Wolfgang Huber

Wolfgang Huber 's AcademicInfluence.com Rankings

Wolfgang Huber

Biology

#2406

World Rank

#3822

Historical Rank

Computational Biology

#19

World Rank

#19

Historical Rank

Bioinformatics

#19

World Rank

#19

Historical Rank

biology Degrees

Download Badge

Biology

Why Is Wolfgang Huber Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Wolfgang Huber is a German computational biologist who serves as group leader for the Huber Group at the European Molecular Biology Laboratory , where he is also a senior scientist. He is a founding member of Bioconductor and, alongside Sascha Dietrich, serves the joint head of the Molecular Medicine Partnership Unit's group Systems Medicine of Cancer Drugs.

(See a Problem?)

Wolfgang Huber 's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 (2014) (43922)
HTSeq—a Python framework to work with high-throughput sequencing data (2014) (14763)
Differential expression analysis for sequence count data (2010) (13372)
Bioconductor: open software development for computational biology and bioinformatics (2004) (12224)
gplots: Various R Programming Tools for Plotting Data (2015) (2744)
Software for Computing and Annotating Genomic Ranges (2013) (2663)
Orchestrating high-throughput genomic analysis with Bioconductor (2015) (2623)
Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt (2009) (2461)
Variance stabilization applied to microarray data calibration and to the quantification of differential expression (2002) (2276)
Bioinformatics and Computational Biology Solutions Using R and Bioconductor (Statistics for Biology and Health) (2005) (2247)
BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis (2005) (1593)
Detecting differential usage of exons from RNA-seq data (2012) (1300)
Count-based differential expression analysis of RNA sequencing data using R and Bioconductor (2013) (1009)
Bidirectional promoters generate pervasive transcription in yeast (2009) (952)
arrayQualityMetrics—a bioconductor package for quality assessment of microarray data (2008) (851)
Phenotypic profiling of the human genome by time-lapse microscopy reveals cell division genes (2010) (811)
Two independent modes of chromatin organization revealed by cohesin removal (2017) (788)
A high-resolution map of transcription in the yeast genome. (2006) (724)
Independent filtering increases detection power for high-throughput experiments (2010) (662)
Human haematopoietic stem cell lineage commitment is a continuous process (2017) (631)
Variation in Transcription Factor Binding Among Humans (2010) (595)
EBImage—an R package for image processing with applications to cellular phenotypes (2010) (559)
High-resolution mapping of meiotic crossovers and non-crossovers in yeast (2008) (551)
Model-based variance-stabilizing transformation for Illumina microarray data (2008) (539)
Love MI, Huber W, Anders S.. Moderated estimation of fold change and dispersion for RNA-Seq data with DESeq2. Genome Biol 15: 550 (2014) (514)
Differential expression of RNA-Seq data at the gene level – the DESeq package (2012) (508)
Expression Atlas update—an integrated database of gene and protein expression in humans, animals and plants (2015) (489)
Multi‐Omics Factor Analysis—a framework for unsupervised integration of multi‐omics data sets (2018) (473)
Addressing Accuracy and Precision Issues in iTRAQ Quantitation* (2010) (463)
Enhancer loops appear stable during development and are associated with paused polymerase (2014) (433)
Data-driven hypothesis weighting increases detection power in genome-scale multiple testing (2016) (400)
The Genomic and Transcriptomic Landscape of a HeLa Cell Line (2013) (394)
Di↵erential analysis of count data - the DESeq2 package (2014) (382)
Thermal proteome profiling for unbiased identification of direct and indirect drug targets using multiplexed quantitative mass spectrometry (2015) (378)
Patterns of somatic structural variation in human cancer genomes (2020) (377)
A global map of human gene expression (2010) (376)
The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs (2015) (347)
Gene expression across mammalian organ development (2019) (344)
Directional tissue migration through a self-generated chemokine gradient (2013) (325)
Expression Atlas update—a database of gene and transcript expression from microarray- and sequencing-based functional genomics experiments (2013) (319)
Orchestrating single-cell analysis with Bioconductor (2019) (315)
Analysis of cell-based RNAi screens (2006) (310)
RNA-Seq workflow: gene-level exploratory analysis and differential expression (2015) (294)
Proteome-wide identification of ubiquitin interactions using UbIA-MS (2018) (288)
Expression Atlas: gene and protein expression across multiple studies and organisms (2017) (282)
Genetic Control of Chromatin States in Humans Involves Local and Distal Chromosomal Interactions (2015) (282)
Identification of regulatory networks in HSCs and their immediate progeny via integrated proteome, transcriptome, and DNA methylome analysis. (2014) (279)
Regenerating islet-derived 3-alpha is a biomarker of gastrointestinal graft-versus-host disease. (2011) (267)
Cell-to-cell expression variability followed by signal reinforcement progressively segregates early mouse lineages (2013) (263)
SomaticSignatures: inferring mutational signatures from single-nucleotide variants (2014) (255)
Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency. (2012) (243)
Tandem fluorescent protein timers for in vivo analysis of protein dynamics (2012) (232)
Identification and classification of differentially expressed genes in renal cell carcinoma by expression profiling on a global human 31,500-element cDNA array. (2001) (200)
Parameter estimation for the calibration and variance stabilization of microarray data (2003) (200)
Thermal proteome profiling monitors ligand interactions with cellular membrane proteins (2015) (197)
Comprehensive molecular characterization of mitochondrial genomes in human cancers (2017) (197)
A Reliable Tool to Determine Cell Viability in Complex 3-D Culture: The Acid Phosphatase Assay (2007) (193)
NIH Consensus development project on criteria for clinical trials in chronic graft-versus-host disease: II. The 2014 Pathology Working Group Report. (2015) (189)
Myc Depletion Induces a Pluripotent Dormant State Mimicking Diapause (2016) (188)
Ringo – an R/Bioconductor package for analyzing ChIP-chip readouts (2007) (187)
Antisense expression increases gene expression variability and locus interdependency (2011) (183)
Prognostic factors influencing surgical management and outcome of gastrointestinal stromal tumours (2003) (181)
Mapping of signaling networks through synthetic genetic interaction analysis by RNAi (2011) (179)
Identification of regulatory networks in HSCs and their immediate progeny via integrated proteome, transcriptome, and DNA methylome analysis (2015) (171)
The Shh Topological Domain Facilitates the Action of Remote Enhancers by Reducing the Effects of Genomic Distances (2016) (170)
Protein quality control at the inner nuclear membrane (2014) (167)
Transparency and reproducibility in artificial intelligence (2020) (167)
Transcript mapping with high-density oligonucleotide tiling arrays (2006) (164)
Clustering phenotype populations by genome-wide RNAi and multiparametric imaging (2010) (163)
Alternative start and termination sites of transcription drive most transcript isoform differences across human tissues (2017) (162)
An Optogenetic Method to Modulate Cell Contractility during Tissue Morphogenesis (2015) (152)
Graphs in molecular biology (2007) (135)
Proteome-wide solubility and thermal stability profiling reveals distinct regulatory roles for ATP (2018) (134)
Nuclear Architecture Organized by Rif1 Underpins the Replication-Timing Program (2016) (133)
Supervised Machine Learning (2008) (133)
Mapping genetic interactions in human cancer cells with RNAi and multiparametric phenotyping (2013) (131)
Low Paneth cell numbers at onset of gastrointestinal graft-versus-host disease identify patients at high risk for nonrelapse mortality. (2013) (126)
Biological plasticity rescues target activity in CRISPR knock outs (2019) (118)
Genome-wide analysis of mRNA decay patterns during early Drosophila development (2010) (116)
Shrinkage estimation of dispersion in Negative Binomial models for RNA-seq experiments with small sample size (2013) (114)
Prognostic impacts of cytogenetic findings in clear cell renal cell carcinoma: gain of 5q31-qter predicts a distinct clinical phenotype with favorable prognosis. (2001) (112)
High-resolution transcription atlas of the mitotic cell cycle in budding yeast (2010) (110)
Single-cell transcriptome analysis reveals coordinated ectopic gene expression patterns in medullary thymic epithelial cells (2015) (110)
Cytogenetic and morphologic typing of 58 papillary renal cell carcinomas: evidence for a cytogenetic evolution of type 2 from type 1 tumors. (2003) (109)
Drug-perturbation-based stratification of blood cancer (2017) (109)
Relating CNVs to transcriptome data at fine resolution: assessment of the effect of variant size, type, and overlap with functional regions. (2011) (107)
Drift and conservation of differential exon usage across tissues in primate species (2013) (107)
Bioconductor Case Studies (2008) (107)
cAMP Response Element-Binding Protein Is a Primary Hub of Activity-Driven Neuronal Gene Expression (2011) (104)
The Small Non-coding Vault RNA1-1 Acts as a Riboregulator of Autophagy (2017) (101)
A Compendium to Ensure Computational Reproducibility in High-Dimensional Classification Tasks (2004) (101)
Gene expression in kidney cancer is associated with cytogenetic abnormalities, metastasis formation, and patient survival. (2005) (95)
Importing ArrayExpress datasets into R/Bioconductor (2009) (93)
Multi-domain protein families and domain pairs: comparison with known structures and a random model of domain recombination (2004) (93)
miR-16 and miR-125b are involved in barrier function dysregulation through the modulation of claudin-2 and cingulin expression in the jejunum in IBS with diarrhoea (2017) (90)
Microarray data quality control improves the detection of differentially expressed genes. (2010) (90)
Systematic analysis of T7 RNA polymerase based in vitro linear RNA amplification for use in microarray experiments (2004) (88)
Alternative polyadenylation diversifies post‐transcriptional regulation by selective RNA–protein interactions (2014) (87)
FourCSeq: analysis of 4C sequencing data (2015) (85)
Comparison of normalization methods for Illumina BeadChip HumanHT-12 v3 (2010) (84)
A map of directional genetic interactions in a metazoan cell (2015) (83)
Reduced proteasome activity in the aging brain results in ribosome stoichiometry loss and aggregation (2019) (81)
Staged surgery with neoadjuvant 90Y-DOTATOC therapy for down-sizing synchronous bilobular hepatic metastases from a neuroendocrine pancreatic tumor (2010) (76)
Recurrent CDKN1B (p27) mutations in hairy cell leukemia. (2015) (75)
In situ analysis of cross-hybridisation on microarrays and the inference of expression correlation (2007) (73)
Assessing affymetrix GeneChip microarray quality (2011) (71)
Genomic organization of transcriptomes in mammals: Coregulation and cofunctionality. (2007) (70)
Discovery of novel drug sensitivities in T-PLL by high-throughput ex vivo drug testing and mutation profiling (2017) (69)
A chemical–genetic interaction map of small molecules using high‐throughput imaging in cancer cells (2015) (67)
Dissecting intratumour heterogeneity of nodal B-cell lymphomas at the transcriptional, genetic and drug-response levels (2020) (67)
glmGamPoi: fitting Gamma-Poisson generalized linear models on single cell count data (2020) (66)
Identifying drug targets in tissues and whole blood with thermal-shift profiling (2020) (66)
Identifying splits with clear separation: a new class discovery method for gene expression data (2001) (66)
Comparison between preoperative quantitative assessment of bowel wall vascularization by contrast-enhanced ultrasound and operative macroscopic findings and results of histopathological scoring in Crohn's disease. (2010) (62)
Combinatorial effects of four histone modifications in transcription and differentiation. (2008) (61)
Organelle proteomics experimental designs and analysis (2010) (59)
arrayMagic: two-colour cDNA microarray quality control, preprocessing (2005) (57)
Differential expression with the Bioconductor Project (2005) (56)
Single-cell polyadenylation site mapping reveals 3′ isoform choice variability (2015) (55)
A Discrete Transition Zone Organizes the Topological and Regulatory Autonomy of the Adjacent Tfap2c and Bmp7 Genes (2015) (54)
Gain of CTCF-Anchored Chromatin Loops Marks the Exit from Naive Pluripotency (2018) (52)
Quality Assessment and Data Analysis for microRNA Expression Arrays (2008) (51)
Chemokine and chemokine receptor expression analysis in target organs of acute graft-versus-host disease (2009) (50)
Analysis of microarray gene expression data (2003) (50)
High-Content siRNA Screen Reveals Global ENaC Regulators and Potential Cystic Fibrosis Therapy Targets (2013) (49)
From ORFeome to biology: a functional genomics pipeline. (2004) (49)
Coverage and error models of protein-protein interaction data by directed graph analysis (2007) (48)
Nonparametric Analysis of Thermal Proteome Profiles Reveals Novel Drug-binding Proteins (2019) (46)
Making the most of high-throughput protein-interaction data (2007) (45)
Systematic comparison of surface coatings for protein microarrays (2005) (45)
A Large-Scale RNAi Screen Identifies Deaf1 as a Regulator of Innate Immune Responses in Drosophila (2009) (44)
Comparative analysis of structured RNAs in S. cerevisiae indicates a multitude of different functions (2007) (43)
matchprobes: a Bioconductor package for the sequence-matching of microarray probe elements (2004) (42)
Sex differences in oncogenic mutational processes (2019) (41)
The LIFEdb database in 2006 (2005) (41)
Comparison between quantitative assessment of bowel wall vascularization by contrast-enhanced ultrasound and results of histopathological scoring in ulcerative colitis (2012) (39)
Consensus diagnostic histopathological criteria for acute gastrointestinal graft versus host disease improve interobserver reproducibility (2015) (37)
Two independent modes of chromosome organization are revealed by cohesin removal (2016) (37)
Various R Programming Tools for Plotting Data [R package gplots version 3.1.0] (2020) (35)
Genome-wide allele- and strand-specific expression profiling (2009) (34)
Covariate powered cross‐weighted multiple testing (2017) (32)
The RNA-Binding Protein YBX3 Controls Amino Acid Levels by Regulating SLC mRNA Abundance. (2019) (31)
Developmental Gene Expression Differences between Humans and Mammalian Models (2019) (31)
Transcriptome-wide Profiling and Posttranscriptional Analysis of Hematopoietic Stem/Progenitor Cell Differentiation toward Myeloid Commitment (2014) (30)
Steroid treatment alters adhesion molecule and chemokine expression in experimental acute graft-vs.-host disease of the intestinal tract. (2011) (29)
Control of tissue morphology by Fasciclin III-mediated intercellular adhesion (2013) (29)
Improved binding site assignment by high-resolution mapping of RNA–protein interactions using iCLIP (2015) (29)
CXCL12 promotes glycolytic reprogramming in acute myeloid leukemia cells via the CXCR4/mTOR axis (2016) (29)
analysis of count data { the DESeq2 package (2015) (28)
Statistical methods and software for the analysis of highthroughput reverse genetic assays using flow cytometry readouts (2006) (27)
Analyzing ChIP-chip Data Using Bioconductor (2008) (26)
TRRAP is essential for regulating the accumulation of mutant and wild-type p53 in lymphoma. (2018) (25)
Faculty Opinions recommendation of Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. (2016) (24)
FourCSeq : analysis of 4 C sequencing data (2015) (24)
Top-down standards will not serve systems biology (2006) (23)
Efficient treatment of murine acute GvHD by in vitro expanded donor regulatory T cells (2019) (22)
Retrospective evaluation of whole exome and genome mutation calls in 746 cancer samples (2020) (22)
Splenic pooling and loss of VCAM-1 causes an engraftment defect in patients with myelofibrosis after allogeneic hematopoietic stem cell transplantation (2016) (22)
Genome-wide survey of post-meiotic segregation during yeast recombination (2011) (22)
Tumor-Induced Osteomalacia: Increased Level of FGF-23 in a Patient with a Phosphaturic Mesenchymal Tumor at the Tibia Expressing Periostin (2014) (22)
Telomere shortening in enterocytes of patients with uncontrolled acute intestinal graft-versus-host disease. (2015) (21)
Timer-based proteomic profiling of the ubiquitin-proteasome system reveals a substrate receptor of the GID ubiquitin ligase (2021) (21)
Functional profiling: from microarrays via cell-based assays to novel tumor relevant modulators of the cell cycle. (2005) (20)
Reply to Talloen et al.: Independent filtering is a generic approach that needs domain specific adaptation (2010) (20)
The importance of transparency and reproducibility in artificial intelligence research (2020) (20)
Consensus on the histopathological evaluation of liver biopsies from patients following allogeneic hematopoietic cell transplantation (2014) (20)
gscreend: modelling asymmetric count ratios in CRISPR screens to decrease experiment size and improve phenotype detection (2020) (20)
Drug-based perturbation screen uncovers synergistic drug combinations in Burkitt lymphoma (2018) (19)
Measuring genetic interactions in human cells by RNAi and imaging (2014) (19)
Multi-omics reveals clinically relevant proliferative drive associated with mTOR-MYC-OXPHOS activity in chronic lymphocytic leukemia (2021) (19)
Estimating node degree in bait-prey graphs (2008) (19)
A genetic interaction map of cell cycle regulators (2016) (19)
SpeCond: a method to detect condition-specific gene expression (2011) (18)
The association between acute graft-versus-host disease and antimicrobial peptide expression in the gastrointestinal tract after allogeneic stem cell transplantation (2017) (18)
Differential analysis of RNA-Seq data at the gene level using the DESeq 2 package (2013) (17)
Expression with the Bioconductor Project (2004) (17)
A user guide for the online exploration and visualization of PCAWG data (2020) (16)
Dynamical modelling of phenotypes in a genome-wide RNAi live-cell imaging assay (2013) (16)
Preventive azithromycin treatment reduces noninfectious lung injury and acute graft-versus-host disease in a murine model of allogeneic hematopoietic cell transplantation. (2015) (16)
Analyzing RNA-seq data with DESeq 2 ( PDF ) (2017) (15)
R Language (2011) (15)
Ringo – an R/Bioconductor package for analyzing ChIP-chip readouts (2007) (15)
Adaptive penalization in high-dimensional regression and classification with external covariates using variational Bayes (2018) (15)
Cell-Based Assays (2005) (14)
Extracting quantitative genetic interaction phenotypes from matrix combinatorial RNAi (2011) (14)
A computational method for detection of ligand-binding proteins from dose range thermal proteome profiles (2020) (14)
Energy metabolism is co-determined by genetic variants in chronic lymphocytic leukemia and influences drug sensitivity (2019) (14)
Covariate powered cross-weighted multiple testing with false discovery rate control (2017) (13)
Dissection of CD20 regulation in lymphoma using RNAi (2016) (13)
TimerQuant: a modelling approach to tandem fluorescent timer design and data interpretation for measuring protein turnover in embryos (2016) (13)
Transformation and Preprocessing of Single-Cell RNA-Seq Data (2021) (13)
gscreend: modelling asymmetric count ratios in CRISPR screens to decrease experiment size and improve phenotype detection (2019) (13)
Contributions of the EMERALD project to assessing and improving microarray data quality. (2011) (13)
CellH5: a format for data exchange in high-content screening (2013) (12)
Condensin II inactivation in interphase does not affect chromatin folding or gene expression (2018) (12)
Assessments of Affymetrix GeneChip Microarray Quality for Laboratories and Single Samples (2011) (12)
Error models for microarray intensities (2004) (11)
Research Techniques Made Simple: Bioinformatics for Genome-Scale Biology. (2017) (11)
The Protein Landscape of Chronic Lymphocytic Leukemia (CLL). (2021) (11)
35th Annual meeting of the European Association for the Study of Diabetes. Brussels, Belgium, 28 September-2 October, 1999. Abstracts. (1999) (11)
Inferring differential exon usage in RNA-Seq data with the DEXSeq package (2015) (11)
Survey of ex vivo drug combination effects in chronic lymphocytic leukemia reveals synergistic drug effects and genetic dependencies (2020) (11)
Transcription profiling of renal cell carcinoma. (2002) (10)
Multi-Omics factor analysis disentangles heterogeneity in blood cancer (2017) (10)
Murine Cytomegalovirus Immediate-Early 1 Gene Expression Correlates with Increased GVHD after Allogeneic Hematopoietic Cell Transplantation in Recipients Reactivating from Latent Infection (2013) (10)
Rintact: enabling computational analysis of molecular interaction data from the IntAct repository (2008) (9)
Control of PD-L1 expression in CLL-cells by stromal triggering of the Notch-c-Myc-EZH2 oncogenic signaling axis (2021) (9)
Human haematopoietic stem cell lineage commitment is a continuous process (2017) (9)
An introduction to low-level analysis methods of DNA microarray data (2005) (9)
BioC 2012: Analyzing RNA-seq data for dierential exon usage with the DEXSeq package (2012) (9)
Polymorphisms in CTNNBL1 in relation to colorectal cancer with evolutionary implications. (2011) (9)
MDM4 Is Targeted by 1q Gain and Drives Disease in Burkitt Lymphoma. (2019) (9)
Systematic discovery of biomolecular condensate-specific protein phosphorylation (2022) (9)
Case Studies Using Graphs on Biological Data (2005) (9)
Reduction of aGVHD using chicken antibodies directed against intestinal pathogens in a murine model. (2017) (9)
Single cell 3’UTR analysis identifies changes in alternative polyadenylation throughout neuronal differentiation and in autism (2020) (8)
Data-driven hypothesis weighting increases detection power in multiple testing (2015) (8)
A clash of cultures in discussions of the P value (2016) (8)
Non-parametric analysis of thermal proteome profiles reveals novel drug-binding proteins (2018) (8)
Visualizing Genomic Data (2006) (8)
Miniaturized Drug Sensitivity and Resistance Test on Patient-Derived Cells Using Droplet-Microarray (2020) (8)
Gene Set Enrichment Analysis (2008) (8)
Reproducible Statistical Analysis in Microarray Profiling Studies (2004) (8)
Bioconductor Software for Graphs (2005) (7)
Proteogenomics refines the molecular classification of chronic lymphocytic leukemia (2022) (7)
Publisher Correction: Orchestrating single-cell analysis with Bioconductor (2019) (7)
Introduction to EBImage, an image processing and analysis toolkit for R (2008) (7)
Comparison of Transformations for Single-Cell RNA-Seq Data (2022) (6)
On the synthesis of microarray experiments (2005) (6)
Cytostatic conditioning in experimental allogeneic bone marrow transplantation: Busulfan causes less early gastrointestinal toxicity but Treosulfan results in improved immune reconstitution (2014) (6)
Variance Stabilization and Robust Normalization for Microarray Gene Expression Data (2002) (6)
High-Throughput Flow Cytometry–Based Assay to Identify Apoptosis-Inducing Proteins (2007) (6)
Retinal Involvement in a Patient with Cerebral Manifestation of Chronic Graft-Versus-Host-Disease (2015) (5)
Transcript mapping with oligonucleotide high-density tiling arrays (2006) (5)
Entrapment syndrome of multiple nerves in graft‐versus‐host disease (2014) (5)
Array-based genotyping in S.cerevisiae using semi-supervised clustering (2009) (5)
h5vc: scalable nucleotide tallies with HDF5 (2014) (5)
MatrixQCvis: shiny-based interactive data quality exploration for omics data (2021) (5)
Online resources for PCAWG data exploration, visualization, and discovery (2017) (4)
Systematic Investigation of Microenvironmental Drug Resistance Mechanisms in Chronic Lymphocytic Leukemia (2019) (4)
Easy Differential Expression (2008) (4)
Upregulation of SPS100 gene expression by an antisense RNA via a switch of mRNA isoforms with different stabilities (2017) (4)
Asymptomatic Multiple Myeloma - Background of Progression, Evolution, and Prognosis (2016) (4)
The Bioconductor channel in F1000Research. (2015) (4)
Analysis of nonleukemic cellular subcompartments reconstructs clonal evolution of acute myeloid leukemia and identifies therapy‐resistant preleukemic clones (2021) (4)
A Patient with Fibroepithelial Polyp of the Ureter—A Rare Condition Mimicking Malignancy: A Case Report (2012) (4)
An autologous culture model of nodal B-cell lymphoma identifies ex vivo determinants of response to bispecific antibodies (2021) (4)
Pairwise effects between lipid GWAS genes modulate lipid plasma levels and cellular uptake (2021) (4)
Neural lineage induction reveals multi-scale dynamics of 3D chromatin organization (2014) (4)
Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 (2014) (4)
Processing Affymetrix Expression Data (2008) (3)
SAMHD1 mutations in mantle cell lymphoma are recurrent and confer in vitro resistance to nucleoside analogues. (2021) (3)
Mutational landscape and complexity in CLL. (2015) (3)
The hwriter package: Composing HTML documents with R objects (2009) (3)
Human genome meeting 2016 (2016) (3)
Low‐level Analysis of Microarray Experiments (2008) (3)
Beginner ’ s guide to using the DESeq 2 package (2014) (3)
Proteome thermal stability reflects organ physiology and identifies drug-target engagement in vivo (2018) (3)
Drug‐microenvironment perturbations reveal resistance mechanisms and prognostic subgroups in CLL (2022) (2)
A user’s guide to the online resources for data exploration, visualization, and discovery for the Pan-Cancer Analysis of Whole Genomes project (PCAWG) (2019) (2)
Human haematopoietic stem cell differentiation follows a continuous waddington-like landscape (2016) (2)
Subgroup-specific gene expression profiles and mixed epistasis in chronic lymphocytic leukemia (2021) (2)
SAMHD1 mutations in mantle cell lymphoma are recurrent and confer in vitro resistance to nucleoside analogues (2020) (2)
Computational analysis of ligand dose range thermal proteome profiles (2020) (2)
End-to-end analysis of cell-based screens (2006) (2)
htseq-clip: a toolset for the preprocessing of eCLIP/iCLIP datasets (2022) (2)
Beneficiary Effect of Autologous Hematopoietic Cell Transplantation in Idiopathic Ulcerative Dermatitis C57BL/6 Mice (2014) (2)
Isolated orbital relapse of multiple myeloma in a patient with severe chronic GVHD after allogeneic hematopoietic SCT (2014) (2)
Marked regression of myelofibrosis during reduced-dose dasatinib treatment in chronic myelogenous leukemia in accelerated phase (2016) (2)
Reporting p Values. (2019) (2)
The Bioconductor channel in F1000Research (2016) (2)
Section : Computational Methods for High Throughput Genetic Analysis-Expression profiling Article : Differential Expression with the Bioconductor Project (2004) (1)
Imaging-based coculture model for high-throughput compound screening in hematological cancers (2022) (1)
Author Correction: Pan-cancer analysis of whole genomes (2023) (1)
Efficient Treatment of Murine Acute Graft-Versus-Host Disease with In Vitro Expanded CD4+CD25+ Regulatory T Cells (2011) (1)
MDM4 is an essential disease driver targeted by 1q gain in Burkitt lymphoma (2018) (1)
Mapping drug-microenvironment-genetic interplay in CLL reveals trisomy 12 as a modulator of microenvironmental signals (2021) (1)
Annotation and Metadata (2008) (1)
Transcriptional Profiling Reveals Strong Impact of Major Molecular Disease Subgroups and Mixed Epistasis in Chronic Lymphocytic Leukemia (2019) (1)
DRUG PERTURBATION BASED STRATIFICATION OF LYMPHOPROLIFERATIVE DISORDERS (2017) (1)
HISTOPATHOLOGIC DIAGNOSIS OF CHRONIC GRAFT VERSUS HOST DISEASE: NIH Consensus Development Project on Criteria for Clinical Trials in Chronic Graft-Versus-Host Disease: II. The 2014 Pathology Working Group Report (2015) (1)
Pre-analytical processing of plasma and serum samples for combined proteome and metabolome analysis (2022) (1)
Transcript isoform differences across human tissues are predominantly driven by alternative start and termination sites of transcription (2017) (1)
Deep thermal profiling for detection of functional proteoform groups. (2023) (1)
sSeq: A Simple and Shrinkage Approach of Differential Expression Analysis for RNA-Seq experiments (2013) (1)
Deep thermal proteome profiling for detection of proteoforms and drug sensitivity biomarkers (2022) (1)
Dissecting intratumor heterogeneity of nodal B cell lymphomas on the transcriptional, genetic, and drug response level (2019) (1)
Inferring tumor-specific cancer dependencies through integrating ex vivo drug response assays and drug-protein profiling (2022) (1)
Identifying drug targets in tissues and whole blood with thermal-shift profiling (2020) (1)
Corrigendum: Enhancer loops appear stable during development and are associated with paused polymerase (2016) (1)
Ex-Vivo Drug Response Profiling for Tailoring Treatment in Hematologic Malignancies: The Prospective Non-Interventional SMART-Trial (2019) (1)
Author response: A map of directional genetic interactions in a metazoan cell (2015) (1)
Phenotype with Favorable Prognosis qter Predicts a Distinct Clinical − Cell Carcinoma : Gain of 5 q 31 Prognostic Impacts of Cytogenetic Findings in Clear Cell Renal Updated (2001) (1)
Dynamical modelling of phenotypes in a genome-wide RNAi live-cell imaging assay (2013) (1)
Multimodal and spatially resolved profiling identifies distinct patterns of T-cell infiltration in nodal B-cell lymphoma entities (2022) (1)
A combinatorial extracellular code tunes the intracellular signaling network activity to distinct cellular responses (2018) (1)
Combinatorial drug-microenvironment interaction mapping reveals cell-extrinsic drug resistance mechanisms and clinically relevant patient subgroups in CLL (2021) (1)
Mutated SF3B1 is associated with transcript isoform changes of the genes UQCC and RPL31 both in CLLs and uveal melanomas (2014) (1)
h 5 vc : scalable nucleotide tallies with HDF 5 (2014) (1)
Discovery of Novel Drug Sensitivities in T-Prolymphocytic Leukemia (T-PLL) By High-Throughput Ex Vivo Drug Testing and Genetic Profiling (2014) (1)
Effective Treatment of Acute GvHD After Haploidentical BMT With in vitro Expanded Murine CD4+CD25+ Regulatory T Cells (2011) (0)
Overview over the DKFZ kidney data package (2015) (0)
Intestinal Microbiota: From Inflammatory Bowel Disease to Bone Marrow Transplantation (2012) (0)
Analysis of multi-condition single-cell data with latent embedding multivariate regression (2023) (0)
Lifetime-ratio analysis in the posterior lateral line primordium (2014) (0)
Two Color Arrays (2008) (0)
Analysing Microscopy Screens with EBImage (2007) (0)
CoCo: a web application to display, store and curate ChIP-on-chip data integrated with diverse types of gene expression data (2007) (0)
Diagnostics for independent filtering (2013) (0)
Quality Assessment and Data Analysis for microRNA Expression Arrays Supplementary Material (2008) (0)
Enterocytes Of Patients With Uncontrolled Acute Graft Versus Host Disease Of The Gut Undergo Massive Telomere Shortening Compared To Unaffected Controls (2013) (0)
Software for Computing and Annotating Genomic Ranges The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters (2013) (0)
Faculty of 1000 evaluation for Precision medicine for cancer with next-generation functional diagnostics. (2016) (0)
Title Page / Table of Contents / Imprint / Guidelines for Authors (2015) (0)
TRANSPLANTATION Telomere shortening in enterocytes of patients with uncontrolled acute intestinal graft-versus-host disease (2015) (0)
DEWSeq addresses the pervasive disparity of crosslink site distributions in the discovery of RNA-binding protein binding sites in eCLIP data (2022) (0)
A Novel Grading System of Lower Gastrointestinal Acute Graft-Versus-Host Disease At Disease Onset Predicts Response to Therapy and Non-Relapse Mortality (2011) (0)
BioC 2014 : RNA-Seq workflow for differential gene expression (2014) (0)
The global RNA and protein landscape of hematopoietic stem cells and their immediate progeny (2014) (0)
Type 2 from Type 1 Tumors Cell Carcinomas : Evidence for a Cytogenetic Evolution of Cytogenetic and Morphologic Typing of 58 Papillary Renal (2003) (0)
Two-sided binomial test on the data from Krogan and coworkers 11 (2011) (0)
Abstract 5557: Systematic mapping of drug sensitivity in hematological malignancies identifies vulnerability of chronic lymphocytic leukemia with mutant p53 (2014) (0)
The U1 Spliceosomal RNA: A Novel Non-Coding Hotspot Driver Mutation Independently Associated with Clinical Outcome in Chronic Lymphocytic Leukemia (2019) (0)
Large error models for microarray intensities (2005) (0)
A Comprehensive DNA Methylome Analysis of Stereotyped and Non-Stereotyped CLL Reveals an Epigenetic Signature with Strong Clinical Impact Encompassing IGHV Status, Stereotypes and IGLV3-21R110 (2022) (0)
Proteogenomic Subtyping of Chronic Lymphocytic Leukemia Identifies a Novel Poor Outcome Subgroup with a Distinct Drug Response Profile (2020) (0)
Functional Anti-Apoptotic Protein Dependence and Its Relation to Genomic Prognostic Markers and Response to Treatment in Chronic Lymphocytic Leukemia (2022) (0)
Asymptomatic Multiple Myeloma – Molecular Background of Progression and Prognosis (2017) (0)
Mathematical tree models for cytogenetic development in solid tumors. (2003) (0)
Improved discovery of RNA-binding protein binding sites in eCLIP data using DEWSeq (2022) (0)
Single-Cell Multi-Omic and Spatial Analysis of Nodal B Cell Non-Hodgkin Lymphomas Reveals Plasticity in B Cell Maturation As a Driver of Intratumor Heterogeneity (2022) (0)
Comparing the value of mono- versus coculture for high-throughput compound screening in hematological malignancies (2023) (0)
Proteogenomic Subtyping of Chronic Lymphocytic Leukemia Identifies a Novel Poor Outcome Subgroup with a Distinct Drug Response Profile (2020) (0)
Investigating primary and secondary regulatory mechanisms for hypertension using genome-wide gene expression in multiple tissues and radiotelemetric blood pressure in the rat (2011) (0)
Improved process for preparing 2-acetylcarboxylsyreestere (1998) (0)
Pairwise genetic interactions modulate lipid plasma levels and cellular uptake (2020) (0)
Orchestrating single-cell analysis with Bioconductor (2019) (0)
Methods of “ Thermal proteome profiling for unbiased identification of direct and indirect drug targets “ (2015) (0)
The Extragalactic Reference (1995) (0)
Differential analysis of count data from high-throughput sequencing (2013) (0)
Publisher Correction: Orchestrating single-cell analysis with Bioconductor (2019) (0)
Statistical Challenges in Single-Cell Biology (2017) (0)
Transcriptome analysis of chronic lymphoid leukemia reveals isoform regulation associated with mutations in SF 3 B 1 (2013) (0)
Proteome-wide solubility and thermal stability profiling reveals distinct regulatory roles for ATP (2019) (0)
A process for preparing N-Succinimidylcarbonaten. (1991) (0)
Supplementary Information : FourCSeq comparison with r 3 Cseq (2015) (0)
A user guide for the online exploration and visualization of PCAWG data (2020) (0)
A process for preparing lactams by catalytic rearrangement of cyclic ketoximes (1961) (0)
Liquid soaps- thesis- antithesis- synthesis (1982) (0)
Bioconductor packages for analysis of Thermal Proteome Profiling data (2020) (0)
Interactions between explicit and latent covariates detect cell-type specific treatment effects in exploratory single cell analysis without clustering (2020) (0)
Bioconductor Project Bioconductor Project Working Papers Year Paper Error models for microarray intensities (2013) (0)
Dissecting intratumour heterogeneity of nodal B-cell lymphomas at the transcriptional, genetic and drug-response levels (2020) (0)
TRANSCRIPTIONAL AND GENOMIC INTRA‐TUMOR HETEROGENEITY DRIVES SUBCLONE SPECIFIC DRUG RESPONSES IN DIFFUSE LARGE B CELL LYMPHOMA (2019) (0)
Systematic Mapping Of Drug and Pathway Sensitivity In Chronic Lymphocytic Leukemia Identifies Synthetic Lethal Interactions Of Mutant p53 (2013) (0)
Author Correction: A computational method for detection of ligand-binding proteins from dose range thermal proteome profiles (2021) (0)
Drug-based perturbation screen uncovers synergistic drug combinations in Burkitt lymphoma (2018) (0)
High-throughput profiling of drug interactions in Gram-positive bacteria (2022) (0)
Author Correction: Inferring structural variant cancer cell fraction (2022) (0)
Thymic expression of tissue-restricted self-antigens is a highly coordinated and evolutionary conserved process (2016) (0)
842: Systematic phenotypic profiling of chemical-genetic interactions in human cancer cells (2014) (0)
Additional data file 1 (2007) (0)
Gene expression across mammalian organ development (2019) (0)
Statistische Datenbehandlung: Experimental design: a chemometric approach. Von S. N. Deming und S. L. Morgan. Elsevier, Amsterdam ‐ Oxford ‐ New York ‐ Tokyo 1987. 285 S., 150 Abb. $ 100.‐. lSBN 0‐444‐42734‐1 (1988) (0)
Author Correction: Patterns of somatic structural variation in human cancer genomes (2020) (0)
Phenotypic distance measures for image-based high-throughput screening (2013) (0)
Author Correction: Retrospective evaluation of whole exome and genome mutation calls in 746 cancer samples (2020) (0)
PhD and postdoc training outcomes at EMBL: changing career paths for life scientists in Europe (2022) (0)
>mmu-miR-1=miR-1 TACATACTTCTTTACATTCCA >hsa-let-7a=let-7a AACTATACAACCTACTACCTCA >hsa-miR-7=miR-7 AACAAAATCACTAGTCTTCCA >mmu-miR-9=miR-9 TCATACAGCTAGATAACCAAAGA >hsa-miR-9*=miR-9* ACTTTCGGTTATCTAGCTTTA >mmu-miR-15b=miR-15 TGTAAACCATGATGTGCTGCTA >hsa-miR-16=miR-16 CGCCAATATTTACGTGCTGCTA >hsa-miR-17-5 (2007) (0)
Fold Changes, Log Ratios, Background Correction, Shrinkage Estimation, and Variance Stabilization (2008) (0)
Bioconductor Project Bioconductor Project Working Papers Year Paper Visualizing Genomic Data (2013) (0)
1 Preprocessing Overview (0)
regions of the effect of variant size , type , and overlap with functional Relating CNVs to transcriptome data at fine resolution : Assessment Material (2011) (0)
Transcript Mapping with High-Density Tiling Arrays (2016) (0)
The Influence of the Bone Marrow Niche on Drug Response Phenotypes of Blood Cancers (2018) (0)
Solutions to Exercises (2008) (0)
Explorer Nuclear Architecture Organized by Rif 1 Underpins the Replication-Timing Program (2016) (0)
CSAMA 2014 : RNA-Seq differential expression workflow (2014) (0)
Abstract LB-305: A computational approach to identify recurrent somatic driver events in noncoding regions in human cancers (2015) (0)
Segmentation demo (2006) (0)
Genome analysis h5vc: scalable nucleotide tallies with HDF5 (2014) (0)
From ORFeome to Biology: Identification of Cancer Relevant Modulators of the Cell Cycle (2005) (0)
827: Ex vivo combinatorial screen to identify drug sensitivity and rational treatment of chronic lymphocytic leukemia (2014) (0)
BIOINFORMATICS Importing ArrayExpress datasets into R/Bioconductor (2009) (0)
Global landscape of hematopoietic stem cells and multipotent progenitors (2013) (0)
Metabolic balance in colorectal cancer is maintained by optimal Wnt signaling levels (2022) (0)
Supplement : Analyzing ChIP-chip data using Bioconductor (2009) (0)
Authoring Bioconductor workflows with BiocWorkflowTools (2018) (0)
Subgroups of T-Cell Prolymphocytic Leukemia (T-PLL) Discovered By High-Throughput Ex Vivo Drug Testing and Genetic Profiling (2015) (0)
Diagnostics for independent filtering : choosing filter statistic and cutoff (2016) (0)
Studies Using Graphs on Biological Data (2005) (0)
Introduction and Motivating Examples (2005) (0)
Evaluation of VST algorithm in lumi package (2007) (0)
Reactivation of Murine Cytomegalovirus Is Associated with Increased Gvhd Severity in Allogeneic Hematopoietic Cell Transplant Recipients (2013) (0)
Bioconductor Project Bioconductor Project Working Papers Year Paper Differential Expression with the Bioconductor Project (2013) (0)
Using Graphs for Interactome Data (2008) (0)
The Prolyl Hydroxylase Inhibitor Dimethyl Oxalyl Glycine Decreases the Severity of Acute Lung Injury After Allogeneic Hematopoietic Cell Transplantation. (2012) (0)
THE LANDSCAPE OF DRUG PERTURBATION EFFECTS IN LEUKEMIA AND LYMPHOMA (2019) (0)
Donor Neutrophils Contribute to Graft-Versus-Host-Disease Pathogenesis after Allogeneic Hematopoietic Cell Transplantation (2016) (0)
Author Correction: The evolutionary history of 2,658 cancers (2023) (0)

This paper list is powered by the following services:

Other Resources About Wolfgang Huber

en.wikipedia.org

What Schools Are Affiliated With Wolfgang Huber ?

Wolfgang Huber is affiliated with the following schools:

University of Regensburg

Wolfgang Huber 's Academic­Influence.com Rankings

Why Is Wolfgang Huber Influential?

Wolfgang Huber 's Published Works

Published Works

Other Resources About Wolfgang Huber

What Schools Are Affiliated With Wolfgang Huber ?

Wolfgang Huber 's AcademicInfluence.com Rankings