Yoshihide Tsujimoto
#107,344
Most Influential Person Now
Yoshihide Tsujimoto's AcademicInfluence.com Rankings
Yoshihide Tsujimotobiology Degrees
Biology
#5728
World Rank
#8275
Historical Rank
Cell Biology
#162
World Rank
#169
Historical Rank
Molecular Biology
#543
World Rank
#556
Historical Rank

Download Badge
Biology
Yoshihide Tsujimoto's Degrees
- PhD Molecular Biology University of Tokyo
- Masters Biochemistry University of Tokyo
- Bachelors Biology University of Tokyo
Similar Degrees You Can Earn
Why Is Yoshihide Tsujimoto Influential?
(Suggest an Edit or Addition)Yoshihide Tsujimoto's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- Molecular mechanisms of cell death: recommendations of the Nomenclature Committee on Cell Death 2018 (2018) (3106)
- Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC (1999) (2234)
- Guidelines for the use and interpretation of assays for monitoring cell death in higher eukaryotes (2009) (2078)
- Involvement of the bcl-2 gene in human follicular lymphoma. (1985) (1884)
- Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. (1984) (1793)
- Role of Bcl-2 family proteins in a non-apoptotic programmed cell death dependent on autophagy genes (2004) (1439)
- Cyclophilin D-dependent mitochondrial permeability transition regulates some necrotic but not apoptotic cell death (2005) (1272)
- Intracellular ATP levels determine cell death fate by apoptosis or necrosis. (1997) (1268)
- Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. (1986) (1154)
- The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. (1985) (1028)
- Bax interacts with the permeability transition pore to induce permeability transition and cytochrome c release in isolated mitochondria. (1998) (998)
- Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and Aβ-induced cell death (2004) (862)
- Discovery of Atg5/Atg7-independent alternative macroautophagy (2009) (861)
- Essential versus accessory aspects of cell death: recommendations of the NCCD 2015 (2014) (799)
- Another way to die: autophagic programmed cell death (2005) (756)
- Prevention of programmed cell death of sympathetic neurons by the bcl-2 proto-oncogene. (1992) (742)
- Bcl‐2 family: Life‐or‐death switch (2000) (699)
- Molecular cloning of the chromosomal breakpoint of B-cell lymphomas and leukemias with the t(11;14) chromosome translocation. (1984) (687)
- Role of Bcl‐2 family proteins in apoptosis: apoptosomes or mitochondria? (1998) (635)
- Prevention of hypoxia-induced cell death by Bcl-2 and Bcl-xL (1995) (631)
- JNK promotes Bax translocation to mitochondria through phosphorylation of 14‐3‐3 proteins (2004) (555)
- Role of the mitochondrial membrane permeability transition in cell death (2007) (540)
- PRAD1, a candidate BCL1 oncogene: mapping and expression in centrocytic lymphoma. (1991) (479)
- Effect of bcl-2 on Fas antigen-mediated cell death. (1993) (454)
- Clustering of breakpoints on chromosome 11 in human B-cell neoplasms with the t(11 ; 14) chromosome translocation (1985) (439)
- Bcl-2 prevents apoptotic mitochondrial dysfunction by regulating proton flux. (1998) (428)
- Acinus is a caspase-3-activated protein required for apoptotic chromatin condensation (1999) (425)
- Cell death regulation by the Bcl‐2 protein family in the mitochondria (2003) (412)
- BH4 domain of antiapoptotic Bcl-2 family members closes voltage-dependent anion channel and inhibits apoptotic mitochondrial changes and cell death. (2000) (406)
- Three distinct IL-2 signaling pathways mediated by bcl-2, c-myc, and lck cooperate in hematopoietic cell proliferation (1995) (402)
- Induction of apoptosis as well as necrosis by hypoxia and predominant prevention of apoptosis by Bcl-2 and Bcl-XL. (1996) (387)
- Essential Role of Voltage-Dependent Anion Channel in Various Forms of Apoptosis in Mammalian Cells (2001) (373)
- 14-3-3 Interacts Directly with and Negatively Regulates Pro-apoptotic Bax* (2003) (347)
- Electrophysiological Study of a Novel Large Pore Formed by Bax and the Voltage-dependent Anion Channel That Is Permeable to Cytochrome c * (2000) (345)
- Bcl-2 blocks loss of mitochondrial membrane potential while ICE inhibitors act at a different step during inhibition of death induced by respiratory chain inhibitors. (1996) (329)
- VDAC regulation by the Bcl-2 family of proteins (2000) (327)
- Molecular mechanisms of cell death: recommendations of the Nomenclature Committee on Cell Death 2018 (2018) (323)
- Multiple subcellular localization of bcl-2: detection in nuclear outer membrane, endoplasmic reticulum membrane, and mitochondrial membranes. (1994) (319)
- Apoptosis and necrosis: Intracellular ATP level as a determinant for cell death modes (1997) (309)
- Involvement of Histone H1.2 in Apoptosis Induced by DNA Double-Strand Breaks (2003) (305)
- Mutation in ankyrin repeats of the mouse Notch2 gene induces early embryonic lethality. (1999) (300)
- Proapoptotic BH3-only Bcl-2 family members induce cytochrome c release, but not mitochondrial membrane potential loss, and do not directly modulate voltage-dependent anion channel activity. (2000) (289)
- Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-determining region (CDR-III)-specific probes. (1989) (286)
- Retardation of chemical hypoxia-induced necrotic cell death by Bcl-2 and ICE inhibitors: possible involvement of common mediators in apoptotic and necrotic signal transductions. (1996) (278)
- Bcl-2 expression prevents activation of the ICE protease cascade. (1996) (271)
- Neonatal motoneurons overexpressing the bcl-2 protooncogene in transgenic mice are protected from axotomy-induced cell death. (1994) (259)
- Fzo1, a Protein Involved in Mitochondrial Fusion, Inhibits Apoptosis* (2004) (254)
- The voltage-dependent anion channel: an essential player in apoptosis. (2002) (252)
- bcl-2 deficiency in mice leads to pleiotropic abnormalities: accelerated lymphoid cell death in thymus and spleen, polycystic kidney, hair hypopigmentation, and distorted small intestine. (1995) (245)
- Stress-resistance conferred by high level of bcl-2 alpha protein in human B lymphoblastoid cell. (1989) (239)
- Molecular cloning and characterization of an antigen associated with early stages of melanoma tumor progression. (1988) (235)
- Gelsolin Inhibits Apoptosis by Blocking Mitochondrial Membrane Potential Loss and Cytochrome c Release* (2000) (232)
- Nuclear Translocation of Caspase-3 Is Dependent on Its Proteolytic Activation and Recognition of a Substrate-like Protein(s)* (2005) (222)
- Characterization of the protein product of bcl-2, the gene involved in human follicular lymphoma. (1987) (213)
- Ceramide Formation Leads to Caspase-3 Activation during Hypoxic PC12 Cell Death (1998) (209)
- Regulation of bcl-2 proto-oncogene expression during normal human lymphocyte proliferation. (1987) (207)
- Mitochondria and Cell Death (2000) (205)
- Molecular analysis of mbcl-2: Structure and expression of the murine gene homologous to the human gene involved in follicular lymphoma (1987) (205)
- Abrogation of Fas-induced fulminant hepatic failure in mice by hepatocyte growth factor. (1998) (204)
- Lysophosphatidylcholine as a death effector in the lipoapoptosis of hepatocytess⃞s⃞ The online version of this article (available at http://www.jlr.org) contains supplementary data in the form of three figures. Published, JLR Papers in Press, October 18, 2007. (2008) (204)
- Synergistic anti-apoptotic activity between Bcl-2 and SMN implicated in spinal muscular atrophy (1997) (201)
- Nitric oxide induces upregulation of Fas and apoptosis in vascular smooth muscle. (1996) (198)
- Bis, a Bcl-2-binding protein that synergizes with Bcl-2 in preventing cell death (1999) (192)
- Mitochondrial membrane permeability transition and cell death. (2006) (189)
- Cyclic bcl-2 gene expression in human uterine endometrium during menstrual cycle (1994) (184)
- A novel protein, RTN-xS, interacts with both Bcl-xL and Bcl-2 on endoplasmic reticulum and reduces their anti-apoptotic activity (2000) (180)
- The t(8; 14) chromosomal translocation occurring in B-cell malignancies results from mistakes in V–D–J joining (1986) (179)
- ATP-dependent steps in apoptotic signal transduction. (1999) (177)
- Type I interferons are essential mediators of apoptotic death in virally infected cells (1998) (176)
- Preferential linkage of bcl-2 to immunoglobulin light chain gene in chronic lymphocytic leukemia (1990) (176)
- Bcl-2 Prevents Caspase-independent Cell Death* (1998) (171)
- Involvement of CPP32/Yama(-like) proteases in Fas-mediated apoptosis. (1996) (169)
- Bax and Bcl-xL independently regulate apoptotic changes of yeast mitochondria that require VDAC but not adenine nucleotide translocator (2000) (165)
- 150-kDa Oxygen-regulated Protein (ORP150) Suppresses Hypoxia-induced Apoptotic Cell Death* (1999) (165)
- Involvement of JNK in the regulation of autophagic cell death (2010) (160)
- Mitochondrial permeability transition mediates apoptosis induced by N‐methyl(R)salsolinol, an endogenous neurotoxin, and is inhibited by Bcl‐2 and rasagiline, N‐propargyl‐1(R)‐aminoindan (2002) (160)
- Oncogene activation by chromosome translocation in human malignancy. (1987) (153)
- DNA rearrangements in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene. (1987) (147)
- Expression of the bcl-2 gene in human multiple myeloma cell lines and normal plasma cells. (1992) (144)
- Neuroaxonal Dystrophy Caused by Group VIA Phospholipase A2 Deficiency in Mice: A Model of Human Neurodegenerative Disease (2008) (142)
- Apoptotic cytosol facilitates Bax translocation to mitochondria that involves cytosolic factor regulated by Bcl-2. (1999) (141)
- Human gelsolin prevents apoptosis by inhibiting apoptotic mitochondrial changes via closing VDAC (2000) (141)
- The human T-cell leukemia virus type I Tax protein induces apoptosis which is blocked by the Bcl-2 protein (1994) (135)
- Differential effects of Bcl-2 on T and B cells in transgenic mice. (1992) (135)
- Bcl-2/E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with Bcl-2/Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability (1999) (130)
- Activation of mitochondrial voltage-dependent anion channel by apro-apoptotic BH3-only protein Bim (2002) (128)
- Overexpression of the human BCL-2 gene product results in growth enhancement of Epstein-Barr virus-immortalized B cells. (1989) (127)
- Inhibition of apoptosis by the actin‐regulatory protein gelsolin (1997) (124)
- Isolation and characterization of the chicken bcl-2 gene: expression in a variety of tissues including lymphoid and neuronal organs in adult and embryo. (1992) (121)
- The dna sequence of bombyx mori fibroin gene including the 5′ flanking, mRNA coding, entire intervening and fibroin protein coding regions (1979) (120)
- Evolution of B-cell malignancy: pre-B-cell leukemia resulting from MYC activation in a B-cell neoplasm with a rearranged BCL2 gene. (1988) (119)
- Amelioration of hippocampal neuronal damage after global ischemia by neuronal overexpression of BCL-2 in transgenic mice. (1998) (116)
- A cloning method for caspase substrates that uses the yeast two-hybrid system: cloning of the antiapoptotic gene gelsolin. (1998) (114)
- Antiapoptotic function of 17AA(+)WT1 (Wilms' tumor gene) isoforms on the intrinsic apoptosis pathway (2006) (113)
- Bcl-2 and Bcl-xL block apoptosis as well as necrosis: possible involvement of common mediators in apoptotic and necrotic signal transduction pathways. (1997) (113)
- Bcl-2 Family of Proteins: Life-or-Death Switch in Mitochondria (2002) (113)
- Opening of plasma membrane voltage-dependent anion channels (VDAC) precedes caspase activation in neuronal apoptosis induced by toxic stimuli (2005) (112)
- Transgenic mouse sperm that have green acrosome and red mitochondria allow visualization of sperm and their acrosome reaction in vivo. (2010) (111)
- Functional conservation of mouse Notch receptor family members (1996) (109)
- BH4-domain peptide from Bcl-xL exerts anti-apoptotic activity in vivo (2003) (109)
- Isolation, mapping, and functional analysis of a novel human cDNA (BNIP3L) encoding a protein homologous to human NIP3 (1998) (107)
- Structural analysis of the fibroin gene at the 5′ end and its surrounding regions (1979) (106)
- Involvement of caspase-4(-like) protease in Fas-mediated apoptotic pathway (1997) (104)
- Neuroaxonal Dystrophy in Calcium-Independent Phospholipase A2β Deficiency Results from Insufficient Remodeling and Degeneration of Mitochondrial and Presynaptic Membranes (2011) (100)
- Correlation of CD2 expression with PML gene breakpoints in patients with acute promyelocytic leukemia. (1992) (99)
- Essential role of active nuclear transport in apoptosis (1997) (98)
- Cell death: regulation by the Bcl‐2 protein family (2006) (95)
- The chromosome 14 breakpoint in neoplastic B cells with the t(11;14) translocation involves the immunoglobulin heavy chain locus. (1984) (95)
- PLA2 activity is required for nuclear shrinkage in caspase-independent cell death (2003) (94)
- Direct interaction of the mitochondrial membrane protein carnitine palmitoyltransferase I with Bcl-2. (1997) (89)
- Localization of the human pim oncogene (PIM) to a region of chromosome 6 involved in translocations in acute leukemias. (1986) (87)
- Cytokine-induced apoptotic cell death in a mouse pancreatic beta-cell line: inhibition by Bcl-2 (1996) (87)
- The rck/p54 candidate proto-oncogene product is a 54-kilodalton D-E-A-D box protein differentially expressed in human and mouse tissues. (1995) (87)
- Bcl-2 confers growth and survival advantage to interleukin 7-dependent early pre-B cells which become factor independent by a multistep process in culture. (1992) (81)
- A thermostable collagenolytic protease with a very large molecular mass produced by thermophilic Bacillus sp. strain MO-1 (2001) (80)
- Involvement of Fas in regression of vaginal epithelia after ovariectomy and during an estrous cycle. (1996) (80)
- Variant translocation of the bcl-2 gene to immunoglobulin lambda light chain gene in chronic lymphocytic leukemia. (1989) (80)
- Bcl2 enhances survival of newborn neurons in the normal and ischemic hippocampus (2006) (75)
- The reciprocal partners of both the t(14; 18) and the t(11; 14) translocations involved in B-cell neoplasms are rearranged by the same mechanism. (1988) (73)
- Differential expression of Notch1 and Notch2 in developing and adult mouse brain. (1995) (71)
- The human c-ros gene (ROS) is located at chromosome region 6q16----6q22. (1986) (71)
- Prevention of hypoxic liver cell necrosis by in vivo human bcl-2 gene transfection. (1998) (67)
- Involvement of ICE family proteases in apoptosis induced by reoxygenation of hypoxic hepatocytes. (1996) (67)
- Accelerated disappearance of melanocytes in bcl-2-deficient mice. (1996) (67)
- Role of Atg5-dependent cell death in the embryonic development of Bax/Bak double-knockout mice (2017) (66)
- Chromosome translocations and B cell neoplasia. (1984) (65)
- MPP+ induces necrostatin-1- and ferrostatin-1-sensitive necrotic death of neuronal SH-SY5Y cells (2017) (64)
- Golgi membrane‐associated degradation pathway in yeast and mammals (2016) (63)
- Neuronal differentiation of PC12 cells as a result of prevention of cell death by bcl-2. (1994) (61)
- A functional role for death proteases in s-Myc- and c-Myc-mediated apoptosis (1997) (60)
- Association of insulin receptor substrate proteins with Bcl-2 and their effects on its phosphorylation and antiapoptotic function. (2000) (60)
- Gene transfection of mouse primordial germ cells in vitro and analysis of their survival and growth control. (1997) (59)
- The bcl-2 gene encodes a novel G protein (1989) (57)
- Caspase-dependent apoptosis of COS-7 cells induced by Bax overexpression: differential effects of Bcl-2 and Bcl-xL on Bax-induced caspase activation and apoptosis (1997) (57)
- Identification of NRF2, a member of the NF-E2 family of transcription factors, as a substrate for caspase-3(-like) proteases (1999) (57)
- Crystal structure of human cyclophilin D in complex with its inhibitor, cyclosporin A at 0.96‐Å resolution (2007) (56)
- Susceptibility of Cerebellar Granule Neurons Derived from Bcl‐2‐Deficient and Transgenic Mice to Cell Death (1997) (56)
- BH 4 domain of antiapoptotic Bcl-2 family members closes voltage-dependent anion channel and inhibits apoptotic mitochondrial changes and cell death (2000) (55)
- Mechanisms of chromosome translocation in B- and T-cell neoplasia (1987) (54)
- Requirement of voltage-dependent anion channel 2 for pro-apoptotic activity of Bax (2009) (53)
- Death‐signalling cascade in mouse cerebellar granule neurons (1998) (52)
- Potential Z-DNA elements surround the breakpoints of chromosome translocation within the 5' flanking region of bcl-2 gene. (1990) (51)
- Caspase-4 and caspase-5, members of the ICE/CED-3 family of cysteine proteases, are CrmA-inhibitable proteases (1997) (50)
- The t(8;14) chromosome translocation of the Burkitt lymphoma cell line Daudi occurred during immunoglobulin gene rearrangement and involved the heavy chain diversity region. (1987) (50)
- BH4 peptide derivative from Bcl-xL attenuates ischemia/reperfusion injury thorough anti-apoptotic mechanism in rat hearts. (2005) (47)
- Deleterious effects of mitochondrial ROS generated by KillerRed photodynamic action in human cell lines and C. elegans. (2012) (47)
- Reactive Astrocytes Express Bis, a Bcl-2-Binding Protein, after Transient Forebrain Ischemia (2002) (46)
- Gene cloning, expression, and crystallization of a thermostable exo-inulinase from Geobacillus stearothermophilus KP1289 (2003) (45)
- Promoter sequence of fibroin gene assigned by in vitro transcription system. (1981) (44)
- Regulation of bcl-2 gene expression in lymphoid cell lines containing normal #18 or t(14;18) chromosomes. (1989) (43)
- Molecular cloning of a human immunoglobulin λ chain variable sequence (1984) (43)
- A-Kinase-Anchoring Protein 95 Functions as a Potential Carrier for the Nuclear Translocation of Active Caspase 3 through an Enzyme-Substrate-Like Association (2005) (39)
- Bcl2 Deficiency Activates FoxO through Akt Inactivation and Accelerates Osteoblast Differentiation (2014) (37)
- High expression of α-synuclein in damaged mitochondria with PLA2G6 dysfunction (2016) (37)
- Cytogenetic 2; 18 and 18; 22 translocation in chronic lymphocytic leukemia with juxtaposition of bcl-2 and immunoglobulin light chain genes. (1992) (36)
- A Bax/Bak-independent Mechanism of Cytochrome c Release* (2007) (34)
- Molecular cloning of the chromosomal breakpoint of a B-cell lymphoma with the t(11;14)(q23;q32) translocation. (1991) (33)
- Bis deficiency results in early lethality with metabolic deterioration and involution of spleen and thymus. (2008) (32)
- Methioninase gene therapy with selenomethionine induces apoptosis in bcl-2-overproducing lung cancer cells (2003) (32)
- CA Repeats in the 3′-Untranslated Region of bcl-2 mRNA Mediate Constitutive Decay of bcl-2 mRNA*♦ (2004) (31)
- Activin A‐induced apoptosis is suppressed by BCL‐2 (1995) (31)
- Dose-dependent doxycycline-mediated adrenocorticotropic hormone secretion from encapsulated Tet-on proopiomelanocortin Neuro2A cells in the subarachnoid space. (1998) (31)
- Juxtaposition of human bcl-2 and immunoglobulin lambda light chain gene in chronic lymphocytic leukemia is the result of a reciprocal chromosome translocation between chromosome 18 and 22. (1989) (31)
- hnRNP L binds to CA repeats in the 3'UTR of bcl-2 mRNA. (2009) (30)
- Molecular cloning and functional analysis of the murine bax gene promoter. (1999) (29)
- Chromosomal orientation of the lambda light chain locus: Vλ is proximal to Cλ in 22q11 (1985) (29)
- Molecular genetics of human B-cell neoplasia. (1986) (29)
- Regions essential for the interaction between Bcl-2 and SMN, the spinal muscular atrophy disease gene product (2000) (28)
- Bcl-2 Protects Tubular Epithelial Cells from Ischemia Reperfusion Injury by Inhibiting Apoptosis (2008) (27)
- Evidence against a functional site for Bcl-2 downstream of caspase cascade in preventing apoptosis (1997) (26)
- Delayed‐onset caspase‐dependent massive hepatocyte apoptosis upon fas activation in bak/bax‐deficient mice (2011) (26)
- The t(8;14) breakpoint of the EW 36 undifferentiated lymphoma cell line lies 5' of MYC in a region prone to involvement in endemic Burkitt's lymphomas. (1988) (26)
- Notch2 is required for formation of the placental circulatory system, but not for cell-type specification in the developing mouse placenta. (2007) (25)
- Molecular characterization of a t(11;14)(q23;q32) chromosome translocation in a B-cell lymphoma. (1990) (23)
- Moloney murine leukemia virus infection accelerates lymphomagenesis in E mu-bcl-2 transgenic mice. (1995) (23)
- Localization of 11q13 loci with respect to regional chromosomal breakpoints. (1992) (23)
- 14-3-3 interacts directly with and negatively regulates pro-apoptotic Bax. (2015) (22)
- Noxa is necessary for hydrogen peroxide‐induced caspase‐dependent cell death (2010) (22)
- Essential role of p38 MAPK in caspase‐independent, iPLA2‐dependent cell death under hypoxia/low glucose conditions (2009) (21)
- Analysis of Two Major Intracellular Phospholipases A2 (PLA2) in Mast Cells Reveals Crucial Contribution of Cytosolic PLA2α, Not Ca2+-independent PLA2β, to Lipid Mobilization in Proximal Mast Cells and Distal Fibroblasts* (2011) (21)
- The role of Cyclophilin D in learning and memory (2009) (21)
- Bcl-2 expression in the thymus and periphery. (1994) (21)
- Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage. (2005) (20)
- Multiple ways to die: Non-apoptotic forms of cell death (2012) (19)
- Deficiency of Calcium-Independent Phospholipase A2 Beta Induces Brain Iron Accumulation through Upregulation of Divalent Metal Transporter 1 (2015) (18)
- A Caspase-8-independent Signaling Pathway Activated by Fas Ligation Leads to Exposure of the Bak N Terminus* (2004) (18)
- correction: BcL-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC (2000) (18)
- Long-Term Functional Assessment of Encapsulated Cells Transfected with Tet-On System (1999) (18)
- Synchronized necrotic death of attached hepatocytes mediated via gap junctions (2014) (17)
- D11S146 and BCL1 are physically linked but can be discriminated by their amplification status in human breast cancer. (1991) (16)
- Vital staining for cell death identifies Atg9a-dependent necrosis in developmental bone formation in mouse (2016) (16)
- Molecular Cloning and Characterization of an Antigen Associated with Early Stages of Melanoma Tumor Progression 1 (2006) (16)
- Molecular genetics of human B- and T-cell neoplasia. (1986) (16)
- Localization ofbcl-2, bax, andbcl-x mRNAs in the developing inner ear of the mouse (1996) (15)
- Molecular genetics of lymphoid tumorigenesis. (1989) (14)
- Natural fibroin genes purified without using cloning procedures from fibroin-producing and -nonproducing tissues reveal indistinguishable structure and function. (1984) (13)
- Recent progress on the human bcl-2 gene involved in follicular lymphoma: characterization of the protein products. (1988) (13)
- Vascular smooth muscle maintains the levels of Bcl-2 in endothelial cells. (2001) (13)
- Corrigendum: Discovery of Atg5/Atg7-independent alternative macroautophagy (2016) (12)
- Inhibition of epithelial cell death by Bcl-2 improved chronic colitis in IL-10 KO mice. (2013) (12)
- Prevention of neuronal cell death by Bcl-2. (1998) (11)
- Cell ablation by ectopic expression of cell death genes, ced‐3 and Ice, in Drosophila (1997) (11)
- Molecular cloning of the breakpoint of t(11;22)(q23;q11) chromosome translocation in an adult acute myelomonocytic leukaemia (1996) (10)
- Role of RIP1 in physiological enterocyte turnover in mouse small intestine via nonapoptotic death (2015) (10)
- Structures of the Small-Molecule Bcl-2 Inhibitor (BH3I-2) and Its Related Simple Model in Protonated and Deprotonated Forms (2004) (9)
- Ohtsu, M. et al. Inhibition of apoptosis by the actin-regulatory protein gelsolin. EMBO J. 16, 4650-4656 (1997) (9)
- Modulation of LFA-1 surface antigen expression by activated H-ras oncogene in EBV-infected human B-lymphoblast cells. (1991) (9)
- Role of anti-apoptotic Bcl-2 protein in spinal muscular atrophy. (2000) (9)
- Cyclophilin D-dependent mitochondrial permeability transition is not involved in neurodegeneration in mnd2 mutant mice. (2010) (8)
- Progressive Axonal Degeneration of Nigrostriatal Dopaminergic Neurons in Calcium-Independent Phospholipase A2β Knockout Mice (2016) (8)
- Transferrin receptor 1 is required for enucleation of mouse erythroblasts during terminal differentiation (2019) (8)
- Chromosomal orientation of the lambda light chain locus: V lambda is proximal to C lambda in 22q11. (1985) (8)
- bcl-2: antidote for cell death. (1996) (7)
- [Molecular biology of apoptosis]. (1997) (6)
- Long‐range mapping of the 11q23 region involved in chromosome aberrations in human tumors by pulsed‐field gel electrophoresis with a yeast artificial chromosome (1993) (6)
- Overexpressed Bcl-xL prevents bacterial superantigen-induced apoptosis of thymocytes in vitro (1997) (6)
- Requirement of voltage-dependent anion channel 2 for pro-apoptotic activity of Bax (2010) (6)
- Correlation of CD 2 Expression With PML Gene Breakpoints in Patients With Acute Promyelocytic Leukemia (2003) (6)
- Chromosomal assignment of the Bcl2-related genes, Bcl2l and Bax, in the mouse and rat. (1996) (6)
- ARTIFICIAL FERTILIZATION, EARLY DEVELOPMENT AND CHROMOSOME NUMBERS IN THE BRACHIOPOD LINGULA ANATINA (2010) (6)
- Molecular cloning of a human immunoglobulin lambda chain variable sequence. (1984) (5)
- Deletion of the bis gene results in a marked increase in the production of corticosterone that is associated with thymic atrophy in mice. (2011) (5)
- [Molecular mechanism of apoptosis]. (1998) (5)
- Targeted expression of ced-3 and Ice induces programmed cell death in Drosophila (1997) (5)
- Screening of cell death genes with a mammalian genome-wide RNAi library. (2010) (5)
- Cell Death in Thymus and Spleen, Polycystic Kidney, Hair Hypopigmentation, and Distorted Small Intestine1 (1995) (5)
- [Inhibition of apoptosis by a baculovirus p35 gene]. (1996) (4)
- Molecular mechanisms involved in human B and T cell neoplasia. (1986) (4)
- 150-kDa Oxygen-regulated Protein ( ORP 150 ) Suppresses Hypoxia-induced Apoptotic Cell (1999) (4)
- Two distinct Fas-activated signaling pathways revealed by an antitumor drug D609 (2005) (4)
- Crystal structure of human cyclophilin D in complex with cyclosporin A (2008) (4)
- Associated with Early Stages of Melanoma Tumor Progression Molecular Cloning and Characterization of an Antigen Updated (2006) (3)
- Prevention of cell death by Bcl-2 (1998) (3)
- Involvement of apoptosis and cholinergic dysfunction in Alzheimer’s disease (2006) (3)
- Three dimensional structure of pallasite Esquel by X-ray computed tomography. (1999) (3)
- Analysis of Two Major Intracellular Phospholipase A 2 s in Mast Cells Reveals Crucial Contribution of cPLA 2 α , not iPLA 2 β , to Lipid Mobilization in Proximal Mast Cells and Distal Fibroblasts (2011) (2)
- The 3rd German-Japanese Joint Workshop. Cell Death in the CNS: Molecules and Programs (1996) (2)
- An investigation into the role of Bcl-2 in neuroendocrine differentiation. (2005) (2)
- MITCHELL MEDAL LECTURE (2006) (1)
- I-1 Transcription Regulation of Silk Genes (1984) (1)
- A vehicle for DNA transfer and for recovery of transferred genes: lambda Charon phage-pBR322 hybrid. (1983) (1)
- Germ line configuration of the BCL-2 major breakpoint region in hyperplastic lymph nodes. (1991) (1)
- PROTECTION OF MITOCHONDRIAL POTENTIAL LOSS BY BCL-2 IN APOPTOSIS AND NECROSIS (1996) (1)
- Molecular Mechanism of Genetic Recombination in Bacteriophage T7 (1977) (1)
- Transcription regulation of silk genes. (1984) (1)
- Molecular genetics of B- and T-cell neoplasia. (1986) (1)
- [Molecular biology of cell death]. (1994) (0)
- Diagnostic methods for the detection of lymphoma in humans. (1987) (0)
- Chromosome translocations in human B-cell neoplasms. (1988) (0)
- Abstract 102: The Detrimental Role Of iPLA2β In Ischemia/reperfusion Injury (2013) (0)
- Inhibition of non-apoptotic cell death by HDAC inhibitors (2015) (0)
- REGULATION OF CELL DEATH BY THE BCL-2 FAMILY OF PROTEINS (2002) (0)
- Immunohistochemistry and Western blotting analyses for 4-HNE in iPLA 2 β-KO mice. (2015) (0)
- [Prevention of cell death by Bcl-2 family genes]. (1996) (0)
- TGAAATGCAGTGGTCGTTACGC TCCACC AAGAAAGCAGGAACC TGTGGTATGAA CAAATCAA CTTATGTGT TGACC TTTAGAGAGTTGC TTACGTGGCC TGTTCAACACAGACCCACCC AGAGCCC TCC TGCCC TCC TTCCGCGGGGGC T TTC TC AGGC TGTCC TTC AGGGTC TTCCTGAAATGC AGTGG TCGTT CGC ACCAAGAAAGCAGGAAC TGGTATGAA CGAATCAACTTATGTGTTGAC TTAGAGAG TGCTTAC TGGCCTGTT (0)
- 173 BCL-XL activates human transglutaminase 1 promoter in keratinocytes (1997) (0)
- P121. Role of non-apoptotic cell death during mouse placental vasculogenesis (2010) (0)
- Involvement of ICE-like proteases in hypoxic cell death. (1996) (0)
- Induction of osteoblast differentiation by FoxOs. (2014) (0)
- [B-CLL and bcl-2 gene]. (1991) (0)
- Title Bcl 2 Deficiency Activates FoxO through Akt Inactivation and AcceleratesOsteoblast Differentiation (2019) (0)
- Molecular basis of apoptosis : Bcl-2 family proteins as a life-or-death switch (2002) (0)
- BH4 merged polypeptide (2000) (0)
- DNA Damages and Apoptosis (2003) (0)
- Carcinogenesis and cell death suppresion.Mainly on bcl-2. (1994) (0)
- Regulation of apoptosis and necrosis by Bcl-2 and ICE family proteases. (1996) (0)
- 4 and other hand , the Bcl-2 proto-oncogene product ( Bakhshi (2013) (0)
- High expression of α-synuclein in damaged mitochondria with PLA2G6 dysfunction (2016) (0)
- Prevention of Neuronal (eil Death by BcI-2 (1998) (0)
- Table of Contents (1996) (0)
- Regulation of cell death via mitochondrial channel (2004) (0)
- S-4-2 DNA Damages and Apoptosis(Aiming Further Development of Radiotherapy, Abstracts of the 46th Annual Meeting of the Japan Radiation Research Society) (2003) (0)
- EcoRI-sensitive mutation of T7 phage (1977) (0)
- Study of the novel mechanism of MPP+-induced necrotic neuronal cell death in neuronal SH-SY5Y cells (2016) (0)
- Cell death and cardiac remodeling (2008) (0)
- Involvement ofFasinregression ofvaginal epithelia after ovariectomy andduring an estrouscycle (1996) (0)
- [Structure and function of the silk fibroin gene (author's transl)]. (1979) (0)
- bcl-2 : antidote for apoptotic cell death (1993) (0)
- Molecular genetics of human B cell neoplasia. (1986) (0)
- Diagnostic methods for evidence of lymphoma in humans. (1987) (0)
- 718 In situ localization of BCL-2 mrna in the mouse central nervous system (1993) (0)
- Molecular Mechanism and Physiology of Apoptosis (2014) (0)
This paper list is powered by the following services:
What Schools Are Affiliated With Yoshihide Tsujimoto?
Yoshihide Tsujimoto is affiliated with the following schools: