Yoshinobu Takakura

Yoshinobu Takakura's AcademicInfluence.com Rankings

Yoshinobu Takakura

Computer Science

#7395

World Rank

#7789

Historical Rank

Machine Learning

#2710

World Rank

#2745

Historical Rank

Artificial Intelligence

#3006

World Rank

#3052

Historical Rank

Database

#4456

World Rank

#4633

Historical Rank

computer-science Degrees

Download Badge

Computer Science

Yoshinobu Takakura's Degrees

PhD Computer Science Kyoto University
Masters Computer Science Kyoto University
Bachelors Computer Science Kyoto University

Similar Degrees You Can Earn

Why Is Yoshinobu Takakura Influential?

(Suggest an Edit or Addition)

(See a Problem?)

Yoshinobu Takakura's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Visualization and in vivo tracking of the exosomes of murine melanoma B16-BL6 cells in mice after intravenous injection. (2013) (503)
The Fate of Plasmid DNA After Intravenous Injection in Mice: Involvement of Scavenger Receptors in Its Hepatic Uptake (1995) (365)
Macrophage-dependent clearance of systemically administered B16BL6-derived exosomes from the blood circulation in mice (2015) (334)
In vitro cytotoxicity of macromolecules in different cell culture systems (1995) (311)
The 4F2hc/LAT1 complex transports l-DOPA across the blood–brain barrier (2000) (245)
Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA. (2016) (212)
Macromolecular Carrier Systems for Targeted Drug Delivery: Pharmacokinetic Considerations on Biodistribution (1996) (183)
Quantitative analysis of tissue distribution of the B16BL6-derived exosomes using a streptavidin-lactadherin fusion protein and iodine-125-labeled biotin derivative after intravenous injection in mice. (2015) (182)
Cell-specific delivery of genes with glycosylated carriers. (2001) (173)
Catalase delivery for inhibiting ROS-mediated tissue injury and tumor metastasis. (2009) (173)
Effect of DNA/liposome mixing ratio on the physicochemical characteristics, cellular uptake and intracellular trafficking of plasmid DNA/cationic liposome complexes and subsequent gene expression. (2000) (173)
Interaction between DNA–cationic liposome complexes and erythrocytes is an important factor in systemic gene transfer via the intravenous route in mice: the role of the neutral helper lipid (2001) (168)
Possibility of Exosome-Based Therapeutics and Challenges in Production of Exosomes Eligible for Therapeutic Application. (2018) (164)
Biodegradable CpG DNA hydrogels for sustained delivery of doxorubicin and immunostimulatory signals in tumor-bearing mice. (2011) (159)
Physicochemical and pharmacokinetic characteristics of plasmid DNA/cationic liposome complexes. (1995) (158)
Asialoglycoprotein receptor-mediated gene transfer using novel galactosylated cationic liposomes. (1998) (154)
Hepatocyte-targeted in vivo gene expression by intravenous injection of plasmid DNA complexed with synthetic multi-functional gene delivery system (2000) (143)
Cell type‐specific and common characteristics of exosomes derived from mouse cell lines: Yield, physicochemical properties, and pharmacokinetics (2017) (142)
Design and development of nanosized DNA assemblies in polypod-like structures as efficient vehicles for immunostimulatory CpG motifs to immune cells. (2012) (142)
Disposition Characteristics of Macromolecules in Tumor-Bearing Mice (1990) (140)
Targeted delivery of plasmid DNA to hepatocytes in vivo: optimization of the pharmacokinetics of plasmid DNA/galactosylated poly(L-lysine) complexes by controlling their physicochemical properties. (1998) (136)
Targeted delivery of plasmid DNA complexed with galactosylated poly(L-lysine). (1998) (136)
Hepatic uptake of polystyrene microspheres in rats: effect of particle size on intrahepatic distribution. (1999) (134)
Prevention of neutrophil-mediated hepatic ischemia/reperfusion injury by superoxide dismutase and catalase derivatives. (2001) (133)
DNA nanotechnology-based composite-type gold nanoparticle-immunostimulatory DNA hydrogel for tumor photothermal immunotherapy. (2017) (132)
Effect of exosome isolation methods on physicochemical properties of exosomes and clearance of exosomes from the blood circulation. (2016) (132)
Nonviral vectors for in vivo gene delivery: physicochemical and pharmacokinetic considerations. (1997) (128)
Long circulating emulsion carrier systems for highly lipophilic drugs. (1994) (126)
Action mechanism of tachyplesin I and effects of PEGylation. (2007) (126)
Pharmacokinetics of Exosomes-An Important Factor for Elucidating the Biological Roles of Exosomes and for the Development of Exosome-Based Therapeutics. (2017) (121)
Effect of Particle Size and Charge on the Disposition of Lipid Carriers After Intratumoral Injection into Tissue-isolated Tumors (2004) (120)
In vivo disposition characteristics of plasmid DNA complexed with cationic liposomes. (1995) (118)
Role of Phosphatidylserine-Derived Negative Surface Charges in the Recognition and Uptake of Intravenously Injected B16BL6-Derived Exosomes by Macrophages. (2017) (118)
Hepatic uptake and gene expression mechanisms following intravenous administration of plasmid DNA by conventional and hydrodynamics-based procedures. (2001) (117)
Hydrodynamics‐based procedure involves transient hyperpermeability in the hepatic cellular membrane: implication of a nonspecific process in efficient intracellular gene delivery (2004) (117)
Intratumoral pharmacokinetics and in vivo gene expression of naked plasmid DNA and its cationic liposome complexes after direct gene transfer. (1997) (117)
Nonviral vector-mediated RNA interference: its gene silencing characteristics and important factors to achieve RNAi-based gene therapy. (2009) (114)
Targeted delivery of human recombinant superoxide dismutase by chemical modification with mono- and polysaccharide derivatives. (1992) (113)
Targeted delivery and improved therapeutic potential of catalase by chemical modification: combination with superoxide dismutase derivatives. (1999) (113)
Macromolecular drug carrier systems in cancer chemotherapy: macromolecular prodrugs. (1995) (111)
Heat shock protein derivatives for delivery of antigens to antigen presenting cells. (2008) (107)
Macrophage activation by a DNA/cationic liposome complex requires endosomal acidification and TLR9‐dependent and ‐independent pathways (2005) (104)
Preservation of exosomes at room temperature using lyophilization (2018) (103)
Gene expression and antitumor effects following direct interferon (IFN)-γ gene transfer with naked plasmid DNA and DC-chol liposome complexes in mice (1999) (102)
Injectable, self-gelling, biodegradable, and immunomodulatory DNA hydrogel for antigen delivery. (2014) (100)
The assembly of a short linear natural cytosine-phosphate-guanine DNA into dendritic structures and its effect on immunostimulatory activity. (2009) (99)
Enhanced immunostimulatory activity of oligodeoxynucleotides by Y‐shape formation (2008) (91)
Enhanced lymphatic delivery of mitomycin C conjugated with dextran. (1984) (91)
Effects of skin metabolism on percutaneous penetration of lipophilic drugs. (1997) (90)
Effects of erythrocytes and serum proteins on lung accumulation of lipoplexes containing cholesterol or DOPE as a helper lipid in the single-pass rat lung perfusion system. (2001) (90)
Physicochemical and disposition characteristics of antisense oligonucleotides complexed with glycosylated poly(L-lysine). (1997) (87)
Accelerated growth of B16BL6 tumor in mice through efficient uptake of their own exosomes by B16BL6 cells (2017) (87)
Therapeutic effects of superoxide dismutase derivatives modified with mono- or polysaccharides on hepatic injury induced by ischemia/reperfusion. (1992) (77)
Involvement of specific mechanism in plasmid DNA uptake by mouse peritoneal macrophages. (1998) (74)
Disposition and Tumor Localization of Mitomycin C–Dextran Conjugates in Mice (1987) (73)
Plasmid DNA activates murine macrophages to induce inflammatory cytokines in a CpG motif-independent manner by complex formation with cationic liposomes. (2002) (72)
Galactosylated proteins are recognized by the liver according to the surface density of galactose moieties. (1995) (69)
Effect of the content of unmethylated CpG dinucleotides in plasmid DNA on the sustainability of transgene expression (2009) (68)
Disposition and pharmacokinetics of a polymeric prodrug of mitomycin C, mitomycin C-dextran conjugate, in the rat. (1984) (68)
Pharmacokinetic evaluation of polymeric carriers (1996) (68)
The role of tissue macrophages in the induction of proinflammatory cytokine production following intravenous injection of lipoplexes (2002) (68)
Induction of Potent Antitumor Immunity by Sustained Release of Cationic Antigen from a DNA‐Based Hydrogel with Adjuvant Activity (2015) (68)
Sustained Exogenous Expression of Therapeutic Levels of IFN-γ Ameliorates Atopic Dermatitis in NC/Nga Mice via Th1 Polarization (2010) (66)
Development of a novel polymeric prodrug of mitomycin C, mitomycin C-dextran conjugate with anionic charge. II. Disposition and pharmacokinetics following intravenous and intramuscular administration (1987) (65)
Inhibition of metastatic tumor growth by targeted delivery of antioxidant enzymes. (2005) (64)
Vector-Based in Vivo RNA Interference: Dose- and Time-Dependent Suppression of Transgene Expression (2004) (64)
Fetuin mediates hepatic uptake of negatively charged nanoparticles via scavenger receptor. (2007) (62)
Inhibition of experimental hepatic metastasis by targeted delivery of catalase in mice (2004) (62)
Development of a novel polymeric prodrug of mitomycin C, mitomycin C-dextran conjugate with anionic charge. I. Physicochemical characteristics and in vivo and in vitro antitumor activities (1987) (62)
Blood concentrations of small extracellular vesicles are determined by a balance between abundant secretion and rapid clearance (2019) (62)
Pharmacokinetic analysis of in vivo disposition of succinylated proteins targeted to liver nonparenchymal cells via scavenger receptors: importance of molecular size and negative charge density for in vivo recognition by receptors. (2002) (61)
The hydrodynamics-based procedure for controlling the pharmacokinetics of gene medicines at whole body, organ and cellular levels. (2005) (59)
Role of Extracellular Vesicle Surface Proteins in the Pharmacokinetics of Extracellular Vesicles. (2018) (58)
Disposition of oligonucleotides in isolated perfused rat kidney: involvement of scavenger receptors in their renal uptake. (1996) (56)
Soluble macromolecular carriers for the delivery of antitumour drugs (1989) (56)
Significant Role of Liver Sinusoidal Endothelial Cells in Hepatic Uptake and Degradation of Naked Plasmid DNA After Intravenous Injection (2004) (56)
Pharmacokinetics and targeted delivery of proteins and genes (1996) (56)
Synthesis and pharmacokinetics of a novel macromolecular prodrug of Tacrolimus (FK506), FK506-dextran conjugate. (1999) (55)
Hepatic uptake of negatively charged particles in rats: possible involvement of serum proteins in recognition by scavenger receptor. (2004) (54)
Regeneration characteristics of mitomycin C-dextran conjugate in relation to its activity. (1983) (53)
Self-assembling DNA dendrimer for effective delivery of immunostimulatory CpG DNA to immune cells. (2015) (53)
Adiponectin Stimulates Exosome Release to Enhance Mesenchymal Stem-Cell-Driven Therapy of Heart Failure in Mice (2020) (52)
Development of targeted delivery systems for nucleic acid drugs. (1997) (52)
Therapeutic effect of intravenous interferon gene delivery with naked plasmid DNA in murine metastasis models. (2002) (52)
Pharmacokinetic characteristics and therapeutic effects of mitomycin C-dextran conjugates after intratumoural injection. (1998) (51)
Targeted delivery of drugs and proteins to the liver via receptor-mediated endocytosis (1997) (50)
Enhanced Class I Tumor Antigen Presentation via Cytosolic Delivery of Exosomal Cargos by Tumor-Cell-Derived Exosomes Displaying a pH-Sensitive Fusogenic Peptide. (2017) (50)
In vivo recognition of mannosylated proteins by hepatic mannose receptors and mannan-binding protein. (2001) (49)
Characterization of Plasmid DNA Binding and Uptake by Peritoneal Macrophages from Class A Scavenger Receptor Knockout Mice (1999) (48)
Therapeutic effect of intravenous delivery of lipoplexes containing the interferon-β gene and poly I: poly C in a murine lung metastasis model (2003) (48)
Hepatic Disposition Characteristics of Electrically Charged Macromolecules in Rat in Vivo and in the Perfused Liver (1991) (48)
Physico-chemical and antitumor characteristics of high molecular weight prodrugs of mitomycin C. (1982) (47)
Efficient scavenger receptor‐mediated uptake and cross‐presentation of negatively charged soluble antigens by dendritic cells (2004) (47)
Cellular interaction and in vitro antitumor activity of mitomycin C-dextran conjugate. (1986) (47)
Control of pharmacokinetic profiles of drug—macromolecule conjugates (1996) (47)
Corrigendum: Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion (2015) (47)
Influence of Physicochemical Properties on Pharmacokinetics of Non-viral Vectors for Gene Delivery (2002) (47)
Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases. (2005) (47)
Development of gene drug delivery systems based on pharmacokinetic studies. (2001) (46)
Biochemical and biopharmaceutical properties of macromolecular conjugates of uricase with dextran and polyethylene glycol. (1990) (45)
Pharmacokinetics and In Vivo Gene Transfer of Plasmid DNA Complexed with Mannosylated Poly(L-Lysine) in Mice (2000) (45)
Disposition Characteristics of Plasmid DNA in the Single-pass Rat Liver Perfusion System (1996) (45)
Restricted cytokine production from mouse peritoneal macrophages in culture in spite of extensive uptake of plasmid DNA (2004) (45)
Synthesis and Pharmacokinetics of a New Liver-Specific Carrier, Glycosylated Carboxymethyl-Dextran, and Its Application to Drug Targeting (2004) (45)
Controlled biodistribution of highly lipophilic drugs with various parenteral formulations. (1993) (45)
Uptake by hepatocytes and biliary excretion of intravenously administered polystyrene microspheres in rats. (1999) (45)
Surface hydrophobicity of particles is not necessarily the most important determinant in their in vivo disposition after intravenous administration in rats. (2001) (44)
Biliary excretion of polystyrene microspheres depends on the type of receptor-mediated uptake in rat liver. (2001) (44)
Preparation and properties of the immunoconjugate composed of anti-human colon cancer monoclonal antibody and mitomycin C-dextran conjugate. (1992) (44)
Near-infrared fluorescence probes for enzymes based on binding affinity modulation of squarylium dye scaffold. (2012) (44)
Theoretical considerations involving the pharmacokinetics of plasmid DNA. (2005) (43)
Control of in vivo fate of albumin derivatives utilizing combined chemical modification. (1994) (42)
Targeted delivery of superoxide dismutase to macrophages via mannose receptor-mediated mechanism. (1994) (42)
Design of polymeric prodrugs of prostaglandin E(1) having galactose residue for hepatocyte targeting. (1999) (42)
Control of pharmaceutical properties of soybean trypsin inhibitor by conjugation with dextran. I: Synthesis and characterization. (1989) (42)
Validation of the Chloramine-T Induced Oxidation of Human Serum Albumin as a Model for Oxidative Damage in Vivo (2003) (42)
Hepatocyte-specific distribution of catalase and its inhibitory effect on hepatic ischemia/reperfusion injury in mice. (1999) (41)
Improvement of the Pulmonary Absorption of (Asu1,7)-Eel Calcitonin by Various Protease Inhibitors in Rats (1994) (41)
The Accumulation Mechanism of Cationic Mitomycin C‐dextran Conjugates in the Liver: In‐vivo Cellular Localization and In‐vitro Interaction with Hepatocytes (1988) (40)
Biliary excretion of polystyrene microspheres with covalently linked FITC fluorescence after oral and parenteral administration to male Wistar rats. (1996) (40)
Self-assembling DNA hydrogel-based delivery of immunoinhibitory nucleic acids to immune cells. (2016) (39)
Reactivation of silenced transgene expression in mouse liver by rapid, large-volume injection of isotonic solution. (2008) (39)
Pharmacokinetic evaluation of mannosylated bovine serum albumin as a liver cell-specific carrier: quantitative comparison with other hepatotropic ligands. (1999) (38)
Comparative Analysis of Percutaneous Absorption Enhancement by d-Limonene and Oleic Acid Based on a Skin Diffusion Model (1994) (38)
Stability and pharmacokinetic characteristics of oligonucleotides modified at terminal linkages in mice. (1995) (38)
Disposition characteristics of macromolecules in the perfused tissue-isolated tumor preparation. (1992) (38)
Uptake and gene expression of naked plasmid DNA in cultured brain microvessel endothelial cells. (1998) (37)
In Vivo and in Vitro Analysis of Skin Penetration Enhancement Based on a Two-Layer Diffusion Model with Polar and Nonpolar Routes in the Stratum Corneum (1994) (37)
Pharmacokinetics in design of polymeric drug delivery systems (1994) (35)
Induction of tumor-specific immune response by gene transfer of Hsp70-cell-penetrating peptide fusion protein to tumors in mice. (2010) (35)
Improved anti‐cancer effect of interferon gene transfer by sustained expression using CpG‐reduced plasmid DNA (2007) (35)
Depressive symptoms as a side effect of Interferon-α therapy induced by induction of indoleamine 2,3-dioxygenase 1 (2016) (34)
Renal disposition characteristics of oligonucleotides modified at terminal linkages in the perfused rat kidney. (1995) (34)
Demonstration of the Receptor‐mediated Hepatic Uptake of Dextran in Mice (1992) (34)
Gene silencing of β‐catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice (2008) (34)
Efficient uptake and rapid degradation of plasmid DNA by murine dendritic cells via a specific mechanism. (2002) (34)
Uptake characteristics of oligonucleotides in the isolated rat liver perfusion system. (1996) (33)
Disposition of anticancer drugs after bolus arterial administration in a tissue-isolated tumor perfusion system. (1990) (33)
Sequence-Specific Suppression of mdr1a/1b Expression in Mice via RNA Interference (2005) (33)
DNA-based nano-sized systems for pharmaceutical and biomedical applications. (2010) (33)
Mechanisms of hepatic disposition of polystyrene microspheres in rats: effects of serum depend on the sizes of microspheres. (1999) (33)
Optimization of Albumin Secretion and Metabolic Activity of Cytochrome P450 1A1 of Human Hepatoblastoma HepG2 Cells in Multicellular Spheroids by Controlling Spheroid Size. (2017) (33)
Effects of inflammatory response on in vivo transgene expression by plasmid DNA in mice. (2008) (32)
Control of pharmaceutical properties of soybean trypsin inhibitor by conjugation with dextran. II: Biopharmaceutical and pharmacological properties. (1989) (32)
Efficient delivery of immunostimulatory DNA to mouse and human immune cells through the construction of polypod-like structured DNA. (2014) (32)
Analysis of in vivo skin penetration enhancement by oleic acid based on a two-layer diffusion model with polar and nonpolar routes in the stratum corneum (1995) (31)
Improvement of therapeutic effect of human recombinant superoxide dismutase on ischemic acute renal failure in the rat via cationization and conjugation with polyethylene glycol. (1994) (31)
Disposition characteristics of mitomycin C-dextran conjugate in normal and tumor-bearing muscles of rabbits. (1987) (31)
Antitumor activity of lipophilic prodrugs of mitomycin C entrapped in liposome or O/W emulsion. (1984) (30)
Improved sustained release of antigen from immunostimulatory DNA hydrogel by electrostatic interaction with chitosan. (2017) (30)
Hepatic targeting of drugs and proteins by chemical modification (1995) (30)
Development of a hepatocyte-specific prostaglandin E(1) polymeric prodrug and its potential for preventing carbon tetrachloride-induced fulminant hepatitis in mice. (1999) (29)
Important role of serum proteins associated on the surface of particles in their hepatic disposition. (2002) (29)
Suppression of tumor growth by intratumoral injection of short hairpin RNA-expressing plasmid DNA targeting β-catenin or hypoxia-inducible factor 1α (2006) (28)
Quantitative and temporal analysis of gene silencing in tumor cells induced by small interfering RNA or short hairpin RNA expressed from plasmid vectors. (2009) (28)
Transplantation of insulin-secreting multicellular spheroids for the treatment of type 1 diabetes in mice. (2014) (28)
DNA nanotechnology-based development of delivery systems for bioactive compounds. (2014) (28)
Histogram analysis of pharmacokinetic parameters by bootstrap resampling from one-point sampling data in animal experiments. (2006) (27)
Tumor Localization and in vivo Antitumor Activity of the Immunoconjugate Composed of Anti‐human Colon Cancer Monoclonal Antibody and Mitomycin C‐Dextran Conjugate (1991) (27)
Disposition characteristics of recombinant human interleukin-11 after a bolus intravenous administration in mice. (1995) (27)
Effect of Interferon-γ on the Pharmacokinetics of Digoxin, a P-glycoprotein Substrate, Intravenously Injected into the Mouse (2004) (26)
Design for Cell-Specific Targeting of Proteins Utilizing Sugar-Recognition Mechanism: Effect of Molecular Weight of Proteins on Targeting Efficiency (1995) (26)
Pharmacokinetic Analysis of Lectin-dependent Biodistribution of Fucosylated Bovine Serum Albumin: A Possible Carrier for Kupffer Cells (2001) (26)
Inhibition of tumor cell growth in the liver by RNA interference-mediated suppression of HIF-1α expression in tumor cells and hepatocytes (2008) (26)
Simultaneous delivery of doxorubicin and immunostimulatory CpG motif to tumors using a plasmid DNA/doxorubicin complex in mice. (2010) (26)
Development and Pharmacokinetics of Galactosylated Poly-L-Glutamic Acid as a Biodegradable Carrier for Liver-Specific Drug Delivery (1996) (25)
Manipulation of renal disposition of human recombinant superoxide dismutase by chemical modification. (1994) (25)
Structural and immunostimulatory properties of Y-shaped DNA consisting of phosphodiester and phosphorothioate oligodeoxynucleotides. (2010) (25)
Design of PCR-amplified DNA fragments for in vivo gene delivery: size-dependency on stability and transgene expression. (2007) (25)
Disposition of radioactivity after injection of liver-targeted proteins labeled with 111In or 125I. Effect of labeling on distribution and excretion of radioactivity in rats. (1999) (25)
Poly(N-isopropylacrylamide)-coated microwell arrays for construction and recovery of multicellular spheroids. (2013) (25)
Effect of interferons on P-glycoprotein-mediated rhodamine-123 efflux in cultured rat hepatocytes. (2002) (25)
Pharmacokinetics of Plasmid DNA-Based Non-viral Gene Medicine. (2005) (24)
Specific uptake of succinylated proteins via a scavenger receptor-mediated mechanism in cultured brain microvessel endothelial cells. (1993) (24)
Interaction of polystyrene microspheres with liver cells: roles of membrane receptors and serum proteins. (1999) (24)
Prolonged circulation half-life of interferon γ activity by gene delivery of interferon γ-serum albumin fusion protein in mice. (2011) (24)
Synthesis and pharmacological activity of a novel water-soluble hepatocyte-specific polymeric prodrug of prostaglandin E(1) using lactosylated poly(L-glutamic hydrazide) as a carrier. (2001) (24)
Enhanced pharmacological activity of recombinant human interleukin-11 (rhIL11) by chemical modification with polyethylene glycol. (2007) (23)
Disposition of a polymeric prodrug of mitomycin C, mitomycin C-dextran conjugate, in the perfused rat liver. (1989) (23)
Small-molecule-induced clustering of heparan sulfate promotes cell adhesion. (2013) (23)
Analysis of in vitro skin penetration of acyclovir prodrugs based on a diffusion model with a metabolic process (1996) (23)
Residualizing indium-111-radiolabel for plasmid DNA and its application to tissue distribution study. (2003) (22)
Disposition characteristics of glycosylated poly(amino acids) as liver cell-specific drug carrier. (1998) (22)
Pharmacokinetics and Preventive Effects of Targeted Catalase Derivatives on Hydrogen Peroxide-Induced Injury in Perfused Rat Liver (2002) (22)
Electrical charge on protein regulates its absorption from the rat small intestine. (2002) (22)
Increase in CpG DNA-induced inflammatory responses by DNA oxidation in macrophages and mice. (2011) (22)
DNA and its cationic lipid complexes induce CpG motif‐dependent activation of murine dendritic cells (2007) (22)
Combined encapsulation of a tumor antigen and immune cells using a self‐assembling immunostimulatory DNA hydrogel to enhance antigen‐specific tumor immunity (2018) (21)
Pharmacokinetic analysis of hepatic uptake of galactosylated bovine serum albumin in a perfused rat liver. (1998) (21)
Control of plasma cholesterol-lowering action of probucol with various lipid carrier systems. (1998) (21)
Pharmacokinetic and Tissue Distribution Mechanism of Mouse Recombinant Heat Shock Protein 70 in Mice (2005) (21)
Pharmacokinetic considerations regarding non‐viral cancer gene therapy (2008) (20)
Efficient scavenger receptor-mediated hepatic targeting of proteins by introduction of negative charges on the proteins by aconitylation: the influence of charge density and size of the proteins molecules. (2003) (20)
Development of DNA-anchored assembly of small extracellular vesicle for efficient antigen delivery to antigen presenting cells. (2019) (20)
In Vivo Tracking of Extracellular Vesicles in Mice Using Fusion Protein Comprising Lactadherin and Gaussia Luciferase. (2017) (20)
Retardation of Antigen Release from DNA Hydrogel Using Cholesterol‐Modified DNA for Increased Antigen‐Specific Immune Response (2017) (20)
Hepatic delivery of particulates in the submicron range by a hydrodynamics‐based procedure: implications for particulate gene delivery systems (2004) (19)
Antitumor immunity by small extracellular vesicles collected from activated dendritic cells through effective induction of cellular and humoral immune responses. (2020) (19)
Cellular uptake properties of oligonucleotides in LLC-PK1 renal epithelial cells. (1998) (19)
Disposition characteristics of model macromolecules in the perfused rat kidney. (1993) (18)
Liver uptake and hepato-biliary transfer of galactosylated proteins in rats are determined by the extent of galactosylation. (1999) (18)
Plasma disposition and in vivo and in vitro antitumor activities of mitomycin C-dextran conjugate in relation to the mode of action. (1985) (18)
Efficient amplification of self-gelling polypod-like structured DNA by rolling circle amplification and enzymatic digestion (2015) (18)
Control of the disposition profiles of proteins in the kidney via chemical modification (1994) (18)
Absorption characteristics of macromolecular prodrugs of mitomycin C following intramuscular administration. (1986) (18)
Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene (2017) (17)
Hsp-based tumor vaccines: state-of-the-art and future directions. (2007) (17)
Constant and steady transgene expression of interferon‐γ by optimization of plasmid construct for safe and effective interferon‐γ gene therapy (2012) (17)
Synthetic molecules that protect cells from anoikis and their use in cell transplantation. (2014) (17)
Self-assembling CpG DNA nanoparticles for efficient antigen delivery and immunostimulation. (2012) (17)
Optimal Arrangement of Four Short DNA Strands for Delivery of Immunostimulatory Nucleic Acids to Immune Cells. (2015) (17)
Comparison of the type of liposome involving cytokine production induced by non-CpG Lipoplex in macrophages. (2010) (17)
TLR9‐dependent systemic interferon‐β production by intravenous injection of plasmid DNA/cationic liposome complex in mice (2009) (16)
Secretion polarity of interferon-β in epithelial cell lines (2002) (16)
Effects of Localization of Antigen Proteins in Antigen-Loaded Exosomes on Efficiency of Antigen Presentation. (2019) (16)
In Vivo Evaluation of Acyclovir Prodrug Penetration and Metabolism Through Rat Skin Using a Diffusion/Bioconversion Model (2004) (16)
Enhancement of antiproliferative activity of interferons by RNA interference‐mediated silencing of SOCS gene expression in tumor cells (2008) (16)
Increased Insulin Secretion from Insulin-Secreting Cells by Construction of Mixed Multicellular Spheroids (2015) (16)
Amelioration of Experimental Autoimmune Encephalomyelitis in Mice by Interferon-Beta Gene Therapy, Using a Long-Term Expression Plasmid Vector. (2017) (16)
Development of safe and effective nonviral gene therapy by eliminating CpG motifs from plasmid DNA vector. (2012) (15)
Effects of upregulated indoleamine 2, 3-dioxygenase 1 by interferon γ gene transfer on interferon γ-mediated antitumor activity (2014) (15)
Development of a novel Hsp70-based DNA vaccine as a multifunctional antigen delivery system. (2010) (15)
Enhanced generation of cytotoxic T lymphocytes by heat shock protein 70 fusion proteins harboring both CD8(+) T cell and CD4(+) T cell epitopes. (2010) (15)
Disposition Characteristics of Protein Drugs in the Perfused Rat Kidney (1993) (15)
Disposition and gene expression characteristics in solid tumors and skeletal muscle after direct injection of naked plasmid DNA in mice. (2003) (15)
Skin penetration enhancement of acyclovir by prodrug-enhancer combination. (1994) (14)
Characterization of a lipophilic prodrug of 5-fluorouracil with a cholesterol promoiety and its application to liposomes. (1988) (14)
Cellular uptake and activation characteristics of naked plasmid DNA and its cationic liposome complex in human macrophages. (2005) (14)
Development of orally‐deliverable DNA hydrogel by microemulsification and chitosan coating (2018) (14)
Cellular activation by plasmid DNA in various macrophages in primary culture. (2008) (14)
Permeability modulation of human intestinal Caco-2 cell monolayers by interferons. (2005) (14)
Tissue distribution of 111In-labeled uricase conjugated with charged dextrans and polyethylene glycol. (1991) (14)
Biological effects and cellular uptake of c-myc antisense oligonucleotides and their cationic liposome complexes. (1998) (14)
Development of RNA/DNA Hydrogel Targeting Toll-Like Receptor 7/8 for Sustained RNA Release and Potent Immune Activation (2020) (14)
Control of polarization and tumoricidal activity of macrophages by multicellular spheroid formation (2018) (13)
Pharmacokinetic analysis of scavenger receptor-mediated uptake of anionized proteins in the isolated perfused rat liver (1997) (13)
Using size-controlled multicellular spheroids of murine adenocarcinoma cells to efficiently establish pulmonary tumors in mice. (2017) (13)
Increased immunostimulatory activity of polypod-like structured DNA by ligation of the terminal loop structures. (2012) (13)
Enhanced generation of cytotoxic T lymphocytes by increased cytosolic delivery of MHC class I epitope fused to mouse heat shock protein 70 via polyhistidine conjugation. (2009) (13)
Urinary excretion characteristics of a polymeric prodrug of mitomycin C, mitomycin C-dextran conjugate. (1985) (13)
Stimulation side-dependent asymmetrical secretion of poly I:poly C-induced interferon-beta from polarized epithelial cell lines. (1999) (13)
Simultaneous detection of DsRed2‐tagged and EGFP‐tagged human β‐interferons in the same single cells (2004) (13)
Positive Correlation Between the Generation of Reactive Oxygen Species and Activation/Reactivation of Transgene Expression After Hydrodynamic Injections into Mice (2011) (13)
Pharmacokinetic evaluation of biodistribution data obtained with radiolabeled proteins in mice. (1999) (12)
Regulation of immunological balance by sustained interferon-γ gene transfer for acute phase of atopic dermatitis in mice (2012) (12)
Targeting Delivery of Protein Drugs by Chemical Modification (1994) (12)
Fate of lipid and encapsulated drug after intramuscular administration of liposomes prepared by the freeze-thawing method in rats. (1985) (12)
Phosphatidylserine-deficient small extracellular vesicle is a major somatic cell-derived sEV subpopulation in blood (2021) (12)
Biliary excretion of mitomycin C dextran conjugates in relation to physicochemical characteristics of carrier dextran. (1990) (12)
Plasmid DNA uptake and subsequent cellular activation characteristics in human monocyte-derived cells in primary culture. (2007) (12)
Expression profile-dependent improvement of insulin sensitivity by gene delivery of interleukin-6 in a mouse model of type II diabetes. (2013) (12)
Nasal delivery of Japanese cedar pollen Cryj1 by using self-gelling immunostimulatory DNA for effective induction of immune responses in mice. (2015) (11)
Therapeutic Application of Small Extracellular Vesicles (sEVs): Pharmaceutical and Pharmacokinetic Challenges. (2020) (11)
Enhanced antigen-specific antibody production following polyplex-based DNA vaccination via the intradermal route in mice. (2006) (11)
Pharmacokinetics and disposition characteristics of recombinant decorin after intravenous injection into mice. (1999) (11)
Interleukin-4-carrying small extracellular vesicles with a high potential as anti-inflammatory therapeutics based on modulation of macrophage function. (2021) (11)
Polypod-Shaped DNAs: Small-Angle X-ray Scattering and Immunostimulatory Activity. (2016) (11)
Theoretical Design of Prodrug-Enhancer Combination Based on a Skin Diffusion Model: Prediction of Permeation of Acyclovir Prodrugs Treated with l-Geranylazacycloheptan-2-one (1996) (11)
Incorporation into a biodegradable hyaluronic acid matrix enhances in vivo efficacy of recombinant human interleukin 11 (rhIL11). (2006) (11)
Enhanced CTL response by controlled intracellular trafficking of antigen in dendritic cells following DNA vaccination. (2009) (11)
Hepatic Disposition Characteristics of 111In-Labeled Lactosaminated Bovine Serum Albumin in Rats (1991) (10)
Enhancement of anticancer effect of interferon-γ gene transfer against interferon-γ-resistant tumor by depletion of tumor-associated macrophages. (2014) (10)
The uptake and degradation of DNA is impaired in macrophages and dendritic cells from NZB/W F(1) mice. (2005) (10)
Safe and effective interferon-beta gene therapy for the treatment of multiple sclerosis by regulating biological activity through the design of interferon-beta-galectin-9 fusion proteins. (2018) (10)
Development of safe and effective nonviral gene therapy by eliminating CpG motifs from plasmid DNA vector (2012) (10)
Injection site‐dependent induction of immune response by DNA vaccine: comparison of skin and spleen as a target for vaccination (2010) (10)
Saturation of transgene protein synthesis from mRNA in cells producing a large number of transgene mRNA (2011) (10)
Augmented inhibitory effect of superoxide dismutase on superoxide anion release from macrophages by direct cationization. (1997) (10)
Moment analysis for kinetics of gene silencing by RNA interference. (2006) (10)
Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice (2014) (9)
Multifunctionalization of Cells with a Self-Assembling Molecule to Enhance Cell Engraftment. (2019) (9)
Evaluation of antiviral effect of type I, II, and III interferons on direct‐acting antiviral‐resistant hepatitis C virus (2017) (9)
Synthesis and biodistribution study of liver-specific prostaglandin E1 polymeric conjugate (1997) (9)
Characterization of LLC-PK1 Kidney Epithelial Cells as an in Vitro Model for Studying Renal Tubular Reabsorption of Protein Drugs (1995) (9)
Non-Polarized Secretion of Mouse Interferon-β from Gene-Transferred Human Intestinal Caco-2 Cells (1997) (9)
Suppression of tumor growth by intratumoral injection of short hairpin RNA-expressing plasmid DNA targeting beta-catenin or hypoxia-inducible factor 1alpha. (2006) (9)
In Vitro and In Vivo Stimulation of Toll-Like Receptor 9 by CpG Oligodeoxynucleotides Incorporated Into Polypod-Like DNA Nanostructures. (2017) (9)
Removal of transgene‐expressing cells by a specific immune response induced by sustained transgene expression (2014) (9)
Role of immunostimulatory DNA and TLR9 in gene therapy. (2006) (9)
Controlling the kinetics of interferon transgene expression for improved gene therapy (2012) (9)
Induction of cytotoxic T lymphocytes following immunization with cationized soluble antigen. (2004) (8)
Interferon-Inducible Mx Promoter-Driven, Long-Term Transgene Expression System of Interferon-β for Cancer Gene Therapy. (2016) (8)
Induction of antigen-specific cytotoxic T lymphocytes by immunization with negatively charged soluble antigen through scavenger receptor-mediated delivery. (2007) (8)
Contribution of Epigenetic Modifications to the Decline in Transgene Expression from Plasmid DNA in Mouse Liver (2015) (8)
Determining the role of surface glycans in the pharmacokinetics of small extracellular vesicles. (2021) (8)
Persistent interferon transgene expression by RNA interference‐mediated silencing of interferon receptors (2010) (8)
Design of polymeric prodrugs of PGE1 for cell-specific hepatic targeting. (2000) (8)
X-ray scattering from immunostimulatory tetrapod-shaped DNA in aqueous solution to explore its biological activity-conformation relationship. (2014) (8)
Analysis methods and recent advances in nonlinear pharmacokinetics from in vitro through in loci to in vivo. (2004) (8)
Application of Magnesium Pyrophosphate-Based Sponge-Like Microparticles to Enhance the Delivery Efficiency and Adjuvant Effects of Polyriboinosinic-Polyribocytidylic Acid in Immune Cells. (2016) (7)
Renal Disposition of Recombinant Human Interleukin-11 in the Isolated Perfused Rat Kidney (2004) (7)
Development of allergic rhinitis immunotherapy using antigen-loaded small extracellular vesicles. (2022) (7)
[Development of drug delivery systems for macromolecular drugs]. (1996) (7)
Erratum to “Effect of DNA/liposome mixing ratio on the physicochemical characteristics, cellular uptake and intracellular trafficking of plasmid DNA/cationic liposome complexes and subsequent gene expression”: [Journal of Controlled Release 66 (2000) 255–269]☆ (2000) (7)
[Analysis and Control of in Vivo Kinetics of Exosomes for the Development of Exosome-based DDS]. (2016) (6)
Cholesterol is required for the polarized secretion of erythropoietin in Madin-Darby canine kidney cells. (2005) (6)
Cationic liposome-mediated efficient induction of type I interferons by a low dose of poly I:poly C in mouse cell lines. (1998) (6)
Development of CD40L-modified tumor small extracellular vesicles for effective induction of antitumor immune response. (2020) (6)
Permeability of macromolecules in cultured endothelial and tumor cell layers on microporous membranes (1992) (6)
Long-term elimination of hepatitis C virus from human hepatocyte chimeric mice after interferon-γ gene transfer. (2014) (6)
SELEX-Based Screening of Exosome-Tropic RNA. (2017) (6)
Manipulation of local disposition and gene expression characteristics of plasmid DNA following intramuscular administration by complexation with cationic macromolecule. (2005) (6)
Gene delivery of albumin binding peptide-interferon-gamma fusion protein with improved pharmacokinetic properties and sustained biological activity. (2013) (6)
[In vivo siRNA delivery to tumor cells and its application to cancer gene therapy]. (2007) (6)
Transport characteristics of ebastine and its metabolites across human intestinal epithelial Caco-2 cell monolayers. (2001) (6)
Inhibition of surgical trauma-enhanced peritoneal dissemination of tumor cells by human catalase derivatives in mice. (2011) (6)
Effect of cationic liposomes on intracellular trafficking and efficacy of antisense oligonucleotides in mouse peritoneal macrophages. (2000) (6)
Erratum to 'Preservation of exosomes at room temperature using lyophilization' [International Journal of Pharmaceutics 553 (2018) 1-7]. (2019) (6)
Towards therapeutic application of RNA-mediated gene regulation. Preface. (2009) (5)
Development of a Nanostructured RNA/DNA Assembly as an Adjuvant Targeting Toll-Like Receptor 7/8. (2019) (5)
Atomic force microscopy analysis of orientation and bending of oligodeoxynucleotides in polypod-like structured DNA (2015) (5)
Elucidation of the Mechanism of Increased Activity of Immunostimulatory DNA by the Formation of Polypod-like Structure (2017) (5)
Pharmacokinetic Analysis of Drug Disposition After Intratumoral Injection in a Tissue-Isolated Tumor Perfusion System (1996) (5)
Control of Disposition Characteristics of Proteins by Direct Cationization in Mice (1995) (5)
Intratumoral pharmacokinetics of oligonucleotides in a tissue-isolated tumor perfusion system. (2000) (5)
Receptor-Mediated Cell Specific Delivery of Drugs to the Liver and Kidney (1996) (5)
Development of a macromolecular prodrug of FK506: I. Synthesis of FK506-dextran conjugate. (1998) (5)
Subcellular trafficking of exogenously expressed interferon‐β in Madin–Darby canine kidney cells (2004) (5)
Passive targeting of drug. (1999) (4)
Incorporation of Gelatin Microspheres into HepG2 Human Hepatocyte Spheroids for Functional Improvement through Improved Oxygen Supply to Spheroid Core. (2020) (4)
Regulation of the Distribution of Cells in Mixed Spheroids by Altering Migration Direction. (2019) (4)
DNA density-dependent uptake of DNA origami-based two-or three-dimensional nanostructures by immune cells. (2020) (4)
A deconvolution method for estimating the first-pass metabolism of orally administered drugs. (1995) (4)
A physiological role of interferon (IFN)-β derived from tumor: tumor growth of a mouse bladder carcinoma line MBT-2 is partially suppressed by autocrine IFN-β (1997) (4)
Effects of methyl-beta-cyclodextrin treatment on secretion profile of interferon-beta and zonula occuludin-1 architecture in Madin-Darby canine kidney cell monolayers. (2009) (4)
Effects of transgene expression level per cell in mice livers on induction of transgene-specific immune responses after hydrodynamic gene transfer (2016) (4)
Effects of Methyl-β-cyclodextrin Treatment on Secretion Profile of Interferon-β and Zonula Occuludin-1 Architecture in Madin–Darby Canine Kidney Cell Monolayers (2009) (4)
Cellular interaction and in vitro antitumor effect of various mitomycin C prodrugs in mitomycin C-resistant L1210 leukemia cell lines. (1987) (4)
Gene Therapy and Gene Delivery (2005) (4)
Secretion polarity of interferon-beta in epithelial cell lines. (2002) (4)
Lymphatic Transport After Parenteral Drug Administration (2019) (3)
Folding of single-stranded circular DNA into rigid rectangular DNA accelerates its cellular uptake. (2019) (3)
Exogenous expression of interferon-beta in cultured brain microvessel endothelial cells. (2004) (3)
Fibronectin inhibits cytokine production induced by CpG DNA in macrophages without direct binding to DNA. (2012) (3)
Control of hypoxia-induced tumor cell adhesion by cytophilic human catalase. (2009) (3)
Construction of Monomeric and Dimeric G-Quadruplex-Structured Cytosine-Phosphate-Guanine Oligodeoxynucleotides for Enhanced Uptake and Activation in Toll-Like Receptor 9-Positive Macrophages. (2020) (3)
Enhanced Activity of Immunosuppressive Oligodeoxynucleotides by Incorporating Them into Hexapod-Like Nanostructured DNA. (2018) (3)
Critical contribution of macrophage scavenger receptor 1 to the uptake of nanostructured DNA by immune cells. (2021) (3)
Combined use of chemically modified nucleobases and nanostructured DNA for enhanced immunostimulatory activity of CpG oligodeoxynucleotide. (2020) (3)
Strategies for persistent retention of macromolecules and nanoparticles in the blood circulation. (2022) (3)
Expression and visualization of a human interferon-beta-enhanced green fluorescent protein chimeric molecule in cultured cells. (2004) (3)
Intercellular delivery of NF-κB inhibitor peptide utilizing small extracellular vesicles for the application of anti-inflammatory therapy. (2020) (3)
Basic pharmacokinetics of oligonucleotides and genes (2002) (2)
Strategy for tumor targeting by macromolecule-drug conjugates. (1988) (2)
Bootstrap method-based estimation of the minimum sample number for obtaining pharmacokinetic parameters in preclinical experiments. (2010) (2)
An evaluation method for nonlinear local disposition in rat liver and kidney. (2004) (2)
Inhibition of nuclear delivery of plasmid DNA and transcription by interferon γ: hurdles to be overcome for sustained gene therapy (2011) (2)
Nucleic Acid Drug Delivery and Targeting (2011) (2)
Development of hydrophobic interaction-based DNA supramolecules as efficient delivery carriers of CpG DNA to immune cells (2021) (2)
Comparison of antigen expression from plasmid DNA in tumor-free and antigen-expressing tumor-bearing mice (2012) (2)
Control of Biopharmaceutical Properties by Dextran Conjugates (1988) (2)
Construction of nanostructured DNA harbouring phosphorodiamidate morpholino oligonucleotide for controlled tissue distribution in mice (2017) (2)
Unique cytokine production profile following stimulation with DNA in macrophages from NZB/W F1 mice. (2008) (2)
[Development of heat shock proteins with controlled distribution properties and their application to vaccine delivery]. (2007) (2)
Extracellular vesicle-based therapeutics: Extracellular vesicles as therapeutic targets and agents. (2023) (2)
Targeted Delivery of Interferon Gamma Using a Recombinant Fusion Protein of a Fibrin Clot-Binding Peptide With Interferon Gamma for Cancer Gene Therapy. (2017) (2)
Secretion mode and subcellular localization of human interferon-beta exogenously expressed in porcine renal epithelial LLC-PK1 cells. (2004) (2)
5′‐Phosphate oligodeoxynucleotides enhance the phosphodiester‐CpG DNA‐induced inflammatory response in macrophages (2011) (2)
Delivery of plasmid DNA to endothelial cells (1996) (2)
[Cancer gene therapy by direct intratumoral injection: gene expression and intratumoral pharmacokinetics of plasmid DNA]. (1997) (2)
Effect of co-administration of cationic macromolecules on the in vivo disposition and in situ renal disposition characteristics of rhIL-11. (2002) (2)
Estimation of drug concentration profiles in skin based on a skin diffusion model. (1997) (1)
[Optimization of gene therapy effect by spaciotemporal control of expressed proteins]. (2010) (1)
In Vivo Disposition Characteristics of Plasmid DNA Complexed with Cationic Liposomes (2003) (1)
The identification of novel small extracellular vesicle (sEV) production modulators using luciferase‐based sEV quantification method (2022) (1)
Development of a macromolecular prodrug of FK 506: III: In vivo disposition of FK 506-dextran conjugate. (1998) (1)
RNAi-based gene silencing in mice (2004) (1)
Effects of oxidation on functional systems of human serum albumin (2001) (1)
Pharmacokinetics of polymer-plasmid DNA complex (2004) (1)
Enhanced Immunostimulatory Activity of CpG Oligodeoxynucleotide by the Combination of Mannose Modification and Incorporation into Nanostructured DNA. (2020) (1)
[Drug delivery systems in gene therapy]. (1998) (1)
Pharmacokinetics in gene delivery (2005) (1)
Development of a macromolecular prodrug of FK 506: II: In vitro study for FK 506-dextran conjugate. (1998) (1)
Development of Heat Shock Proteins with Controlled Distribution Properties and Their Application to Vaccine Delivery (2007) (1)
Hepatic disposition characteristics of recombinant human interleukin-11 (rhIL-11) in the perfused rat liver. (1998) (1)
Drug delivery systems and micromachines. (2001) (1)
[Control of spatiotemporal distribution of interferon γ by genetically fusing functional peptides]. (2012) (1)
Development of multicellular spheroid for cell-based therapy (2013) (1)
Calcium Peroxide-Containing Polydimethylsiloxane-Based Microwells for Inhibiting Cell Death in Spheroids through Improved Oxygen Supply. (2021) (1)
Enhanced Immunostimulatory Activity of Covalent DNA Dendrons (2021) (1)
Cell-specific targeting of drugs and genes with glycosylated liposomes: Comparison with glycosylated poly(amino acids) (2000) (0)
Drug-preloadable methacrylated gelatin microspheres fabricated using an aqueous two-phase system (2022) (0)
Inhibitory effect of superoxide dismutase derivatives modified with various sugar moieties on ischemia/reperfusion injury. (1993) (0)
Forthcoming papers (2006) (0)
In vivo fate of exogenously-administered exosomes (2014) (0)
Molecular Imaging of-Amyloid Plaques for Early Diagnosis of Alzheimer ’ s Disease (2012) (0)
The 30th anniversary of the JSDDS (2014) (0)
The Fate of Polystyrene Microspheres of Various Sizes after Oral and Parenteral Administration to Rats (1995) (0)
Forthcoming papers (2007) (0)
Catch the Trends of Biologics (2018) (0)
Elucidation of the Mechanism of Increased Activity of Immunostimulatory DNA by the Formation of Polypod-like Structure (2017) (0)
Development of oligonucleotide-based nano-sized DDS (2010) (0)
Uptake Characteristics of Anionized and Cationized Proteins in Brain Microvessel Endothelial Cells (1997) (0)
Characteristics of Exosomes and Development of Exosome-based Diagnosis and Therapy (2014) (0)
Optimization of penetration enhancement based on action mechanism and site of enhancers. (1993) (0)
Development of monoclonal antibody-drug conjugate A7-MMC utilizing dextran as intermediate carrier (1988) (0)
Erratum: In vivo disposition characteristics of plasmid DNA complexed with cationic liposomes (Journal of Drug Targeting (1995) vol. 3 (149-157)) (2003) (0)
Public Interest Incorporated Association, the Pharmaceutical Society of Japan, Facing to the Society (2019) (0)
A physiological role of interferon (IFN)-beta derived from tumor: tumor growth of a mouse bladder carcinoma line MBT-2 is partially suppressed by autocrine IFN-beta. (1997) (0)
For further evolution of drug delivery system (2016) (0)
Increased Insulin Secretion from Insulin-Secreting Cells by Construction of Mixed Multicellular Spheroids (2015) (0)
Analysis of Tertiary Structural Features of Branched DNA Nanostructures with Partially Common Sequences Using Small-Angle X-ray Scattering. (2019) (0)
Immunoconjugate of monoclonal antibody A7 and mitomycin C-dextran conjugate linked through thioether bond. (1991) (0)
HEPATIC DISPOSITION CONTROL OF LIPOPHILIC DRUGS VIA LIPID CARRIER SYSYTEMS (1994) (0)
DIFFERENTIAL ROLE OF SERUM MANNAN BINDING PROTEIN IN PHARMACOKINETICS OF MANNOSYLATED POLYMERIC AND PARTICULATE DRUG CARRIERS (2001) (0)
Development of immunotherapy using extracellular vesicles (2021) (0)
Tumor metastasis models. (2001) (0)
Biodistribution control of lipophilic drugs with lipid carrier system. (1995) (0)
Professor Mitsuru Hashida: His outstanding achievements in drug delivery research (2012) (0)
Physicochemical and disposition characteristics of plasimid DNA complexed with cationic liposomes (1995) (0)
DEVELOPMENT OF HEPATOCYTE-SPECIFIC GENE DELIVERY SYSTEMS BASED ON PHARMACOKINETIC STUDIES (2000) (0)
Optimization of Gene Therapy Effect by Spaciotemporal Control of Expressed Proteins (2011) (0)
Pharmacokinetics of plasmid DNA-based non-viral gene medicine. (2005) (0)
Forthcoming papers (2006) (0)
Development of exosome-based DDS targeting gastrointestinal cancer (2018) (0)
40. Increased Transgene Expression of Dystrophin in mdx Muscle by RNAi-Mediated Silencing of Calpain Expression (2006) (0)
Title DNA-based nano-sized systems for pharmaceutical and biomedical applications (2017) (0)
Theoretical Design of Skin Penetration Enhancement Via Prodrug-Enhancer Combination Based on a Diffusion Model (1996) (0)
701. Enhanced Anti-Tumor Effect of Interferon Gene Transfer by Sustained Transgene Expression Using CpG-Reduced Plasmid DNA (2005) (0)
Title Biodegradable CpG DNA hydrogels for sustained delivery of doxorubicin and immunostimulatory signals in tumor-bearing mice (2017) (0)
SIZE-DEPENDENT HEPATIC DISPOSITION OF POLYSTYRENE MICROSPHERES (1998) (0)
EVALUATION OF THE DELIVERY SYSTEMS FOR PROTEIN DRUGS WITH CHEMICAL MODIFICATION USING CELL CULTURE SYSTEMS (1995) (0)
RELATIONSHIP BETWEEN PHYSICOCHEMICAL CHARACTERISITCS, DISTRIBUTION OF DNA-CATIONIC LIPOSOME COMPLEXES AND THEIR GENE EXPRESSION, AND APPLICATION TO GENE THERAPY (2000) (0)
Sugars and DDS (2004) (0)
Exosomes in Cancer Immunotherapy (2018) (0)
Pharmacokinetic Analysis and Development of Delivery Systems of Macromolecular Drugs (1996) (0)
mannose receptors and mannan-binding protein In vivo recognition of mannosylated proteins by hepatic (2016) (0)
Development of Enzymatic Depletion Methods for Preparation of Small Extracellular Vesicles with Long Blood-Circulation Half-Life (2022) (0)
PHARMACOKINETIC ANALYSIS OF DRUG DISPOSITION AFTER INTRATUMORAL INJECTION IN TISSUE-ISOLATED TUMOR PERFUSION SYSTEM (1997) (0)
Tissue-isolated Tumor Preparation Disposition Characteristics of Macromolecules in the Perfused (2006) (0)
CACAGTCATCAGTA GACGTT GCAGTCAGTCTTTTGACTGACTGCAACG TCTACTGAAGCTGCTAGCAAGCTCAGTCAGTTTTCTGACTGAGCTTGC TAGCAGCTGCACAT GACGTT CCATGCATGCTTTTGCATGCATGGAACG TCATGTGCTGACTGTGACTGTCCAGTCAGTTTTTACTGACTGGACAGT GACAGTCACAGTCATCAGTA GACGTT GCAGTCAGTCTTTTGACTGACT GCAACGTCTACTGAAGCTGCTAGCAAGCTCAGTCAGTTTTCTGACTGA (2012) (0)
This information is current as Polarization Atopic Dermatitis in NC / Nga Mice via Th 1 Ameliorates γ Therapeutic Levels of IFN-Sustained Exogenous Expression of Yoshinobu (2010) (0)
Calcium Peroxide-Containing Polydimethylsiloxane-Based Microwells for Inhibiting Cell Death in Multicellular Spheroids Through Improved Oxygen Supply (2020) (0)
Pharmacokinetic Analysis of the in Vivo Disposition of Chemically Modified Proteins in Rats : Effect of Radiolabeling Method (1998) (0)
Disposition and gene expression of plasmid DNA complexed with cationic carriers (1996) (0)
Development of delivery systems of DNA medicines and possible obstacles to be overcome. (1995) (0)
[Control of in vivo characteristics of gene and antisense DNA disposition]. (1994) (0)
Control of disposition characteristics of catalase by chemical modification (1996) (0)
2A2-C06 Alginate gel beads dispersed gold nanoparticles for hyperthermia therapy application (2015) (0)
新しいモダリティ医薬品：DDS研究への期待 (2023) (0)
THEORETICAL DESIGN OF OPTIMAL PRODRUG FOR SKIN PENETRATION ENHANCEMENT BASED ON A DIFFUSION MODEL (1996) (0)
Pharmacokinetic analysis of mannose receptor-mediated hepatic targeting of proteins: Capacity-limited hepatic uptake and saturable binding in plasma (1998) (0)
Title Nasal delivery of Japanese cedar pollen Cryj1 by using self- gelling immunostimulatory DNA for effective induction of immune responses in mice (2017) (0)
CELL-SPECIFIC TARGETING OF DRUGS BY RECEPTOR-MEDIATED ENDOCYTOSIS BASED ON SUGAR RECOGNITION SYSTEMS (1993) (0)
In vivo siRNA Delivery to Tumor Cells and Its Application to Cancer Gene Therapy (2008) (0)
The perspective of DDS from the viewpoint of a basic researcher (2014) (0)
X-ray Scattering from Immunostimulatory Tetrapod-Shaped DNA in Aqueous Solution To Explore Its Biological Activity–Conformation Relationship B (2014) (0)
Significant advance in DDS science (2017) (0)
[Summary of a Report from the Science Council of Japan]. (2019) (0)
[The Expert of the Medicine Explains "Understanding of the Novel Coronavirus Vaccine"]. (2022) (0)
~i~~~~iti~~ characteristics of plasmid rational delivery systems should be designed based on informa- (1996) (0)
Pharmacokinetic approach for the elucidation of elevated plasma small extracellular vesicle (sEV) concentration in cancer. (2023) (0)
71. Intratumoral Delivery of Small Interfering RNA for Inhibition of Tumor Progression in Mice (2005) (0)
Activities of the Pharmaceutical Society of Japan: Collaboration With Science Council of Japan (2021) (0)
Development of evaluation method for drug disposition in tumor using tissue-isolated tumor perfusion system. (1990) (0)
989. Induction of Antitumor Immunity by Cell- Penetrating Peptide-Coupled Hsp70 Gene Transfer to Tumor Cells (2006) (0)
CONTROL OF IN VIVO FATE OF PROTEIN DRUGS USING CHEMICAL MODIFICATION WITH SUGARS (1991) (0)
ENHANCED LYMPHATIC DELIVERY OF MIYOMYCIN C BY POLYMERIC MODIFICATION (1984) (0)
Passive targeting with macromolecular drug carriers. (1999) (0)
Development of Delivery Systems for Antisense Oligonucleotides (1996) (0)
For further development of the Pharmaceutical Society of Japan (2020) (0)
616. Enhancement of Antitumor Activity of Interferons by RNAi-Mediated Silencing of SOCS Genes in Tumor Cells (2006) (0)
CELLULAR INTERACTION AND ANTITUMOR ACTIVITY OF MITOMYCIN C PRODRUGS (1985) (0)
Development of Exosomes Eligible for DDS (2015) (0)
Comparison of polythylene glycol and dextran conjugation with protein drug. (1989) (0)
The effect of the molecular weight of glycosylated proteins on their targeting efficiency to the liver. (1994) (0)
Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene (2017) (0)
Evaluation of the Immune Response After Administration of Plasmid DNA-Non-viral Vector Complexes (2005) (0)
Control of biopharmaceutical properties of uricase by conjugation with dextran derivatives. (1989) (0)
Forthcoming papers (2007) (0)
Design and Evaluation of Monoclonal Antibody-Antitumor Agent Conjugate (1989) (0)

This paper list is powered by the following services:

What Schools Are Affiliated With Yoshinobu Takakura?

Yoshinobu Takakura is affiliated with the following schools:

Yoshinobu Takakura's Academic­Influence.com Rankings

Yoshinobu Takakura's Degrees

Similar Degrees You Can Earn

Why Is Yoshinobu Takakura Influential?

Yoshinobu Takakura's Published Works

Published Works

What Schools Are Affiliated With Yoshinobu Takakura?

Yoshinobu Takakura's AcademicInfluence.com Rankings