as tumor suppressors and are potential biomarkers in colorectal cancer (2008) (0)
- Diamine oxidase activity in human tumors: Clinical and biologic significance (2018) (0)
- Author Correction: Patterns of somatic structural variation in human cancer genomes (2020) (0)
- Cell surface protein phenotype delineates the lineage of cultured human variant small cell lung cancer (SCCL-V) (1985) (0)
- Consistent Association of Ip Loss of Heterozygosity with Pheochromocytomas from Patients with Multiple Endocrine Neoplasia Type 2 Syndromes1 (2006) (0)
- Diamine oxidase histamine. A plasma marker of intestinal mucosal regeneration after arabinosyl cytosine injury (1980) (0)
- esearch or and Stem Cell Biology cer-Related Epigenome Changes Associated with R rogramming to Induced Pluripotent Stem Cells (2010) (0)
- Expression of CD 44 in Human Lung liimors 1 (2006) (0)
- Reviewer List for 2007 (2007) (0)
- Pattern of estrogen receptor gene methylation in colonic tissue is associated with age and site (1995) (0)
- Predicting sensitivity to azacytidine in non-small cell cancer lines by absence of activating mutations. (2012) (0)
- Abstract LB-150: Genetic depletion of DNMT1 reveals a DNMT1 threshold controlling DNA methylation in human cells (2015) (0)
- ning a Gene Promoter Methylation Signature in Sputum for Lung Cancer Risk Assessment (2012) (0)
- Active Chromatin around the Transcription Start Site DNA Methylation by Preservation of Unmethylated DNA and hTERT Is Expressed in Cancer Cell Lines Despite Promoter (2006) (0)
- Expression of CD 44 in Human Lung Tumors Updated (2006) (0)
- Kidney , Brain , and Other Human Cancers Gene Suggests a Suppressor Role in Metalloproteinase-3 Methylation-associated Silencing of the Tissue Inhibitor of Updated Version (1999) (0)
- Human Thyroid Carcinoma Papillary , Follicular , Hurthle ' s Cell , and Poorly Differentiated Distinct Patterns of E-Cadherin CpG Island Methylation in Updated (2006) (0)
- Abstract 1422: Enhancing the therapeutic effects of PARP inhibitors in combination DNA methyl transferase inhibitors, using low doses of ionizing radiation in non small cell lung cancers (2017) (0)
- Hypermethylation of AP-2alpha as a Prognostic Marker for DCIS (2008) (0)
- Reprimo-like is a P53 Responsive Gene Whose Promoter Methylation May Predict for Radiation Responsiveness in Pancreatic Cancer (2010) (0)
- Figure 3, Summation of results for genome tiling arrays performed in colon cancer cells. (2009) (0)
- Epigenetically mediated gene silencing: a companion to genetic alterations in driving tumorigenesis (2007) (0)
- Author Correction: Retrospective evaluation of whole exome and genome mutation calls in 746 cancer samples (2020) (0)
- 5 – Epigenetics and Cancer (2015) (0)
- Part 4: Targeting cancer pathways: The epigenetics question (2015) (0)
- Transcriptional and Posttranscriptional Modulation of Calcitonin Gene Expression by Sodium / t-Butyrate in Cultured Human Medullary Thyroid Carcinoma 1 (2006) (0)
- Advances in Brief E-Cadherin Expression Is Silenced by DNA Hypermethylation in Human Breast and Prostate Carcinomas 1 (2006) (0)
- Abstract 5064: Identifying novel potential epigenetic anti-cancer drugs from natural compounds using a phenotypic-based screening (2017) (0)
- A randomized phase II trial of epigenetic therapy following adjuvant treatment in patients with resected pancreatic cancer and high risk for recurrence. (2015) (0)
- A phase II study of Guadecitabine (G) with Irinotecan (IRI) vs regorafenib or TAS-102 in metastatic colorectal cancer (mCRC) patients (pts) (2020) (0)
- Pathologic downstaging with taxane-based neoadjuvant chemotherapy correlates with increased survival in patients with locally advanced esophageal cancer (2005) (0)
- Long-Term Maintenance Therapy of Established Human Small Cell Variant Lung Carcinoma Implants in Athymic Mice with a Cyclic Regimen of Difluoromethylornithine 1 (2006) (0)
- Author Correction: The evolutionary history of 2,658 cancers (2023) (0)
- Abstract LB-098: Sequential azacitidine and histone deacetylase inhibition induces a potent antitumor response in Kras G12D mouse model of NSCLC (2017) (0)
- Integrated genomic characterization of oesophageal carcinoma (2017) (0)
- Increased cytosine DNA-methyltransferase activity in A/J mouse lung cells following carcinogen exposure and during tumor progression (1994) (0)
- DNA Methyltransferase Inhibitors Promote Homologous Recombination Deficiency through Induction of Immune Signaling, Sensitizing Acute Myeloid Leukemia Cells to PARP Inhibitors (2019) (0)
- Imaging , Diagnosis , Prognosis CpG Island Methylator Phenotype – Positive Tumors in the Absence of MLH 1 Methylation Constitute a Distinct Subset of Duodenal Adenocarcinomas and Are Associated with Poor Prognosis (2012) (0)
- chromatin conformations A novel 6 C assay uncovers Polycomb-mediated higher order Material Supplemental (2008) (0)
- Abstract LB-88: Transient exposure to low-dose decitabine and azacytidine reprograms cancer cells to produce a prolonged antitumor response (2010) (0)
- The Journal thanks the following consultants who, in addition to the members of the Editorial Board, gave their time to review manuscripts submitted in 1980. (1980) (0)
- Abstract A029: Transposable elements exhibit loss of DNA methylation and increases in transcription in a model of tumorigenesis (2022) (0)
- Binding of diamine oxidase (DAO) and lipoprotein lipase (LPL) to vascular endothelial cells (1984) (0)
- Parallel Sessions (Proffered Papers) (2008) (0)
- 577 The role of achaete-scute homolog-1 in neuroendocrine (NE) differentiation during lung carcinogenesis (1997) (0)
- Compositions and methods to detect a neoplasm (2011) (0)
- Abstract B33: Assessing macrophage polarization in sarcomas with PD-L1 correlates (2018) (0)
- Acknowledgment of Reviewers 2013 (2013) (0)
- Referee acknowledgement for 2019 (2020) (0)
- Abstract 2864: Acetylation regulates TET2 stability and enzymatic activity (2015) (0)
- Epigenetic Regulation In Lymphoid Malignancies (2010) (0)
- Resource Integrated Genomic , Epig enomic , and Expression Analyses of Ovarian Cancer Cell Lines Graphical (2018) (0)
- Homage to Martin D. Abeloff (2007) (0)
- Advances in Brief Hypermethylation Can Selectively Silence Individual pltfnk 4 A AlÃ-elesin Neoplasia 1 (2006) (0)
- Abstract CN06-01: Low-dose azacytidine and epigenetic regulation of self-renewal. (2011) (0)
- Uncovering Epigenetic Targets in Cancer (2018) (0)
- Abstract A012: Transcription factor expression repertoire basis for epigenetic and transcriptional subtypes of colorectal cancers (2022) (0)
- Abstract 4455: DNA methylation as biomarkers to predict early recurrence of T1-2N0 lung cancer (2016) (0)
- Plasma histaminase activity after heparin in normal subjects and patients with hyperlipoproteinemia (1973) (0)
- INK 4 Bp 15 Suppressor Role for Hypermethylation-associated Inactivation Indicates a Tumor Updated (2006) (0)
- The Efficacy of Low Dose Epigenetic Agents in Combination with Ionizing Radiation in a Neurosphere Tumor Model of Glioblastoma Multiforme (2008) (0)
- New tumor suppressor HIC-1 (1997) (0)
- Disproportionately low plasma and tumor tissue calcitonin (CT) content in advanced medullary thyroid carcinoma (MTC): An unfavorable prognostic sign? (1979) (0)
- Abstract B20: Malignant transformation initiates a stochastic DNA methylation alteration pattern distinct from that in senescence (2016) (0)
- Abstract 5593: DNMT inhibitor induces NSCLC inflammasome signaling and mitochondrial dysfunction, producing to DSB repair defects and PARP inhibitor sensitivity (2022) (0)
- Abstract 969: Pharmacologic induction of innate immune signaling via STING directly drives homologous recombination deficiency (2020) (0)
- The legacy is not just with you: an interview with Stephen Baylin. (2023) (0)
- Abstract #LB-276: Intersection of genomic and epigenomic gene approaches identifies global disruption of the ECM pathway in colorectal cancer (2009) (0)
- Response of plasma histamine activity (PHA) to heparin in patients with small cell carcinoma of the lung (SCC) (1977) (0)
- Nanoparticle-enabled highly sensitive detection of DNA methylation in single tube (2010) (0)
- Abstract 2823: DNA methyltransferase inhibitors sensitize NSCLC cells to PARP inhibitors by induction of a double strand break repair defect (2018) (0)
- Abstract 2952: Targeting CDK9 reactivates epigenetically silenced genes in cancer (2018) (0)
- Pediatrics Laboratory Research (2010) (0)
- Abstract A008: DNA methyltransferase 3A promotes inflammation-associated gastric cancer growth and presents a therapy target for gastric cancer (2022) (0)
- Comprehensivegenomiccharacterization of squamous cell lung cancers (2012) (0)
- Abstract 6001: Epigenetic regulation of BARD1 confers resistance to anti-VEGF therapy in ovarian cancer (2023) (0)
- 521 - Morphologic and Intestinal Stem Cell Gene Expression Changes in Crispr-Edited APC KO Human Colonoids (2018) (0)
- GCTCAGCCCCGAG AGCTTCTCGlCTTCACCAACTGGTTCTGAG GGGCTcGGCCTGGTCAGGCcCTGGTGCGAATGGACTTTGGAAGCAGGGTG 1200 ATCGCACAACCTGCATCTTTAGTGCTTTCTTGTCAGTGGCGTTGGGAGG GGAAMGGAAAAGWGAAGAAGAAGAAGMAAGAGAAGAAG 1300 AAAAAAACGAAAACAGTCAACCAACCATCGCAACTAAGCGAGGC ) TG CCTGAGGGGCTTTCAGAAAACGGGAGCGCTCAGAACAGTATCTT 1400 TGCAC (0)
- Aberrant promoter methylation in sputum and serum for lung cancer detection (2002) (0)
- Abstract 5033: Azacitidine pretreatment sensitizes NSCLC cells to interferon-γ (2015) (0)
- Alleles in Neoplasia ink 4 Ap 16 Hypermethylation Can Selectively Silence Individual (2006) (0)
- Plasma Postheparin Diamine Oxidase SENSITIVE PROVOCATIVE TEST FOR QUANTITATING LENGTH OF ACUTE INTESTINAL MUCOSALINJURY IN THE RAT GORDOND (0)
- Harvey murine sarcoma retrovirus induced differentiation of human medullary thyroid carcinoma cells (1987) (0)
- Epigenetic Upregulation of Beta-2 Microglobulin in Microsatellite Stable Colon Cancer Cell Lines (2013) (0)
- Abstract 1002: An epigenetic strategy to degrade the estrogen receptor in breast cancer (2017) (0)
- Correction to "A new immunohistochemistry prognostic score (IPS) for recurrence and survival in resected pancreatic neuroendocrine tumors (PanNET)" [Oncotarget. 2016; 7(18): 25950-61]. doi: 10.18632/oncotarget.7436 (2017) (0)
- Methylation of CDO 1 , HOXA 9 , and TAC 1 for the Diagnosis of Lung Cancer (2014) (0)
- Author Correction: Inferring structural variant cancer cell fraction (2022) (0)
- Methode de prediction de la reaction clinique a un traitement chimiotherapeutique avec des agents alkylants (2001) (0)
- A new immunohistochemistry prognostic score (IPS) for recurrence and survival in pancreatic neuroendocrine tumors (PanNET). (2016) (0)
- A New Paradigm for the Treatment of Ovarian Cancer: The Use of Epigenetic Therapy to Sensitize Patients to Immunotherapy and Chemotherapy (2015) (0)
- Helicobacter pylori and Gastroduodenal Secretory Function (1996) (0)
- Epigenetic Therapy Drugs Boost Immune Attraction Properties of Epithelial Cancer Cells (2016) (0)
- Abstract B016: Aberrant age-related methylation leads to tumor predisposition in colorectal organoids (2023) (0)
- Abstract A39: Viral response markers in immune-competent solid tumors by immunohistochemistry (2018) (0)
- High throughput, quantitative DNA methylation screening using a quantum dot based nanotechnology assay (2008) (0)
- Erratum: Hypermethylation of ASC/TMS1 is a sputum marker for late-stage lung cancer (Cancer Research (June 15, 2006) 66 (6210-6218)) (2007) (0)
- Abstract B50: A phenotypic screen to identify novel potential epigenetic anticancer drugs from natural compounds (2016) (0)
- A look at the origins of cancer epigenetics. (2013) (0)
- γ Downregulation of IFN- ) Promoter and Subsequent γof the Gamma Interferon (IFN- Methyltransferase, Resulting in De Novo Virus Type 1 Upregulates DNA Infection with Human Immunodeficiency (2013) (0)
- Abstract A36: Organoid models for deciphering roles of the evolving landscape of epigenetic heterogeneity during aging in cancer development (2020) (0)
- Abstract IA12: Epigenetic therapy—potential efficacy for enhancing immune checkpoint therapy (2020) (0)
- Abstract 2948: Combination treatment of PARP inhibitor, BMN 673 and DNMT inhibitor, Azacytidine: A potential therapy for BRCA negative and positive, triple negative breast cancers (2015) (0)
- Abstract LB-205: Combination of DNA methyltransferase and PARP inhibitors as a novel therapy strategy for poor prognosis acute myeloid leukemia and triple-negative breast cancers (2016) (0)
- E-Cadherin Expression Is Silenced by 5 * CpG Island Methylation in Acute Leukemia 1 (2000) (0)
- Abstract NG07: Immunomodulatory and tumor cell killing effects of the demethylating agent 5-azacytidine in ovarian cancer (2015) (0)
- Defining the association of methylation biomarkers for establishing lung cancer risk: A nested case-control study of a high-risk cohort (2003) (0)
- Abstract 4045: Decreased Fanconi anemia gene expression contributes to efficacy of PARP and DNMT inhibitor combination therapy in triple negative breast cancer (2017) (0)
- Advances in Brief Constitutive Achaete-Scute Homologue-1 Promotes Airway Dysplasia and Lung Neuroendocrine Tumors in Transgenic Mice 1 (2000) (0)
- Abstract LB046: Characterizing the role of inflammation-induced epigenetic alterations in modulating the immune microenvironment during lung cancer initiation (2023) (0)
- Abstract 6256: Inhibition of class IIa HDACs potentiates MYC inhibitor-driven cytotoxicity by inducing MYC depletion and oxidative stress in non-small cell lung cancer (2023) (0)
- Abstract 2618: DNMT1 as a marker of differential sensitivities to epigenetic therapy of a Kras mutant and Kras wild type human non small cell lung cancer cell line (2011) (0)
- An intermediate methylation signature is associated with improved patient survival and a distinct global mRNA expression profile in glioblastoma: An interim analysis of The Cancer Genome Atlas data (2008) (0)
- 55: Early Methylation of SYNE1 in Colorectal Cancer: Implications for Stool-Based Colorectal Cancer Screening (2009) (0)
- Expression of CD44 in Human Lung liimors1 (2006) (0)
- Beyond Traditional Paradigms in Disparities Research (2008) (0)
- Abstract 3278: Identification of epigenetic therapy induced tumor antigens to promote proliferation and infiltration of antigen specific T cells in non-small cell lung cancer (2022) (0)
- High throughput DNA methylation analysis on a droplet-in-oil polymerase chain reaction array (2009) (0)
- Cigarette smoke induces epithelial to mesenchymal transition and increases the metastatic ability of breast cancer cells (2013) (0)
- Cancer esearch apeutics , Targets , and Chemical Biology rrant Silencing of Cancer-Related Genes by CpG ermethylation Occurs Independently of Their R tial Organization in the Nucleus (2010) (0)
- DNA methylation density analysis via fluorescent dye incorporation (2010) (0)
- The Combination of PARP Inhibitors and DNMT Inhibitors Modulates Immune Activity and Suggests a Role for Immune Therapy in AML (2018) (0)
- Abstract 4019: Inhibiting DNA methylation causes an interferon response in cancer cells via endogenous retroviruses and recruits immune cells to the tumor microenvironment to sensitize to immune therapy (2016) (0)
- The EstrogenReceptorCpG Island Is Methylatedin Most HematopoieticNeoplasms1 (1996) (0)
- W1755 Exploring Combination Epigenetic Therapy for the Treatment of Colorectal Cancer (2009) (0)
- Epigenetic therapy inhibits metastases by disrupting premetastatic niches (2020) (0)
- Theshort armofchromosome 11isa"hotspot" for hypermethylation inhumanneoplasia ANDRtEDE BUSTROS*, BARRYD.NELKIN*, ANNSILVERMAN*, GARTHEHRLICHt, BERNARDPOIESZt, (1988) (0)
- Reprogramming to Induced Pluripotent Stem Cells Cancer-Related Epigenome Changes Associated with Updated (2010) (0)
- Methylation-induced silencing of TFPI-2 is an early-stage event in colorectal cancer (2008) (0)
- High‐resolution Epigenome Mapping Reveals Distinct and Divergent Roles for UHRF1 in the Maintenance of DNA Methylation (2020) (0)
- Abstract A18: Mismatch repair proteins recruit DNA methyltransferase 1 to sites of oxidative DNA damage (2016) (0)
- A Phase II Trial of Guadecitabine plus Atezolizumab in Metastatic Urothelial Carcinoma Progressing after Initial Immune Checkpoint Inhibitor Therapy. (2023) (0)
- Abstract 2773: Chronic cigarette smoke exposure of bronchial epithelial cells induces progressive epigenomic changes leading to transformation (2016) (0)
- Correction (2005) (0)
- Exploring the cancer methylome (2012) (0)
- Abstract 4653: Combination Azacitidine and histone deacetylase inhibition induces a multi factorial synergistic anti-tumor response in non-small cell lung cancer (NSCLC) (2016) (0)
- Abstract 773: Early detection of ovarian cancer using cell-free DNA fragmentomes (2023) (0)
- Jacob, Monod, the Lac Operon, and the PaJaMa Experiment-Gene Expression Circuitry Changing the Face of Cancer Research. (2016) (0)
- Abstract LB-92: Loss of a single Hic1 allele accelerates polyp formation in Apc mice (2010) (0)
- Abstract B18: Chronic cigarette smoke exposure of bronchial epithelial cells induces progressive epigenomic changes leading to early steps of transformation (2016) (0)
- Sequential administration of DNA methyltransferase inhibitors (DNMTi) and histone deacetylase inhibitors (HDACi) induces apoptosis with caspase and reactive oxygen species (ROS)-dependent synergy (2007) (0)
- A Bioinformatics Pipeline for Cancer Epigenetics (2010) (0)
- Abstract PR12: Immunomodulatory effects of 5-Azacyditine in ovarian cancer cell lines (2013) (0)
- Therapeutics , Targets , and Chemical Biology ARecombinant Reporter System forMonitoring Reactivation of an Endogenously DNA Hypermethylated Gene (2014) (0)
- MspI and DraI polymorphisms at the ERBA beta locus on chromosome 3p. (1990) (0)
This paper list is powered by the following services:
Other Resources About Stephen B. Baylin
What Schools Are Affiliated With Stephen B. Baylin?
Stephen B. Baylin is affiliated with the following schools: