Yusuke Nakamura
#14,111
Most Influential Person Now
Medical researcher in Japan
Yusuke Nakamura 's AcademicInfluence.com Rankings
Yusuke Nakamura law Degrees
Law
#1265
World Rank
#1608
Historical Rank
Common Law
#32
World Rank
#35
Historical Rank
International Law
#147
World Rank
#210
Historical Rank
Download Badge
Law
Yusuke Nakamura 's Degrees
- PhD Medical Science University of Tokyo
- Doctorate Medicine University of Tokyo
Why Is Yusuke Nakamura Influential?
(Suggest an Edit or Addition)According to Wikipedia, is a Japanese prominent geneticist and cancer researcher best known for developing Genome-Wide Association Study . He is one of the world's pioneers in applying genetic variations and whole genome sequencing, leading the research field of personalized medicine.
Yusuke Nakamura 's Published Works
Number of citations in a given year to any of this author's works
Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author
Published Works
- A second generation human haplotype map of over 3.1 million SNPs (2007) (4567)
- Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease (2009) (1235)
- p53AIP1, a Potential Mediator of p53-Dependent Apoptosis, and Its Regulation by Ser-46-Phosphorylated p53 (2000) (1214)
- Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are associated with rheumatoid arthritis (2003) (1076)
- AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1 (2000) (968)
- A ribonucleotide reductase gene involved in a p53-dependent cell-cycle checkpoint for DNA damage (2000) (939)
- Complete sequencing and characterization of 21,243 full-length human cDNAs (2004) (879)
- An ancient retrotransposal insertion causes Fukuyama-type congenital muscular dystrophy (1998) (787)
- Whole-genome sequencing of liver cancers identifies etiological influences on mutation patterns and recurrent mutations in chromatin regulators (2012) (777)
- Seven New Loci Associated with Age-Related Macular Degeneration (2013) (741)
- Variants in KCNQ1 are associated with susceptibility to type 2 diabetes mellitus (2008) (739)
- Functional SNPs in the lymphotoxin-α gene that are associated with susceptibility to myocardial infarction (2002) (730)
- SNPs in KCNQ1 are associated with susceptibility to type 2 diabetes in East Asian and European populations (2008) (717)
- SMYD3 encodes a histone methyltransferase involved in the proliferation of cancer cells (2004) (697)
- Genome-wide association analyses identify 18 new loci associated with serum urate concentrations (2012) (678)
- Localization of an ataxia-telangiectasia gene to chromosome 11q22–23 (1988) (648)
- Genome-wide association scan identifies a colorectal cancer susceptibility locus on 11q23 and replicates risk loci at 8q24 and 18q21 (2008) (629)
- An intronic SNP in a RUNX1 binding site of SLC22A4, encoding an organic cation transporter, is associated with rheumatoid arthritis (2003) (618)
- HJURP Is a Cell-Cycle-Dependent Maintenance and Deposition Factor of CENP-A at Centromeres (2009) (598)
- Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction (2006) (568)
- Meta-analysis identifies six new susceptibility loci for atrial fibrillation (2012) (535)
- Genome-wide association study identifies loci influencing concentrations of liver enzymes in plasma (2011) (526)
- DKK1, a negative regulator of Wnt signaling, is a target of the β-catenin/TCF pathway (2004) (521)
- Heterozygous TGFBR2 mutations in Marfan syndrome (2004) (518)
- Mutation of RRM2B, encoding p53-controlled ribonucleotide reductase (p53R2), causes severe mitochondrial DNA depletion (2007) (515)
- Genome-wide association study of hematological and biochemical traits in a Japanese population (2010) (506)
- A genome-wide association study identifies variants in the HLA-DP locus associated with chronic hepatitis B in Asians (2009) (487)
- A functional polymorphism in the 5′ UTR of GDF5 is associated with susceptibility to osteoarthritis (2007) (486)
- Genome-wide association study identifies HLA-A*3101 allele as a genetic risk factor for carbamazepine-induced cutaneous adverse drug reactions in Japanese population. (2011) (469)
- Single nucleotide polymorphisms in TNFSF15 confer susceptibility to Crohn's disease. (2005) (463)
- Recognition of hemi-methylated DNA by the SRA protein UHRF1 by a base-flipping mechanism (2008) (447)
- An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases susceptibility to osteoarthritis (2005) (441)
- Mutations of the APC adenomatous polyposis coli) gene (1993) (434)
- A high-throughput SNP typing system for genome-wide association studies (2001) (433)
- New gene functions in megakaryopoiesis and platelet formation (2011) (423)
- Overexpression of LSD1 contributes to human carcinogenesis through chromatin regulation in various cancers (2011) (420)
- ITPKC functional polymorphism associated with Kawasaki disease susceptibility and formation of coronary artery aneurysms (2008) (415)
- Mutation in Npps in a mouse model of ossification of the posterior longitudinal ligament of the spine (1998) (410)
- Glypican-3, overexpressed specifically in human hepatocellular carcinoma, is a novel tumor marker. (2003) (390)
- Genetic associations at 53 loci highlight cell types and biological pathways relevant for kidney function (2016) (388)
- Growth-suppressive effects of BPOZ and EGR2, two genes involved in the PTEN signaling pathway (2001) (381)
- Meta-analysis identifies common variants associated with body mass index in East Asians (2012) (372)
- Genetic variation in PSCA is associated with susceptibility to diffuse-type gastric cancer (2008) (370)
- A functional variant in FCRL3, encoding Fc receptor-like 3, is associated with rheumatoid arthritis and several autoimmunities (2005) (364)
- Japanese population structure, based on SNP genotypes from 7003 individuals compared to other ethnic groups: effects on population-based association studies. (2008) (350)
- Overview of the BioBank Japan Project: Study design and profile (2017) (346)
- Positional cloning of the gene for Nijmegen breakage syndrome (1998) (340)
- Genome-wide association study identifies a susceptibility locus for HCV-induced hepatocellular carcinoma (2011) (338)
- Allelic Loss in Colorectal Carcinoma (1989) (331)
- Genome-wide association study identifies three new susceptibility loci for adult asthma in the Japanese population (2011) (319)
- Mutation analysis in the BRCA2 gene in primary breast cancers (1996) (314)
- Gene-based SNP discovery as part of the Japanese Millennium Genome Project: identification of 190 562 genetic variations in the human genome (2002) (312)
- Expression profiles of non-small cell lung cancers on cDNA microarrays: Identification of genes for prediction of lymph-node metastasis and sensitivity to anti-cancer drugs (2003) (309)
- Association Between Telomere Length and Risk of Cancer and Non-Neoplastic Diseases: A Mendelian Randomization Study (2017) (302)
- ICBP90, an E2F-1 target, recruits HDAC1 and binds to methyl-CpG through its SRA domain (2004) (302)
- Meta-analysis identifies nine new loci associated with rheumatoid arthritis in the Japanese population (2012) (299)
- Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population (2012) (298)
- Genome-wide association study of intracranial aneurysm identifies three new risk loci (2010) (298)
- A novel brain-specific p53-target gene, BAI1, containing thrombospondin type 1 repeats inhibits experimental angiogenesis (1997) (296)
- Association of a novel long non‐coding RNA in 8q24 with prostate cancer susceptibility (2011) (295)
- Mapping of mutation causing Friedreich's ataxia to human chromosome 9 (1988) (295)
- Genome-wide association study identifies five new susceptibility loci for prostate cancer in the Japanese population (2010) (293)
- JSNP: a database of common gene variations in the Japanese population (2002) (291)
- Critical roles of non-histone protein lysine methylation in human tumorigenesis (2015) (286)
- Dysregulation of PRMT1 and PRMT6, Type I arginine methyltransferases, is involved in various types of human cancers (2011) (285)
- Genome-wide association meta-analysis identifies new endometriosis risk loci (2012) (281)
- Genomewide association between GLCCI1 and response to glucocorticoid therapy in asthma. (2011) (281)
- Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 With Susceptibility to Type 2 Diabetes in a Japanese Population (2008) (280)
- SARS-CoV-2 genomic variations associated with mortality rate of COVID-19 (2020) (275)
- Genome-wide association study identifies multiple susceptibility loci for pancreatic cancer (2014) (273)
- Amino acid substitution in hepatitis C virus core region and genetic variation near the interleukin 28B gene predict viral response to telaprevir with peginterferon and ribavirin (2010) (273)
- A genome-wide association study identifies three new risk loci for Kawasaki disease (2012) (268)
- Functional variants in ADH1B and ALDH2 coupled with alcohol and smoking synergistically enhance esophageal cancer risk. (2009) (265)
- Meta-analysis identifies multiple loci associated with kidney function–related traits in east Asian populations (2012) (264)
- Enhanced SMYD3 expression is essential for the growth of breast cancer cells (2006) (261)
- A genome-wide association study in the Japanese population identifies susceptibility loci for type 2 diabetes at UBE2E2 and C2CD4A-C2CD4B (2010) (261)
- Absence of mutation in the NOD2/CARD15 gene among 483 Japanese patients with Crohn's disease (2002) (259)
- A regulatory variant in CCR6 is associated with rheumatoid arthritis susceptibility (2010) (254)
- Identification of membrane-type matrix metalloproteinase-1 as a target of the β-catenin/Tcf4 complex in human colorectal cancers (2002) (251)
- A genome-wide association study identifies three new susceptibility loci for ulcerative colitis in the Japanese population (2009) (251)
- A radiation hybrid map of the rat genome containing 5,255 markers (1999) (250)
- Variations in the FTO gene are associated with severe obesity in the Japanese (2008) (247)
- Molecular Features of the Transition from Prostatic Intraepithelial Neoplasia (PIN) to Prostate Cancer (2004) (242)
- An integrated database of chemosensitivity to 55 anticancer drugs and gene expression profiles of 39 human cancer cell lines. (2002) (241)
- A functional SNP in CILP, encoding cartilage intermediate layer protein, is associated with susceptibility to lumbar disc disease (2005) (239)
- A SNP in the ABCC11 gene is the determinant of human earwax type (2006) (238)
- Functional variation in LGALS2 confers risk of myocardial infarction and regulates lymphotoxin-α secretion in vitro (2004) (237)
- Common variation near CDKN1A, POLD3 and SHROOM2 influences colorectal cancer risk (2012) (234)
- When good drugs go bad (2007) (233)
- Identification of ALDH4 as a p53-inducible gene and its protective role in cellular stresses (2004) (232)
- Genetic variants associated with warfarin dose in African-American individuals: a genome-wide association study (2013) (232)
- Significant effect of polymorphisms in CYP2D6 and ABCC2 on clinical outcomes of adjuvant tamoxifen therapy for breast cancer patients. (2010) (231)
- A cross-population atlas of genetic associations for 220 human phenotypes (2021) (229)
- Genome-wide cDNA microarray analysis of gene expression profiles in pancreatic cancers using populations of tumor cells and normal ductal epithelial cells selected for purity by laser microdissection (2004) (228)
- Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations (2012) (226)
- Association analysis of genetic variants in IL23R, ATG16L1 and 5p13.1 loci with Crohn's disease in Japanese patients (2007) (220)
- Preferential mutation of paternally derived RB gene as the initial event in sporadic osteosarcoma (1989) (210)
- Impact of CYP2D6*10 on recurrence‐free survival in breast cancer patients receiving adjuvant tamoxifen therapy (2008) (207)
- Genetic variations in the gene encoding ELMO1 are associated with susceptibility to diabetic nephropathy. (2005) (206)
- Mammalian p53R2 Protein Forms an Active Ribonucleotide Reductasein Vitro with the R1 Protein, Which Is Expressed Both in Resting Cells in Response to DNA Damage and in Proliferating Cells* (2001) (206)
- A genome-wide association study of chronic hepatitis B identified novel risk locus in a Japanese population. (2011) (206)
- A nonsynonymous SNP in PRKCH (protein kinase C η) increases the risk of cerebral infarction (2007) (205)
- Overexpression of the JmjC histone demethylase KDM5B in human carcinogenesis: involvement in the proliferation of cancer cells through the E2F/RB pathway (2010) (203)
- Molecular diagnosis of colorectal tumors by expression profiles of 50 genes expressed differentially in adenomas and carcinomas (2002) (202)
- Increases of amphiregulin and transforming growth factor-alpha in serum as predictors of poor response to gefitinib among patients with advanced non-small cell lung cancers. (2005) (201)
- The p53 Family Member Genes Are Involved in the Notch Signal Pathway* (2002) (201)
- Genome-wide associations and functional genomic studies of musculoskeletal adverse events in women receiving aromatase inhibitors. (2010) (199)
- Thymic stromal lymphopoietin gene promoter polymorphisms are associated with susceptibility to bronchial asthma. (2011) (194)
- Large-scale genome-wide association study in a Japanese population identifies novel susceptibility loci across different diseases (2020) (191)
- Dikkopf-1 as a novel serologic and prognostic biomarker for lung and esophageal carcinomas. (2007) (190)
- Activation of Holliday junction recognizing protein involved in the chromosomal stability and immortality of cancer cells. (2007) (190)
- ANLN plays a critical role in human lung carcinogenesis through the activation of RHOA and by involvement in the phosphoinositide 3-kinase/AKT pathway. (2005) (188)
- Novel 5α‐steroid reductase (SRD5A3, type‐3) is overexpressed in hormone‐refractory prostate cancer (2007) (187)
- Identification of nectin-4 oncoprotein as a diagnostic and therapeutic target for lung cancer. (2009) (183)
- HLA-B*3505 allele is a strong predictor for nevirapine-induced skin adverse drug reactions in HIV-infected Thai patients (2009) (183)
- A Genome-Wide Association Study Identifies Novel Loci for Paclitaxel-Induced Sensory Peripheral Neuropathy in CALGB 40101 (2012) (183)
- Overexpressed P-cadherin/CDH3 promotes motility of pancreatic cancer cells by interacting with p120ctn and activating rho-family GTPases. (2005) (182)
- Demethylation of RB regulator MYPT1 by histone demethylase LSD1 promotes cell cycle progression in cancer cells. (2011) (177)
- A genome-wide association identified the common genetic variants influence disease severity in β0-thalassemia/hemoglobin E (2009) (177)
- Prediction of sensitivity of advanced non-small cell lung cancers to gefitinib (Iressa, ZD1839). (2004) (177)
- Validation of the histone methyltransferase EZH2 as a therapeutic target for various types of human cancer and as a prognostic marker (2011) (176)
- Isolation of p53‐target genes and their functional analysis (2004) (174)
- Diverse transcriptional initiation revealed by fine, large‐scale mapping of mRNA start sites (2001) (174)
- Involvement of maternal embryonic leucine zipper kinase (MELK) in mammary carcinogenesis through interaction with Bcl-G, a pro-apoptotic member of the Bcl-2 family (2007) (172)
- Genome-wide analysis of gene expression in intestinal-type gastric cancers using a complementary DNA microarray representing 23,040 genes. (2002) (170)
- High-density genotyping study identifies four new susceptibility loci for atopic dermatitis (2013) (170)
- Amplification and over‐expression of the AIB1 nuclear receptor co‐activator gene in primary gastric cancers (2000) (170)
- Variation in TP63 is associated with lung adenocarcinoma susceptibility in Japanese and Korean populations (2010) (168)
- Novel lipogenic enzyme ELOVL7 is involved in prostate cancer growth through saturated long-chain fatty acid metabolism. (2009) (168)
- A genome-wide association study identifies two new susceptibility loci for lung adenocarcinoma in the Japanese population (2012) (167)
- PDZ-binding kinase/T-LAK cell-originated protein kinase, a putative cancer/testis antigen with an oncogenic activity in breast cancer. (2006) (166)
- Myasthenic crisis and polymyositis induced by one dose of nivolumab (2016) (165)
- ITPA polymorphism affects ribavirin-induced anemia and outcomes of therapy--a genome-wide study of Japanese HCV virus patients. (2010) (165)
- RB1 methylation by SMYD2 enhances cell cycle progression through an increase of RB1 phosphorylation. (2012) (165)
- Association of STAT4 with susceptibility to rheumatoid arthritis and systemic lupus erythematosus in the Japanese population. (2008) (165)
- Associations of functional NLRP3 polymorphisms with susceptibility to food-induced anaphylaxis and aspirin-induced asthma. (2009) (164)
- Genome-wide cDNA microarray screening to correlate gene expression profiles with sensitivity of 85 human cancer xenografts to anticancer drugs. (2002) (164)
- Variation in the DEPDC5 locus is associated with progression to hepatocellular carcinoma in chronic hepatitis C virus carriers (2011) (163)
- Genome-wide analysis of gene expression in synovial sarcomas using a cDNA microarray. (2002) (163)
- Involvement of the FGF18 gene in colorectal carcinogenesis, as a novel downstream target of the beta-catenin/T-cell factor complex. (2003) (162)
- p53RDL1 regulates p53-dependent apoptosis (2003) (161)
- Functional haplotypes of PADI 4 , encoding citrullinating enzyme peptidylarginine deiminase 4 , are associated with rheumatoid arthritis (2003) (161)
- Identification of the gene responsible for gelatinous drop-like corneal dystrophy (1999) (161)
- A genome-wide association study identifies four susceptibility loci for keloid in the Japanese population (2010) (161)
- Osteopenia and male-specific sudden cardiac death in mice lacking a zinc transporter gene, Znt5. (2002) (160)
- Identification of the interferon regulatory factor 5 gene (IRF-5) as a direct target for p53 (2002) (159)
- Association of the gene encoding wingless-type mammary tumor virus integration-site family member 5B (WNT5B) with type 2 diabetes. (2004) (159)
- Involvement of PEG10 in human hepatocellular carcinogenesis through interaction with SIAH1. (2003) (158)
- Functional analysis of the thymic stromal lymphopoietin variants in human bronchial epithelial cells. (2009) (158)
- Predicting response to methotrexate, vinblastine, doxorubicin, and cisplatin neoadjuvant chemotherapy for bladder cancers through genome-wide gene expression profiling. (2006) (157)
- Laser capture microdissection and microarray expression analysis of lung adenocarcinoma reveals tobacco smoking- and prognosis-related molecular profiles. (2002) (156)
- Common variants in DVWA on chromosome 3p24.3 are associated with susceptibility to knee osteoarthritis (2008) (155)
- Molecular features of hormone-refractory prostate cancer cells by genome-wide gene expression profiles. (2007) (154)
- A genome-wide association study identifies genetic variants in the CDKN2BAS locus associated with endometriosis in Japanese (2010) (154)
- Gene expression profiles of small-cell lung cancers: molecular signatures of lung cancer. (2006) (153)
- Identification of BMP and Activin Membrane-bound Inhibitor (BAMBI), an Inhibitor of Transforming Growth Factor-β Signaling, as a Target of the β-Catenin Pathway in Colorectal Tumor Cells* (2004) (152)
- Classification of sensitivity or resistance of cervical cancers to ionizing radiation according to expression profiles of 62 genes selected by cDNA microarray analysis. (2002) (149)
- Association of VKORC1 and CYP2C9 polymorphisms with warfarin dose requirements in Japanese patients (2006) (148)
- Critical roles of mucin 1 glycosylation by transactivated polypeptide N-acetylgalactosaminyltransferase 6 in mammary carcinogenesis. (2010) (148)
- Histone lysine methyltransferase SETD8 promotes carcinogenesis by deregulating PCNA expression. (2012) (147)
- Genome-wide association study identifies two susceptibility loci for exudative age-related macular degeneration in the Japanese population (2011) (146)
- Wnt inhibitor Dickkopf-1 as a target for passive cancer immunotherapy. (2010) (146)
- Axin Facilitates Smad3 Activation in the Transforming Growth Factor β Signaling Pathway (2001) (145)
- [BioBank Japan project]. (2005) (142)
- Common variation of IL28 affects gamma-GTP levels and inflammation of the liver in chronically infected hepatitis C virus patients. (2010) (141)
- EB3, a novel member of the EB1 family preferentially expressed in the central nervous system, binds to a CNS-specific APC homologue (2000) (139)
- A variable number of tandem repeats polymorphism in an E2F-1 binding element in the 5′ flanking region of SMYD3 is a risk factor for human cancers (2005) (138)
- Genome-Wide Association Study of Pancreatic Cancer in Japanese Population (2010) (137)
- Detection of K‐ras mutation in sputum by mutant‐allele‐specific amplification (MASA) (1993) (137)
- Identification of 779 genetic variations in eight genes encoding members of the ATP-binding cassette, subfamily C (ABCC/MRP/CFTR) (2002) (136)
- Genome-Wide Association Study of White Blood Cell Count in 16,388 African Americans: the Continental Origins and Genetic Epidemiology Network (COGENT) (2011) (136)
- A genome-wide association study in the Japanese population confirms 9p21 and 14q23 as susceptibility loci for primary open angle glaucoma. (2012) (135)
- Vaccination with multiple peptides derived from novel cancer‐testis antigens can induce specific T‐cell responses and clinical responses in advanced esophageal cancer (2009) (134)
- Genome-wide cDNA microarray analysis of gene-expression profiles involved in ovarian endometriosis. (2003) (134)
- Genome-Wide Association Study Identifies HLA-DP as a Susceptibility Gene for Pediatric Asthma in Asian Populations (2011) (133)
- Localization of membrane-associated guanylate kinase (MAGI)-1/BAI-associated protein (BAP) 1 at tight junctions of epithelial cells (1999) (133)
- Association of genetic polymorphisms in SLCO1B3 and ABCC2 with docetaxel‐induced leukopenia (2008) (132)
- Genome-wide association analysis in East Asians identifies breast cancer susceptibility loci at 1q32.1, 5q14.3 and 15q26.1 (2014) (132)
- Association analysis of SLC22A4, SLC22A5 and DLG5 in Japanese patients with Crohn disease (2004) (132)
- Identification of CRYM as a candidate responsible for nonsyndromic deafness, through cDNA microarray analysis of human cochlear and vestibular tissues. (2003) (132)
- ADAM8 as a Novel Serological and Histochemical Marker for Lung Cancer (2004) (131)
- p53AIP1 regulates the mitochondrial apoptotic pathway. (2002) (131)
- Bcl-2/E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with Bcl-2/Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability (1999) (130)
- Meta-Analysis of Genome-Wide Association Studies Identifies Six New Loci for Serum Calcium Concentrations (2013) (130)
- Genes associated with liver metastasis of colon cancer, identified by genome-wide cDNA microarray. (2004) (129)
- Down-regulation of RAB6KIFL/KIF20A, a kinesin involved with membrane trafficking of discs large homologue 5, can attenuate growth of pancreatic cancer cell. (2005) (128)
- c‐Met activation in lung adenocarcinoma tissues: An immunohistochemical analysis (2007) (128)
- The neuromedin U-growth hormone secretagogue receptor 1b/neurotensin receptor 1 oncogenic signaling pathway as a therapeutic target for lung cancer. (2006) (128)
- Common variants in CASP3 confer susceptibility to Kawasaki disease. (2010) (128)
- Development of an orally-administrative MELK-targeting inhibitor that suppresses the growth of various types of human cancer (2012) (127)
- Genome‐wide analysis of gene expression in human intrahepatic cholangiocarcinoma (2005) (126)
- Afatinib Activity in Platinum-Refractory Metastatic Urothelial Carcinoma in Patients With ERBB Alterations. (2016) (126)
- Therapeutic potential of antibodies against FZD10, a cell-surface protein, for synovial sarcomas (2005) (126)
- Accumulation of genetic changes during development and progression of hepatocellular carcinoma: Loss of heterozygosity on chromosome arm Ip occurs at an early stage of hepatocarcinogenesis (1995) (126)
- Genome-wide association study identifies genetic determinants of warfarin responsiveness for Japanese. (2010) (125)
- A functional single nucleotide polymorphism in the core promoter region of CALM1 is associated with hip osteoarthritis in Japanese. (2005) (125)
- A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (2013) (124)
- A functional single nucleotide polymorphism in mucin 1, at chromosome 1q22, determines susceptibility to diffuse-type gastric cancer. (2011) (124)
- Fukutin is required for maintenance of muscle integrity, cortical histiogenesis and normal eye development. (2003) (124)
- Novel 5 alpha-steroid reductase (SRD5A3, type-3) is overexpressed in hormone-refractory prostate cancer. (2008) (123)
- Multiple Loci Are Associated with White Blood Cell Phenotypes (2011) (123)
- Comparison of gene-expression profiles between diffuse- and intestinal-type gastric cancers using a genome-wide cDNA microarray (2004) (123)
- Association between obesity and polymorphisms in SEC16B, TMEM18, GNPDA2, BDNF, FAIM2 and MC4R in a Japanese population (2009) (123)
- A genome-wide association study identifies two susceptibility loci for duodenal ulcer in the Japanese population (2012) (122)
- Phase II Clinical Trial of Multiple Peptide Vaccination for Advanced Head and Neck Cancer Patients Revealed Induction of Immune Responses and Improved OS (2014) (122)
- Multicenter, phase II clinical trial of cancer vaccination for advanced esophageal cancer with three peptides derived from novel cancer-testis antigens (2012) (122)
- Prevalence of Allergic Rhinitis and Sensitization to Common Aeroallergens in a Japanese Population (2009) (122)
- Involvement of kinesin family member 2C/mitotic centromere‐associated kinesin overexpression in mammary carcinogenesis (2007) (121)
- Plakophilin 3 oncogene as prognostic marker and therapeutic target for lung cancer. (2005) (121)
- Common variant near the endothelin receptor type A (EDNRA) gene is associated with intracranial aneurysm risk (2011) (120)
- IL28B but not ITPA polymorphism is predictive of response to pegylated interferon, ribavirin, and telaprevir triple therapy in patients with genotype 1 hepatitis C. (2011) (120)
- A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (2010) (119)
- Cancer-testis antigen lymphocyte antigen 6 complex locus K is a serologic biomarker and a therapeutic target for lung and esophageal carcinomas. (2007) (119)
- Germ‐line and somatic mutations of the APC gene in patients with turcot syndrome and analysis of APC mutations in brain tumors (1994) (119)
- Correction: Corrigendum: Regulation of histone modification and chromatin structure by the p53–PADI4 pathway (2012) (119)
- VNTR (variable number of tandem repeat) sequences as transcriptional, translational, or functional regulators (1998) (118)
- The lysine 831 of vascular endothelial growth factor receptor 1 is a novel target of methylation by SMYD3. (2007) (118)
- Comparison of gene expression profiles between Opisthorchis viverrini and non‐Opisthorchis viverrini associated human intrahepatic cholangiocarcinoma (2006) (118)
- Identification of human leukocyte antigen‐A24‐restricted epitope peptides derived from gene products upregulated in lung and esophageal cancers as novel targets for immunotherapy (2007) (118)
- Catalog of 605 single-nucleotide polymorphisms (SNPs) among 13 genes encoding human ATP-binding cassette transporters: ABCA4, ABCA7, ABCA8, ABCD1, ABCD3, ABCD4, ABCE1, ABCF1, ABCG1, ABCG2, ABCG4, ABCG5, and ABCG8 (2002) (118)
- Genome-wide association study for intracranial aneurysm in the Japanese population identifies three candidate susceptible loci and a functional genetic variant at EDNRA. (2012) (117)
- Screening for germ‐line mutations in familial adenomatous polyposis patients: 61 new patients and a summary of 150 unrelated patients (1992) (117)
- A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids (2011) (116)
- Impaired function of p53R2 in Rrm2b-null mice causes severe renal failure through attenuation of dNTP pools (2003) (116)
- hCDC4b, a regulator of cyclin E, as a direct transcriptional target of p53 (2003) (116)
- Activation of KIF4A as a Prognostic Biomarker and Therapeutic Target for Lung Cancer (2007) (116)
- Functional SNPs in CD244 increase the risk of rheumatoid arthritis in a Japanese population (2008) (114)
- Regulation of protein Citrullination through p53/PADI4 network in DNA damage response. (2009) (114)
- Whole-genome sequencing and comprehensive variant analysis of a Japanese individual using massively parallel sequencing (2010) (114)
- Genome-Wide Association Analysis in Asthma Subjects Identifies SPATS2L as a Novel Bronchodilator Response Gene (2012) (114)
- New Sequence Variants in HLA Class II/III Region Associated with Susceptibility to Knee Osteoarthritis Identified by Genome-Wide Association Study (2010) (114)
- Enhanced expression of EHMT2 is involved in the proliferation of cancer cells through negative regulation of SIAH1. (2011) (114)
- Identification of Rad51 alteration in patients with bilateral breast cancer (2000) (113)
- Bioinformatic prediction of potential T cell epitopes for SARS-Cov-2 (2020) (113)
- Case–control association study of 59 candidate genes reveals the DRD2 SNP rs6277 (C957T) as the only susceptibility factor for schizophrenia in the Bulgarian population (2009) (113)
- A Genome-Wide Association Study Identified AFF1 as a Susceptibility Locus for Systemic Lupus Eyrthematosus in Japanese (2012) (112)
- Cross-sectional analysis of BioBank Japan clinical data: A large cohort of 200,000 patients with 47 common diseases (2017) (112)
- The Id2 gene is a novel target of transcriptional activation by EWS-ETS fusion proteins in Ewing family tumors (2002) (112)
- Activation of CDCA1-KNTC2, members of centromere protein complex, involved in pulmonary carcinogenesis. (2006) (112)
- Lysyl 5-Hydroxylation, a Novel Histone Modification, by Jumonji Domain Containing 6 (JMJD6)* (2013) (111)
- Phosphorylation and activation of cell division cycle associated 8 by aurora kinase B plays a significant role in human lung carcinogenesis. (2007) (111)
- Allelotype study of esophageal carcinoma (1994) (111)
- Genome-wide association studies of tuberculosis in Asians identify distinct at-risk locus for young tuberculosis (2012) (110)
- Dual-specificity phosphatase 5 (DUSP5) as a direct transcriptional target of tumor suppressor p53 (2003) (110)
- EGR2 induces apoptosis in various cancer cell lines by direct transactivation of BNIP3L and BAK (2003) (109)
- Mutations in the gene encoding KIAA1199 protein, an inner-ear protein expressed in Deiters' cells and the fibrocytes, as the cause of nonsyndromic hearing loss (2003) (109)
- Genetic polymorphism regulating ORM1-like 3 (Saccharomyces cerevisiae) expression is associated with childhood atopic asthma in a Japanese population. (2008) (108)
- Independent and population-specific association of risk variants at the IRGM locus with Crohn's disease (2010) (108)
- Meta‐analysis of published studies identified eight additional common susceptibility loci for Crohn's disease and ulcerative colitis (2011) (108)
- Ubiquitination and downregulation of BRCA1 by ubiquitin-conjugating enzyme E2T overexpression in human breast cancer cells. (2009) (107)
- Common variants at 11q12, 10q26 and 3p11.2 are associated with prostate cancer susceptibility in Japanese (2012) (107)
- Enhanced HSP70 lysine methylation promotes proliferation of cancer cells through activation of Aurora kinase B (2012) (106)
- Elevated expression of protein regulator of cytokinesis 1, involved in the growth of breast cancer cells (2007) (106)
- Identification of a Novel Tumor-Associated Antigen, Cadherin 3/P-Cadherin, as a Possible Target for Immunotherapy of Pancreatic, Gastric, and Colorectal Cancers (2008) (105)
- Genome-wide analysis of organ-preferential metastasis of human small cell lung cancer in mice. (2003) (104)
- A single-nucleotide polymorphism in ANK1 is associated with susceptibility to type 2 diabetes in Japanese populations. (2012) (103)
- Allelotype of uterine cancer by analysis of RFLP and microsatellite polymorphisms: Frequent loss of heterozygosity on chromosome arms 3p, 9q, 10q, and 17p (1994) (102)
- Association of solute carrier family 12 (sodium/chloride) member 3 with diabetic nephropathy, identified by genome-wide analyses of single nucleotide polymorphisms. (2003) (102)
- Hypoxia-inducible protein 2 (HIG2), a novel diagnostic marker for renal cell carcinoma and potential target for molecular therapy. (2005) (101)
- Genomic organization and mutational analysis of KVLQT1, a gene responsible for familial long QT syndrome (1998) (101)
- HCV substitutions and IL28B polymorphisms on outcome of peg-interferon plus ribavirin combination therapy (2010) (101)
- Genome-wide gene-expression profiles of breast-cancer cells purified with laser microbeam microdissection: identification of genes associated with progression and metastasis. (2004) (101)
- Genome-wide profiling of gene expression in 29 normal human tissues with a cDNA microarray. (2002) (100)
- Phase I clinical trial using peptide vaccine for human vascular endothelial growth factor receptor 2 in combination with gemcitabine for patients with advanced pancreatic cancer (2010) (100)
- Functional polymorphism in the suppressor of cytokine signaling 1 gene associated with adult asthma. (2007) (99)
- Minichromosome Maintenance Protein 7 is a potential therapeutic target in human cancer and a novel prognostic marker of non-small cell lung cancer (2011) (98)
- SNPs in BRAP associated with risk of myocardial infarction in Asian populations (2009) (98)
- Influence of ITPA polymorphisms on decreases of hemoglobin during treatment with pegylated interferon, ribavirin, and telaprevir (2011) (98)
- γ-Aminobutyric Acid (GABA) Stimulates Pancreatic Cancer Growth through Overexpressing GABAA Receptor π Subunit (2007) (98)
- Intratumoral expression levels of PD-L1, GZMA, and HLA-A along with oligoclonal T cell expansion associate with response to nivolumab in metastatic melanoma (2016) (98)
- Prediction of response to neoadjuvant chemotherapy for osteosarcoma by gene-expression profiles. (2004) (97)
- The association of a nonsynonymous single-nucleotide polymorphism in TNFAIP3 with systemic lupus erythematosus and rheumatoid arthritis in the Japanese population. (2010) (96)
- Predicting Response to Methotrexate, Vinblastine, Doxorubicin, and Cisplatin Neoadjuvant Chemotherapy for Bladder Cancers through Genome-Wide Gene Expression Profiling (2005) (96)
- Dose-adjustment study of tamoxifen based on CYP2D6 genotypes in Japanese breast cancer patients (2011) (96)
- A Single Nucleotide Polymorphism in the Matrix Metalloproteinase‐1 Promoter in Endometrial Carcinomas (2000) (96)
- A functional SNP in PSMA6 confers risk of myocardial infarction in the Japanese population (2006) (96)
- Molecular features of triple negative breast cancer cells by genome-wide gene expression profiling analysis. (2013) (95)
- A Genome-Wide Association Study of Overall Survival in Pancreatic Cancer Patients Treated with Gemcitabine in CALGB 80303 (2011) (94)
- Increased Expression of Insulin-like Growth Factor-II Messenger RNA–Binding Protein 1 Is Associated with Tumor Progression in Patients with Lung Cancer (2007) (94)
- IL28 variation affects expression of interferon stimulated genes and peg-interferon and ribavirin therapy. (2011) (93)
- Functional SNP in an Sp1-binding site of AGTRL1 gene is associated with susceptibility to brain infarction. (2007) (93)
- Associations of distinct variants of the intestinal mucin gene MUC3A with ulcerative colitis and Crohn's disease (2001) (92)
- The JmjC domain‐containing histone demethylase KDM3A is a positive regulator of the G1/S transition in cancer cells via transcriptional regulation of the HOXA1 gene (2012) (91)
- Pharmacogenomics of tamoxifen: roles of drug metabolizing enzymes and transporters. (2012) (91)
- Mouse Homologue of a Novel Human Oncofetal Antigen, Glypican-3, Evokes T-Cell–Mediated Tumor Rejection without Autoimmune Reactions in Mice (2004) (91)
- A Single Nucleotide Polymorphism within the Acetyl-Coenzyme A Carboxylase Beta Gene Is Associated with Proteinuria in Patients with Type 2 Diabetes (2010) (90)
- The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population. (2011) (90)
- Genetic dissection of ``OLETF'', a rat model for non-insulin-dependent diabetes mellitus (1998) (90)
- A 3‐Mb physical map of the chromosome region 8p21.3‐p22, including a 600‐kb region commonly deleted in human hepatocellular carcinoma, colorectal cancer, and non‐small cell lung cancer (1994) (90)
- Genome-wide association study for C-reactive protein levels identified pleiotropic associations in the IL6 locus. (2011) (90)
- TOPK inhibitor induces complete tumor regression in xenograft models of human cancer through inhibition of cytokinesis (2014) (89)
- Association studies of 33 single nucleotide polymorphisms (SNPs) in 29 candidate genes for bronchial asthma: positive association of a T924C polymorphism in the thromboxane A2 receptor gene (2000) (89)
- FCRL3, an Autoimmune Susceptibility Gene, Has Inhibitory Potential on B-Cell Receptor-Mediated Signaling1 (2009) (89)
- Polypeptide N-acetylgalactosaminyltransferase 6 disrupts mammary acinar morphogenesis through O-glycosylation of fibronectin. (2011) (89)
- Large-scale single-nucleotide polymorphism (SNP) and haplotype analyses, using dense SNP Maps, of 199 drug-related genes in 752 subjects: the analysis of the association between uncommon SNPs within haplotype blocks and the haplotypes constructed with haplotype-tagging SNPs. (2004) (89)
- Identification of Myc-associated protein with JmjC domain as a novel therapeutic target oncogene for lung cancer (2007) (88)
- Critical role of lysine 134 methylation on histone H2AX for γ-H2AX production and DNA repair (2014) (88)
- A novel human tRNA-dihydrouridine synthase involved in pulmonary carcinogenesis. (2005) (88)
- Isolation of a novel human gene, APCDD1, as a direct target of the beta-Catenin/T-cell factor 4 complex with probable involvement in colorectal carcinogenesis. (2002) (88)
- The histone methyltransferase SMYD2 methylates PARP1 and promotes poly(ADP-ribosyl)ation activity in cancer cells. (2014) (87)
- Mutational Analysis of Mismatch Repair Genes, hMLH1 and hMSH2, in Sporadic Endometrial Carcinomas with Microsatellite Instability (1996) (86)
- Prediction of chemosensitivity for patients with acute myeloid leukemia, according to expression levels of 28 genes selected by genome-wide complementary DNA microarray analysis. (2002) (84)
- Association of CDKAL 1 , IGF 2 BP 2 , CDKN 2 A / B , HHEX , SLC 30 A 8 and KCNJ 11 with susceptibility to type 2 diabetes in a Japanese population (2007) (84)
- Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population (2002) (84)
- Predictive value of the IL28B polymorphism on the effect of interferon therapy in chronic hepatitis C patients with genotypes 2a and 2b. (2011) (83)
- Cell-permeable peptide DEPDC1-ZNF224 interferes with transcriptional repression and oncogenicity in bladder cancer cells. (2010) (83)
- Nonrandom Chromosomal Imbalances in Esophageal Squamous Cell Carcinoma Cell Lines: Possible Involvement of the ATF3 and CENPF Genes in the 1q32 Amplicon (2000) (83)
- Histone lysine methyltransferase Wolf-Hirschhorn syndrome candidate 1 is involved in human carcinogenesis through regulation of the Wnt pathway. (2011) (83)
- Oncogenic role of KIAA0101 interacting with proliferating cell nuclear antigen in pancreatic cancer. (2007) (83)
- Common variation in GPC5 is associated with acquired nephrotic syndrome (2011) (83)
- Soluble MICA and a MICA Variation as Possible Prognostic Biomarkers for HBV-Induced Hepatocellular Carcinoma (2012) (83)
- The Fukuyama congenital muscular dystrophy story (2000) (82)
- Novel tumor marker REG4 detected in serum of patients with resectable pancreatic cancer and feasibility for antibody therapy targeting REG4 (2006) (82)
- Breast cancer: The translation of big genomic data to cancer precision medicine (2017) (82)
- Orphan receptor tyrosine kinase ROR2 as a potential therapeutic target for osteosarcoma (2009) (82)
- Functional promoter polymorphism in the TBX21 gene associated with aspirin-induced asthma (2005) (81)
- Phosphorylation and activation of cell division cycle associated 5 by mitogen-activated protein kinase play a crucial role in human lung carcinogenesis. (2010) (81)
- A genome-wide association study reveals susceptibility variants for non-small cell lung cancer in the Korean population. (2010) (81)
- Genome-wide association scan identifies a colorectal cancer susceptibility locus on 11 q 23 and replicates risk loci at 8 q 24 and 18 q 21 (2009) (80)
- Identification of Nine Novel Loci Associated with White Blood Cell Subtypes in a Japanese Population (2011) (80)
- Comparative profiling of serum glycoproteome by sequential purification of glycoproteins and 2-nitrobenzensulfenyl (NBS) stable isotope labeling: a new approach for the novel biomarker discovery for cancer. (2007) (80)
- Involvement of Epithelial Cell Transforming Sequence-2 Oncoantigen in Lung and Esophageal Cancer Progression (2009) (79)
- Toxoplasma gondii exploits UHRF1 and induces host cell cycle arrest at G2 to enable its proliferation (2008) (79)
- HLA‐A2‐restricted CTL epitopes of a novel lung cancer‐associated cancer testis antigen, cell division cycle associated 1, can induce tumor‐reactive CTL (2008) (79)
- APC, K‐ras codon 12 mutations and p53 gene expression in carcinoma and adenoma of the gall‐bladder suggest two genetic pathways in gall‐bladder carcinogenesis (1996) (79)
- Prediction of outcome of advanced cervical cancer to thermoradiotherapy according to expression profiles of 35 genes selected by cDNA microarray analysis. (2004) (79)
- The NSD family of protein methyltransferases in human cancer. (2015) (78)
- Disruption of Fibroblast Growth Factor Signal Pathway Inhibits the Growth of Synovial Sarcomas: Potential Application of Signal Inhibitors to Molecular Target Therapy (2005) (78)
- Analysis of single-nucleotide polymorphisms in Japanese rheumatoid arthritis patients shows additional susceptibility markers besides the classic shared epitope susceptibility sequences. (2004) (78)
- SMYD2-dependent HSP90 methylation promotes cancer cell proliferation by regulating the chaperone complex formation. (2014) (77)
- Association between single-nucleotide polymorphisms in selectin genes and immunoglobulin A nephropathy. (2002) (77)
- A genome-wide association study identifies ITGA9 conferring risk of nasopharyngeal carcinoma (2009) (77)
- Radioimmunotherapy of human synovial sarcoma using a monoclonal antibody against FZD10 (2008) (77)
- Cancer Precision Medicine: From Cancer Screening to Drug Selection and Personalized Immunotherapy. (2017) (76)
- Expression and chromosomal localization of KIAA0369, a putative kinase structurally related to Doublecortin (1998) (76)
- Methylation at CpG islands in intron 1 of EGR2 confers enhancer‐like activity (2003) (76)
- Identification of single-nucleotide polymorphisms (SNPs) of human N-acetyltransferase genes NAT1, NAT2, AANAT, ARD1, and L1CAM in the Japanese population (2001) (75)
- Discovery and fine mapping of serum protein loci through transethnic meta-analysis. (2012) (75)
- Whole-Exome Sequencing of Muscle-Invasive Bladder Cancer Identifies Recurrent Mutations of UNC5C and Prognostic Importance of DNA Repair Gene Mutations on Survival (2014) (75)
- Detection of novel cancer‐testis antigen‐specific T‐cell responses in TIL, regional lymph nodes, and PBL in patients with esophageal squamous cell carcinoma (2008) (75)
- A genomewide linkage analysis of Kawasaki disease: evidence for linkage to chromosome 12 (2006) (75)
- Sensitivities to various epidermal growth factor receptor‐tyrosine kinase inhibitors of uncommon epidermal growth factor receptor mutations L861Q and S768I: What is the optimal epidermal growth factor receptor‐tyrosine kinase inhibitor? (2016) (74)
- Proliferation Potential-Related Protein, an Ideal Esophageal Cancer Antigen for Immunotherapy, Identified Using Complementary DNA Microarray Analysis (2004) (74)
- A functional polymorphism in IL-18 is associated with severity of bronchial asthma. (2009) (74)
- CYP2D6 genotyping for functional-gene dosage analysis by allele copy number detection. (2009) (73)
- Genome-wide gene expression profile analysis of esophageal squamous cell carcinomas. (2006) (73)
- Genetic studies of 457 breast cancers. Clinicopathologic parameters compared with genetic alterations (1994) (73)
- Krüppel‐like factor 12 plays a significant role in poorly differentiated gastric cancer progression (2009) (72)
- Genetic variations in the gene encoding TFAP2B are associated with type 2 diabetes mellitus (2005) (72)
- Nucleobindin 1 Controls the Unfolded Protein Response by Inhibiting ATF6 Activation* (2007) (72)
- WHSC1 Promotes Oncogenesis through Regulation of NIMA-Related Kinase-7 in Squamous Cell Carcinoma of the Head and Neck (2014) (72)
- A pilot study of durvalumab and tremelimumab and immunogenomic dynamics in metastatic breast cancer (2018) (72)
- A phase I study of combination vaccine treatment of five therapeutic epitope-peptides for metastatic colorectal cancer; safety, immunological response, and clinical outcome (2014) (71)
- Critical roles of T‐LAK cell‐originated protein kinase in cytokinesis (2010) (71)
- DNA variations in human and medical genetics: 25 years of my experience (2009) (71)
- Novel and recurrent COMP (cartilage oligomeric matrix protein) mutations in pseudoachondroplasia and multiple epiphyseal dysplasia (1998) (71)
- p53CSV, a novel p53-inducible gene involved in the p53-dependent cell-survival pathway. (2005) (71)
- Implication of allelic polymorphism of osteopontin in the development of lupus nephritis in MRL/lpr mice (2005) (70)
- Twenty single nucleotide polymorphisms (SNPs) and their allelic frequencies in four genes that are responsible for familial long QT syndrome in the Japanese population (2000) (70)
- Validation study of the prediction system for clinical response of M‐VAC neoadjuvant chemotherapy (2007) (70)
- Association of New Loci Identified in European Genome-Wide Association Studies with Susceptibility to Type 2 Diabetes in the Japanese (2011) (69)
- EphA4 receptor, overexpressed in pancreatic ductal adenocarcinoma, promotes cancer cell growth (2006) (69)
- Identification of Epstein-Barr Virus–Induced Gene 3 as a Novel Serum and Tissue Biomarker and a Therapeutic Target for Lung Cancer (2011) (69)
- Development of Serum Glycoproteomic Profiling Technique; Simultaneous Identification of Glycosylation Sites and Site-Specific Quantification of Glycan Structure Changes* (2010) (69)
- Citalopram and escitalopram plasma drug and metabolite concentrations: genome-wide associations. (2014) (68)
- Pharmacogenomics of selective serotonin reuptake inhibitor treatment for major depressive disorder: genome-wide associations and functional genomics (2012) (68)
- Genetic variants associated with angiotensin-converting enzyme inhibitor-associated angioedema (2013) (68)
- Citrullination of RGG Motifs in FET Proteins by PAD4 Regulates Protein Aggregation and ALS Susceptibility. (2018) (68)
- Nucleotide Pyrophosphatase Gene Polymorphism Associated With Ossification of the Posterior Longitudinal Ligament of the Spine (2002) (68)
- Phase I/II study of S-1 plus cisplatin combined with peptide vaccines for human vascular endothelial growth factor receptor 1 and 2 in patients with advanced gastric cancer. (2012) (67)
- A genome-wide association study identifies locus at 10q22 associated with clinical outcomes of adjuvant tamoxifen therapy for breast cancer patients in Japanese. (2012) (67)
- The Histone Demethylase JMJD2B Plays an Essential Role in Human Carcinogenesis through Positive Regulation of Cyclin-Dependent Kinase 6 (2011) (67)
- Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase (2010) (66)
- Dysregulation of AKT Pathway by SMYD2-Mediated Lysine Methylation on PTEN1,2 (2015) (66)
- Deregulation of the histone demethylase JMJD2A is involved in human carcinogenesis through regulation of the G(1)/S transition. (2013) (66)
- Association of single-nucleotide polymorphisms in the polymeric immunoglobulin receptor gene with immunoglobulin A nephropathy (IgAN) in Japanese patients (2003) (66)
- Identification of semaphorin3B as a direct target of p53. (2002) (65)
- Isolation and characterization of a novel serine threonine kinase gene on chromosome 3p22-21.3 (1999) (65)
- Genetic detection of colorectal cancer cells in circulation and lymph nodes (1997) (65)
- A phase ΙI study of five peptides combination with oxaliplatin-based chemotherapy as a first-line therapy for advanced colorectal cancer (FXV study) (2014) (65)
- Expression of Novel Molecules, MICAL2-PV (MICAL2 Prostate Cancer Variants), Increases with High Gleason Score and Prostate Cancer Progression (2006) (64)
- Phase I clinical study of multiple epitope peptide vaccine combined with chemoradiation therapy in esophageal cancer patients (2014) (64)
- Genetically Manipulated Human Embryonic Stem Cell‐Derived Dendritic Cells with Immune Regulatory Function (2007) (64)
- Gamma-aminobutyric acid (GABA) stimulates pancreatic cancer growth through overexpressing GABAA receptor pi subunit. (2007) (64)
- Cancer peptide vaccine therapy developed from oncoantigens identified through genome-wide expression profile analysis for bladder cancer. (2012) (63)
- Characterization of SEZ6L2 cell‐surface protein as a novel prognostic marker for lung cancer (2006) (63)
- Selective estrogen receptor modulators and pharmacogenomic variation in ZNF423 regulation of BRCA1 expression: individualized breast cancer prevention. (2013) (63)
- Polymorphisms in the 3′ UTR in the neurocalcin δ gene affect mRNA stability, and confer susceptibility to diabetic nephropathy (2007) (63)
- Variation of gene-based SNPs and linkage disequilibrium patterns in the human genome. (2004) (62)
- Regulation of iron homeostasis by the p53-ISCU pathway (2015) (62)
- Genetic Changes and Histopathological Grades in Human Hepatocellular Carcinomas (1993) (62)
- Expression profiles of metastatic brain tumor from lung adenocarcinomas on cDNA microarray. (2006) (62)
- A Genome-Wide Association Study of Nephrolithiasis in the Japanese Population Identifies Novel Susceptible Loci at 5q35.3, 7p14.3, and 13q14.1 (2012) (61)
- A genome-wide association study of HCV-induced liver cirrhosis in the Japanese population identifies novel susceptibility loci at the MHC region. (2013) (61)
- Involvement of FKHR-Dependent TRADD Expression in Chemotherapeutic Drug-Induced Apoptosis (2002) (61)
- Association Study of 71 European Crohn's Disease Susceptibility Loci in a Japanese Population (2013) (61)
- Induction of Neoantigen-Specific Cytotoxic T Cells and Construction of T-cell Receptor–Engineered T Cells for Ovarian Cancer (2018) (61)
- Identification of a Functional Variant in the MICA Promoter Which Regulates MICA Expression and Increases HCV-Related Hepatocellular Carcinoma Risk (2013) (61)
- Common variations in PSMD3-CSF3 and PLCB4 are associated with neutrophil count. (2010) (60)
- Genome-wide association study identifies variations in 6p21.3 associated with nevirapine-induced rash. (2011) (60)
- Frequent β‐Catenin Abnormalities in Bone and Soft‐tissue Tumors (1999) (60)
- Eradication of Large Solid Tumors by Gene Therapy with a T-Cell Receptor Targeting a Single Cancer-Specific Point Mutation (2015) (60)
- An association analysis of HLA-DRB1 with systemic lupus erythematosus and rheumatoid arthritis in a Japanese population: effects of *09:01 allele on disease phenotypes. (2013) (60)
- Quantitative T cell repertoire analysis by deep cDNA sequencing of T cell receptor α and β chains using next-generation sequencing (NGS) (2014) (60)
- Aromatase inhibitors, estrogens and musculoskeletal pain: estrogen-dependent T-cell leukemia 1A (TCL1A) gene-mediated regulation of cytokine expression (2012) (60)
- Association between single nucleotide polymorphisms within genes encoding sirtuin families and diabetic nephropathy in Japanese subjects with type 2 diabetes (2011) (60)
- From cancer genomics to thoracic oncology: discovery of new biomarkers and therapeutic targets for lung and esophageal carcinoma (2008) (60)
- Targeting BIG3–PHB2 interaction to overcome tamoxifen resistance in breast cancer cells (2013) (60)
- A novel oncoprotein RNF43 functions in an autocrine manner in colorectal cancer. (2004) (59)
- Dysregulation of protein methyltransferases in human cancer: An emerging target class for anticancer therapy (2016) (59)
- Low T-cell Receptor Diversity, High Somatic Mutation Burden, and High Neoantigen Load as Predictors of Clinical Outcome in Muscle-invasive Bladder Cancer. (2016) (59)
- Preclinical efficacy of maternal embryonic leucine-zipper kinase (MELK) inhibition in acute myeloid leukemia (2014) (59)
- Association study of genetic polymorphism in ABCC4 with cyclophosphamide-induced adverse drug reactions in breast cancer patients (2009) (59)
- High-density association study and nomination of susceptibility genes for hypertension in the Japanese National Project. (2007) (58)
- Ring Finger Protein 43 as a New Target for Cancer Immunotherapy (2004) (58)
- Genome-wide analysis of gene-expression profiles in chronic myeloid leukemia cells using a cDNA microarray. (2003) (58)
- Identification of pigment epithelium-derived factor as a direct target of the p53 family member genes (2005) (58)
- Genome-wide gene expression profiles of clear cell renal cell carcinoma: identification of molecular targets for treatment of renal cell carcinoma. (2006) (58)
- Prediction of Sensitivity to STI571 among Chronic Myeloid Leukemia Patients by Genome‐wide cDNA Microarray Analysis (2002) (58)
- Epigenetic inactivation of the deleted in lung and esophageal cancer 1 gene in nasopharyngeal carcinoma (2007) (57)
- Catalog of 238 variations among six human genes encoding solute carriers (hSLCs) in the Japanese population (2002) (57)
- Identification of COX17 as a therapeutic target for non-small cell lung cancer. (2003) (57)
- Mutations in the BRCA1 gene in Japanese breast cancer patients (1996) (56)
- p53RFP, a p53-inducible RING-finger protein, regulates the stability of p21WAF1 (2003) (56)
- Phase II clinical trial of peptide cocktail therapy for patients with advanced pancreatic cancer: VENUS‐PC study (2016) (56)
- IL-28B predicts response to chronic hepatitis C therapy--fine-mapping and replication study in Asian populations. (2011) (56)
- The histone methyltransferase Wolf–Hirschhorn syndrome candidate 1‐like 1 (WHSC1L1) is involved in human carcinogenesis (2013) (56)
- Identification of immunoglobulin superfamily 11 (IGSF11) as a novel target for cancer immunotherapy of gastrointestinal and hepatocellular carcinomas (2005) (56)
- Genomic organization and mutational analysis of HERG, a gene responsible for familial long QT syndrome (1998) (55)
- Clonal Hematopoiesis in Liquid Biopsy: From Biological Noise to Valuable Clinical Implications (2020) (55)
- Genome‐wide association study identifies a new SMAD7 risk variant associated with colorectal cancer risk in East Asians (2014) (55)
- Absence of mutation in the NOD2/CARD15 gene among 483 Japanese patients with Crohn's disease (2003) (55)
- PADI4 polymorphism predisposes male smokers to rheumatoid arthritis (2010) (55)
- Analysis of gene-expression profiles after gamma irradiation of normal human fibroblasts. (2006) (55)
- Evaluation of CYP2D6 and Efficacy of Tamoxifen and Raloxifene in Women Treated for Breast Cancer Chemoprevention: Results from the NSABP P1 and P2 Clinical Trials (2011) (55)
- Integration of Cell Line and Clinical Trial Genome-Wide Analyses Supports a Polygenic Architecture of Paclitaxel-Induced Sensory Peripheral Neuropathy (2012) (54)
- Genome-wide linkage scan and association study of PARL to the expression of LHON families in Thailand (2010) (54)
- Identification of TOMM34, which shows elevated expression in the majority of human colon cancers, as a novel drug target. (2006) (54)
- HLA-Cw*1202-B*5201-DRB1*1502 haplotype increases risk for ulcerative colitis but reduces risk for Crohn's disease. (2011) (54)
- Proteomic characterization of ovarian cancers identifying annexin‐A4, phosphoserine aminotransferase, cellular retinoic acid‐binding protein 2, and serpin B5 as histology‐specific biomarkers (2012) (54)
- Genome Wide Analysis of Drug-Induced Torsades de Pointes: Lack of Common Variants with Large Effect Sizes (2013) (53)
- CYP2B6 genotype is a strong predictor of systemic exposure to efavirenz in HIV-infected Zimbabweans (2012) (53)
- Evaluating Genetic Risk for Prostate Cancer among Japanese and Latinos (2012) (53)
- Functional Variants in NFKBIE and RTKN2 Involved in Activation of the NF-κB Pathway Are Associated with Rheumatoid Arthritis in Japanese (2012) (53)
- Oncogenic role of MPHOSPH1, a cancer-testis antigen specific to human bladder cancer. (2008) (53)
- A genome-wide association study identifies PLCL2 and AP3D1-DOT1L-SF3A2 as new susceptibility loci for myocardial infarction in Japanese (2014) (52)
- Activation of Placenta-Specific Transcription Factor Distal-less Homeobox 5 Predicts Clinical Outcome in Primary Lung Cancer Patients (2008) (52)
- Discovery of imidazo[1,2-b]pyridazine derivatives: selective and orally available Mps1 (TTK) kinase inhibitors exhibiting remarkable antiproliferative activity. (2015) (52)
- Arthritis in MRL/lpr mice is under the control of multiple gene loci with an allelic combination derived from the original inbred strains. (2002) (52)
- Integrated analysis of somatic mutations and immune microenvironment in malignant pleural mesothelioma (2017) (52)
- Re: CYP2D6 genotype and tamoxifen response in postmenopausal women with endocrine-responsive breast cancer: the Breast International Group 1-98 trial. (2012) (52)
- Single nucleotide polymorphisms in TNFSF 15 confer susceptibility to Crohn ’ s disease (2005) (52)
- Infrequent Mutations in the PTEN/MMAC1 Gene among Primary Breast Cancers (1998) (52)
- Replication Study for the Association Between Four Loci Identified by a Genome-Wide Association Study on European American Subjects With Type 1 Diabetes and Susceptibility to Diabetic Nephropathy in Japanese Subjects With Type 2 Diabetes (2010) (52)
- Genome-wide screening by cDNA microarray of genes associated with matrix mineralization by human mesenchymal stem cells in vitro. (2002) (52)
- Significantly elevated expression of PF4 (platelet factor 4) and eotaxin in the NOA mouse, a model for atopic dermatitis (1999) (52)
- Resequencing and copy number analysis of the human tyrosine kinase gene family in poorly differentiated gastric cancer. (2009) (52)
- Associations of HLA-DP Variants with Hepatitis B Virus Infection in Southern and Northern Han Chinese Populations: A Multicenter Case-Control Study (2011) (52)
- Characterization of T cell repertoire of blood, tumor, and ascites in ovarian cancer patients using next generation sequencing (2015) (52)
- Identification of Promiscuous KIF20A Long Peptides Bearing Both CD4+ and CD8+ T-cell Epitopes: KIF20A-Specific CD4+ T-cell Immunity in Patients with Malignant Tumor (2013) (51)
- Critical roles of LGN/GPSM2 phosphorylation by PBK/TOPK in cell division of breast cancer cells (2010) (51)
- Dipeptidyl peptidase-4 is highly expressed in bronchial epithelial cells of untreated asthma and it increases cell proliferation along with fibronectin production in airway constitutive cells (2016) (51)
- Serum tumor antigen REG4 as a diagnostic biomarker in pancreatic ductal adenocarcinoma (2009) (51)
- A functional variant in ZNF512B is associated with susceptibility to amyotrophic lateral sclerosis in Japanese. (2011) (51)
- Pharmacogenomics and Patient Care: One Size Does Not Fit All (2012) (51)
- Merging pharmacometabolomics with pharmacogenomics using ‘1000 Genomes’ single-nucleotide polymorphism imputation: selective serotonin reuptake inhibitor response pharmacogenomics (2012) (51)
- A functional SNP in EDG2 increases susceptibility to knee osteoarthritis in Japanese. (2008) (51)
- Involvement of RQCD1 overexpression, a novel cancer-testis antigen, in the Akt pathway in breast cancer cells. (2009) (50)
- Deficiency of GMDS leads to escape from NK cell-mediated tumor surveillance through modulation of TRAIL signaling. (2009) (50)
- Association of single-nucleotide polymorphisms in MTMR9 gene with obesity. (2007) (50)
- Clinical significance of clonal hematopoiesis in the interpretation of blood liquid biopsy (2020) (50)
- Coding SNP in tenascin-C Fn-III-D domain associates with adult asthma. (2005) (50)
- Identification of AXUD1, a novel human gene induced by AXIN1 and its reduced expression in human carcinomas of the lung, liver, colon and kidney (2001) (49)
- Cyclin K as a direct transcriptional target of the p53 tumor suppressor. (2002) (49)
- INSIG2 gene rs7566605 polymorphism is associated with severe obesity in Japanese (2008) (49)
- Analysis of gene-expression profiles in testicular seminomas using a genome-wide cDNA microarray. (2003) (49)
- Beta-defensin 1, aryl hydrocarbon receptor and plasma kynurenine in major depressive disorder: metabolomics-informed genomics (2018) (49)
- Allelic losses on chromosome band 11q13 in aldosterone‐producing adrenal tumors (1995) (49)
- Isolation of a novel gene, CABC1, encoding a mitochondrial protein that is highly homologous to yeast activity of bc1 complex. (2002) (49)
- Effective growth-suppressive activity of maternal embryonic leucine-zipper kinase (MELK) inhibitor against small cell lung cancer (2016) (49)
- Constitutive activation of c‐Met is correlated with c‐Met overexpression and dependent on cell–matrix adhesion in lung adenocarcinoma cell lines (2007) (48)
- Identification of a novel human gene, ZFP91, involved in acute myelogenous leukemia. (2003) (48)
- Common genetic polymorphism of ITPA gene affects ribavirin‐induced anemia and effect of peg‐interferon plus ribavirin therapy (2011) (48)
- Targeted serum glycoproteomics for the discovery of lung cancer‐associated glycosylation disorders using lectin‐coupled ProteinChip arrays (2009) (48)
- Genomic structure and multiple single-nucleotide polymorphisms (SNPs) of the thiopurine S-methyltransferase (TPMT) gene (2000) (48)
- Identification of STAG1 as a key mediator of a p53-dependent apoptotic pathway (2004) (48)
- Loss of heterozygosity at the CYP2D6 locus in breast cancer: implications for germline pharmacogenetic studies. (2015) (48)
- Haplotypes with Copy Number and Single Nucleotide Polymorphisms in CYP2A6 Locus Are Associated with Smoking Quantity in a Japanese Population (2012) (47)
- Microarray Analysis of Gene‐expression Profiles in Diffuse Large B‐cell Lymphoma: Identification of Genes Related to Disease Progression (2002) (47)
- Mutations in the N‐terminal globular domain of the type X collagen gene (COL10A1) in patients with Schmid metaphyseal chondrodysplasia (1997) (47)
- Tumor suppressive role of a 2.4 Mb 9q33–q34 critical region and DEC1 in esophageal squamous cell carcinoma (2005) (47)
- Quantitative structural characterization of local N-glycan microheterogeneity in therapeutic antibodies by energy-resolved oxonium ion monitoring. (2012) (47)
- Up-regulation of PSF2, a member of the GINS multiprotein complex, in intrahepatic cholangiocarcinoma. (2005) (47)
- Genome‐wide association study of chemotherapeutic agent‐induced severe neutropenia/leucopenia for patients in Biobank Japan (2013) (47)
- Characteristics and prognosis of Japanese colorectal cancer patients: The BioBank Japan Project (2017) (46)
- Regulatory polymorphisms in EGR2 are associated with susceptibility to systemic lupus erythematosus. (2010) (46)
- Involvement of the tubulin tyrosine ligase-like family member 4 polyglutamylase in PELP1 polyglutamylation and chromatin remodeling in pancreatic cancer cells. (2010) (46)
- Overview of BioBank Japan follow-up data in 32 diseases (2017) (46)
- Trans-ethnic meta-analysis of white blood cell phenotypes. (2014) (46)
- The Xq22 inversion breakpoint interrupted a novel Ras-like GTPase gene in a patient with Duchenne muscular dystrophy and profound mental retardation. (2002) (46)
- Mutational analysis of the RET proto-oncogene in 71 Japanese patients with medullary thyroid carcinoma (1998) (46)
- Oncogenic roles of TOPK and MELK, and effective growth suppression by small molecular inhibitors in kidney cancer cells (2016) (46)
- Genome-wide gene expression profiles of thyroid carcinoma: Identification of molecular targets for treatment of thyroid carcinoma. (2008) (45)
- Oncogenic role of NALP7 in testicular seminomas (2004) (45)
- Effective screening of T cells recognizing neoantigens and construction of T-cell receptor-engineered T cells (2018) (45)
- Plasma low-molecular-weight proteome profiling identified neuropeptide-Y as a prostate cancer biomarker polypeptide. (2013) (45)
- Initial Flight Operations of the Miniature Propulsion System Installed on Small Space Probe: PROCYON (2016) (45)
- Combinational effect of genes for the renin–angiotensin system in conferring susceptibility to diabetic nephropathy (2006) (45)
- Functional haplotypes of IL-12B are associated with childhood atopic asthma. (2005) (45)
- Stanniocalcin 2 overexpression in castration‐resistant prostate cancer and aggressive prostate cancer (2009) (45)
- Fibroblast growth factor receptor 1 oncogene partner as a novel prognostic biomarker and therapeutic target for lung cancer (2007) (45)
- Genetic identity of Fukuyama‐type congenital muscular dystrophy and Walker‐Warburg syndrome (1995) (45)
- Involvement of G‐patch domain containing 2 overexpression in breast carcinogenesis (2009) (44)
- TSPYL5 SNPs: association with plasma estradiol concentrations and aromatase expression. (2013) (44)
- Mapping of a Breast Cancer Tumor Suppressor Gene Locus to a 4‐cM Interval on Chromosome 18q21 (1997) (44)
- Oncogenic Role of MPHOSPH1, a Cancer-Testis Antigen Specific to Human Bladder Cancer (2007) (44)
- Characterization of the human p57KIP2 gene: Alternative splicing, insertion/deletion polymorphisms in VNTR sequences in the coding region, and mutational analysis (1996) (44)
- Mutations in Zinc‐binding Domains of p53 as a Prognostic Marker of Esophageal‐cancer Patients (2000) (44)
- MUTATED G‐PROTEIN‐COUPLED RECEPTOR GPR10 IS RESPONSIBLE FOR THE HYPERPHAGIA/DYSLIPIDAEMIA/OBESITY LOCUS OF Dmo1 IN THE OLETF RAT (2005) (44)
- Identification of secernin 1 as a novel immunotherapy target for gastric cancer using the expression profiles of cDNA microarray (2006) (43)
- ATM: the p53 booster (1998) (43)
- Isolation of LEM domain-containing 1, a novel testis-specific gene expressed in colorectal cancers. (2004) (43)
- Pathway analysis of genome-wide data improves warfarin dose prediction (2013) (43)
- Induction of tenascin‐C by tumor‐specific EWS‐ETS fusion genes (2003) (43)
- Possible involvement of NEDD4 in keloid formation; its critical role in fibroblast proliferation and collagen production (2011) (43)
- Association of variations in HLA class II and other loci with susceptibility to EGFR-mutated lung adenocarcinoma (2016) (43)
- Inverse correlation of the up‐regulation of FZD10 expression and the activation of β‐catenin in synchronous colorectal tumors (2009) (43)
- Immune profiles in primary squamous cell carcinoma of the head and neck. (2019) (43)
- Novel deletion mutations of OPTN in amyotrophic lateral sclerosis in Japanese (2012) (43)
- Single nucleotide polymorphism in ABCG2 is associated with irinotecan-induced severe myelosuppression (2009) (43)
- Enhanced Expression of RAD51 Associating Protein-1 Is Involved in the Growth of Intrahepatic Cholangiocarcinoma Cells (2008) (43)
- No association for Chinese HBV-related hepatocellular carcinoma susceptibility SNP in other East Asian populations (2012) (42)
- Functional SNP of ARHGEF10 confers risk of atherothrombotic stroke. (2010) (42)
- Polymorphisms in NRXN3, TFAP2B, MSRA, LYPLAL1, FTO and MC4R and their effect on visceral fat area in the Japanese population (2010) (42)
- Isolation and Characterization of Human NBL4, a Gene Involved in the β‐Catenin/Tcf Signaling Pathway (2000) (42)
- Pharmacogenetic Discovery in CALGB (Alliance) 90401 and Mechanistic Validation of a VAC14 Polymorphism that Increases Risk of Docetaxel-Induced Neuropathy (2016) (42)
- Inhibition of tumor growth through suppression of angiogenesis by brain-specific angiogenesis inhibitor 1 gene transfer in murine renal cell carcinoma. (2007) (42)
- Population-genetic nature of copy number variations in the human genome (2009) (42)
- Large-scale screening of TARDBP mutation in amyotrophic lateral sclerosis in Japanese (2012) (42)
- A polymorphism in MAPKAPK3 affects response to interferon therapy for chronic hepatitis C. (2009) (42)
- The forkhead box M1 transcription factor as a candidate of target for anti‐cancer immunotherapy (2009) (42)
- A functional variant in NKX3.1 associated with prostate cancer susceptibility down-regulates NKX3.1 expression. (2010) (42)
- Clinical significance of T cell clonality and expression levels of immune-related genes in endometrial cancer (2017) (41)
- Lessons for pharmacogenomics studies: association study between CYP2D6 genotype and tamoxifen response. (2010) (41)
- Aromatase inhibitor-associated bone fractures: a case-cohort GWAS and functional genomics. (2014) (41)
- Prediction of response to imatinib by cDNA microarray analysis. (2003) (41)
- Isolation of development and differentiation enhancing factor-like 1 (DDEFL1) as a drug target for hepatocellular carcinomas. (2004) (41)
- The Transcriptional Landscape of p53 Signalling Pathway (2017) (41)
- Activation of an oncogenic TBC1D7 (TBC1 domain family, member 7) protein in pulmonary carcinogenesis (2010) (41)
- Germline PARP4 mutations in patients with primary thyroid and breast cancers. (2016) (40)
- Variation in the gene encoding Krüppel-like factor 7 influences body fat: studies of 14 818 Danes. (2009) (40)
- Association between HLA-B*4001 and lipodystrophy among HIV-infected patients from Thailand who received a stavudine-containing antiretroviral regimen. (2010) (40)
- Case-control association study of 65 candidate genes revealed a possible association of a SNP of HTR5A to be a factor susceptible to bipolar disease in Bulgarian population. (2009) (40)
- Cystatin C as a p53‐inducible apoptotic mediator that regulates cathepsin L activity (2016) (40)
- HLA‐A SNPs and amino acid variants are associated with nasopharyngeal carcinoma in Malaysian Chinese (2014) (40)
- Optineurin mutations in Japanese amyotrophic lateral sclerosis (2011) (40)
- GWAS identifies two novel colorectal cancer loci at 16q24.1 and 20q13.12 (2018) (40)
- C12orf48, termed PARP‐1 binding protein, enhances poly(ADP‐ribose) polymerase‐1 (PARP‐1) activity and protects pancreatic cancer cells from DNA damage (2011) (40)
- Impact of LIMK1, MMP2 and TNF-α variations for intracranial aneurysm in Japanese population (2011) (39)
- Involvement of TMEM22 overexpression in the growth of renal cell carcinoma cells. (2009) (39)
- Functional single-nucleotide polymorphisms in the secretogranin III (SCG3) gene that form secretory granules with appetite-related neuropeptides are associated with obesity. (2007) (39)
- Comparison of exome-based HLA class I genotyping tools: identification of platform-specific genotyping errors (2016) (39)
- Reevaluation of a lectin antibody ELISA kit for measuring fucosylated haptoglobin in various conditions. (2013) (39)
- Prostate cancer genomics, biology, and risk assessment through genome‐wide association studies (2012) (39)
- Expression profiles of two types of human knee-joint cartilage (2003) (38)
- High proportion of missense mutations of the BRCA1 and BRCA2 genes in Japanese breast cancer families (1998) (38)
- Combined hepatocellular/cholangiocellular carcinoma with sarcomatoid features: genetic analysis for histogenesis. (2001) (38)
- A functional polymorphism in MMP-9 is associated with childhood atopic asthma. (2006) (38)
- The oncogenic polycomb histone methyltransferase EZH2 methylates lysine 120 on histone H2B and competes ubiquitination. (2013) (38)
- A novel tumor‐associated antigen, cell division cycle 45‐like can induce cytotoxic T‐lymphocytes reactive to tumor cells (2011) (38)
- T-LAK Cell-Originated Protein Kinase (TOPK) as a Prognostic Factor and a Potential Therapeutic Target in Ovarian Cancer. (2016) (38)
- SMYD3-mediated lysine methylation in the PH domain is critical for activation of AKT1 (2016) (38)
- Enhanced Expression of EHMT 2 Is Involved in the Proliferation of Cancer Cells through Negative Regulation of SIAH 11 , 2 (2014) (38)
- Activation of an Estrogen/ Estrogen Receptor Signaling by BIG3 Through Its Inhibitory Effect on Nuclear Transport of PHB2/REA in Breast Cancer (2009) (38)
- Megakaryocyte potentiating factor as a tumor marker of malignant pleural mesothelioma: evaluation in comparison with mesothelin. (2008) (38)
- Characterization of T-cell Receptor Repertoire in Inflamed Tissues of Patients with Crohn's Disease Through Deep Sequencing (2016) (38)
- Activation of WD Repeat and High-Mobility Group Box DNA Binding Protein 1 in Pulmonary and Esophageal Carcinogenesis (2009) (38)
- Inhibition of Experimental Intimal Thickening in Mice Lacking a Novel G-Protein–Coupled Receptor (2003) (38)
- Frequent decreased expression of candidate tumor suppressor gene, DEC1, and its anchorage‐independent growth properties and impact on global gene expression in esophageal carcinoma (2008) (38)
- SUV39H2 methylates and stabilizes LSD1 by inhibiting polyubiquitination in human cancer cells (2015) (38)
- Founder-haplotype analysis in Fukuyama-type congenital muscular dystrophy (FCMD) (1998) (38)
- Isolation of two isoforms of the PAX3 gene transcripts and their tissue-specific alternative expression in human adult tissues (1994) (38)
- HLA-DQB1*03 Confers Susceptibility to Chronic Hepatitis C in Japanese: A Genome-Wide Association Study (2013) (37)
- Immunopharmacogenomics towards personalized cancer immunotherapy targeting neoantigens (2018) (37)
- A genome-wide association study identifies SNP in DCC is associated with gallbladder cancer in the Japanese population (2012) (37)
- Shared Genetic Risk Factors of Intracranial, Abdominal, and Thoracic Aneurysms (2016) (37)
- Identification of SPARC as a candidate target antigen for immunotherapy of various cancers (2010) (37)
- Correlation of allelic losses and clinicopathological factors in primary breast cancers (1997) (37)
- PCOTH, a novel gene overexpressed in prostate cancers, promotes prostate cancer cell growth through phosphorylation of oncoprotein TAF-Ibeta/SET. (2005) (37)
- Bcl‐XL Antisense Sensitizes Human Colon Cancer Cell Line to 5‐Fluorouracil (2000) (37)
- A Comprehensive Peptidome Profiling Technology for the Identification of Early Detection Biomarkers for Lung Adenocarcinoma (2011) (37)
- Association of Common Variants in TNFRSF13B, TNFSF13, and ANXA3 with Serum Levels of Non-Albumin Protein and Immunoglobulin Isotypes in Japanese (2012) (37)
- Expression profile analysis of colon cancer cells in response to sulindac or aspirin. (2002) (37)
- Identification of evidence suggestive of an association with peripheral arterial disease at the OSBPL10 locus by genome-wide investigation in the Japanese population. (2010) (37)
- Crosstalk of EDA-A2/XEDAR in the p53 Signaling Pathway (2010) (37)
- Indazole-based potent and cell-active Mps1 kinase inhibitors: rational design from pan-kinase inhibitor anthrapyrazolone (SP600125). (2013) (36)
- Complete cDNA sequence and genomic organization of a human pancreas-specific gene homologous to Caenorhabditis elegans sel-1 (1999) (36)
- Phase I clinical trial of a five-peptide cancer vaccine combined with cyclophosphamide in advanced solid tumors. (2016) (36)
- Serum REG4 Level Is a Predictive Biomarker for the Response to Preoperative Chemoradiotherapy in Patients With Pancreatic Cancer (2009) (36)
- A first-in-human study investigating biodistribution, safety and recommended dose of a new radiolabeled MAb targeting FZD10 in metastatic synovial sarcoma patients (2018) (36)
- Characterization of an Opa interacting protein 5 involved in lung and esophageal carcinogenesis (2012) (36)
- Molecular cloning, mapping, and characterization of a novel human gene, MTA1-L1, showing homology to a metastasis-associated gene, MTA1 (1999) (36)
- Common Variants in a Novel Gene, FONG on Chromosome 2q33.1 Confer Risk of Osteoporosis in Japanese (2011) (35)
- VAV3 mediates resistance to breast cancer endocrine therapy (2014) (35)
- Impact of viral amino acid substitutions and host interleukin‐28b polymorphism on replication and susceptibility to interferon of hepatitis C virus (2011) (35)
- Hypoxia increases the motility of lung adenocarcinoma cell line A549 via activation of the epidermal growth factor receptor pathway (2007) (35)
- Genome-Wide Association Study of Breast Cancer in the Japanese Population (2013) (35)
- IRX4 at 5p15 suppresses prostate cancer growth through the interaction with vitamin D receptor, conferring prostate cancer susceptibility. (2012) (35)
- TRIUMPH: Primary efficacy of a phase II trial of trastuzumab (T) and pertuzumab (P) in patients (pts) with metastatic colorectal cancer (mCRC) with HER2 (ERBB2) amplification (amp) in tumour tissue or circulating tumour DNA (ctDNA): A GOZILA sub-study (2019) (35)
- Frequent allelic loss at the TOC locus on 17q25.1 in primary breast cancers (1999) (34)
- miR‐125b‐1 and miR‐378a are predictive biomarkers for the efficacy of vaccine treatment against colorectal cancer (2017) (34)
- Characterization of the T cell repertoire by deep T cell receptor sequencing in tissues and blood from patients with advanced colorectal cancer (2016) (34)
- Demographic and lifestyle factors and survival among patients with esophageal and gastric cancer: The Biobank Japan Project (2017) (34)
- Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung Cancer (2011) (34)
- Clonal expansion of antitumor T cells in breast cancer correlates with response to neoadjuvant chemotherapy (2016) (34)
- Isolation of HELAD1, a novel human helicase gene up-regulated in colorectal carcinomas (2002) (34)
- Isolation and characterization of a novel human gene, VANGL1, as a therapeutic target for hepatocellular carcinoma. (2002) (34)
- Cleaning up on β-catenin (1997) (34)
- Differential quantification of CYP2D6 gene copy number by four different quantitative real-time PCR assays (2010) (34)
- Genome-wide association study identified SNP on 15q24 associated with bladder cancer risk in Japanese population. (2015) (34)
- Expression and polymorphism (rs4880) of mitochondrial superoxide dismutase (SOD2) and asparaginase induced hepatotoxicity in adult patients with acute lymphoblastic leukemia (2016) (33)
- Inverse association of IL28B genotype and liver mRNA expression of genes promoting or suppressing antiviral state (2011) (33)
- Effects of SMYD2‐mediated EML4‐ALK methylation on the signaling pathway and growth in non‐small‐cell lung cancer cells (2017) (33)
- Distinct pattern of gene expression in pyothorax‐associated lymphoma (PAL), a lymphoma developing in long‐standing inflammation (2004) (33)
- PRMT6 increases cytoplasmic localization of p21CDKN1A in cancer cells through arginine methylation and makes more resistant to cytotoxic agents (2015) (33)
- Preclinical evaluation of biomarkers associated with antitumor activity of MELK inhibitor (2016) (33)
- Polygenic Inheritance of Paclitaxel-Induced Sensory Peripheral Neuropathy Driven by Axon Outgrowth Gene Sets in CALGB 40101 (Alliance) (2014) (33)
- Integration of Mouse and Human Genome-Wide Association Data Identifies KCNIP4 as an Asthma Gene (2013) (33)
- SNPs on chromosome 5p15.3 associated with myocardial infarction in Japanese population (2011) (33)
- Mapping of Target Regions of Allelic Loss in Primary Breast Cancers to 1‐cM Intervals on Genomic Contigs at 6q21 and 6q25.3 (2000) (32)
- Gene-expression profiles of human tumor xenografts in nude mice treated orally with the EGFR tyrosine kinase inhibitor ZD1839. (2003) (32)
- Single-nucleotide polymorphisms in the class II region of the major histocompatibility complex in Japanese patients with immunoglobulin A nephropathy (2002) (32)
- Identification of the interleukin 4 receptor alpha gene as a direct target for p73. (2003) (32)
- Phosphatidylinositol glycan anchor biosynthesis, class X containing complex promotes cancer cell proliferation through suppression of EHD2 and ZIC1, putative tumor suppressors (2016) (32)
- A genome-wide association study of chemotherapy-induced alopecia in breast cancer patients (2013) (32)
- Molecular Cytogenetic Analysis of 17 Renal Cancer Cell Lines: Increased Copy Number at 5q31‐33 in Cell Lines from Nonpapillary Carcinomas (2000) (32)
- Statin use and all-cause and cancer mortality: BioBank Japan cohort (2017) (32)
- Multiple therapeutic peptide vaccines for patients with advanced gastric cancer. (2017) (32)
- T-LAK Cell-Originated Protein Kinase (TOPK) as a Prognostic Factor and a Potential Therapeutic Target in Ovarian Cancer (2016) (32)
- Lack of Association Between Variations of PDE4D and Ischemic Stroke in the Japanese Population (2009) (32)
- Cloning and characterization of human and mouse PROSC (proline synthetase co-transcribed) genes (1999) (32)
- Reproducibility, Performance, and Clinical Utility of a Genetic Risk Prediction Model for Prostate Cancer in Japanese (2012) (31)
- Catalog of 680 variations among eight cytochrome P450 (CYP) genes, nine esterase genes, and two other genes in the Japanese population (2003) (31)
- Characterization of the cryoablation-induced immune response in kidney cancer patients (2017) (31)
- MELK inhibitor, novel molecular targeted therapeutics for human cancer stem cells (2013) (31)
- Important and critical scientific aspects in pharmacogenomics analysis: lessons from controversial results of tamoxifen and CYP2D6 studies (2013) (31)
- FGFR gene alterations in lung squamous cell carcinoma are potential targets for the multikinase inhibitor nintedanib (2016) (31)
- Identification of PDZK4, a novel human gene with PDZ domains, that is upregulated in synovial sarcomas (2004) (31)
- Diaminopyridine-based potent and selective mps1 kinase inhibitors binding to an unusual flipped-Peptide conformation. (2012) (31)
- Catalog of 86 single-nucleotide polymorphisms (SNPs) in three uridine diphosphate glycosyltransferase genes: UGT2A1, UGT2B15, and UGT8 (2002) (31)
- A genome-wide association study identifies novel susceptibility genetic variation for thyrotoxic hypokalemic periodic paralysis (2012) (31)
- WHSC1L1-mediated EGFR mono-methylation enhances the cytoplasmic and nuclear oncogenic activity of EGFR in head and neck cancer (2017) (31)
- Molecular and biological analysis of carcinoma of the small intestine: β-catenin gene mutation by interstitial deletion involving exon 3 and replication error phenotype (2000) (30)
- A whole-genome radiation hybrid panel and framework map of the rat genome (2000) (30)
- Genome Wide Association Study of Age at Menarche in the Japanese Population (2013) (30)
- Overexpression of Peptidyl-Prolyl Isomerase-Like 1 Is Associated with the Growth of Colon Cancer Cells (2006) (30)
- Critical function for nuclear envelope protein TMEM209 in human pulmonary carcinogenesis. (2012) (30)
- A genome-wide association study identifies a genetic variant in the SIAH2 locus associated with hormonal receptor-positive breast cancer in Japanese (2012) (30)
- Multiple single-nucleotide polymorphisms (SNPs) in the Japanese population in six candidate genes for long QT syndrome (2001) (30)
- An association study of asthma and related phenotypes with polymorphisms in negative regulator molecules of the TLR signaling pathway (2006) (30)
- Genome‐wide association study identifies gastric cancer susceptibility loci at 12q24.11‐12 and 20q11.21 (2018) (30)
- WDRPUH, a novel WD-repeat-containing protein, is highly expressed in human hepatocellular carcinoma and involved in cell proliferation. (2005) (30)
- Replication analysis of SNPs on 9p21.2 and 19p13.3 with amyotrophic lateral sclerosis in East Asians (2011) (30)
- The Construction of Risk Prediction Models Using GWAS Data and Its Application to a Type 2 Diabetes Prospective Cohort (2014) (30)
- Guidelines for genetic testing (2001) (30)
- Overexpression of the potential kinase serine/ threonine/tyrosine kinase 1 (STYK 1) in castration‐resistant prostate cancer (2009) (30)
- The gene for mesomelic dysplasia Kantaputra type is mapped to chromosome 2q24-q32 (1998) (30)
- Phase I clinical trial of cell division associated 1 (CDCA1) peptide vaccination for castration resistant prostate cancer (2017) (30)
- TOPK (T‐LAK cell‐originated protein kinase) inhibitor exhibits growth suppressive effect on small cell lung cancer (2017) (29)
- Characteristics and prognosis of Japanese female breast cancer patients: The BioBank Japan project (2017) (29)
- Activation of an estrogen/estrogen receptor signaling by BIG3 through its inhibitory effect on nuclear transport of PHB2/REA in breast cancer (2009) (29)
- Isolation and characterization of a novel human gene, DRCTNNB1A, the expression of which is down-regulated by β-catenin (2000) (29)
- Efficacy of irreversible EGFR-TKIs for the uncommon secondary resistant EGFR mutations L747S, D761Y, and T854A (2017) (29)
- Quantitative characterization of T-cell repertoire and biomarkers in kidney transplant rejection (2016) (29)
- α‐particle therapy for synovial sarcoma in the mouse using an astatine‐211‐labeled antibody against frizzled homolog 10 (2018) (29)
- A replication study for three nephrolithiasis loci at 5q35.3, 7p14.3 and 13q14.1 in the Japanese population (2013) (29)
- An autosomal dominant posterior polar cataract locus maps to human chromosome 20p12–q12 (2000) (29)
- Mutations of the fibroblast growth factor receptor-3 gene in one familial and six sporadic cases of achondroplasia in Japanese patients (1995) (29)
- Multiplex PCR‐based real‐time invader assay (mPCR‐RETINA): a novel SNP‐based method for detecting allelic asymmetries within copy number variation regions (2008) (29)
- Association of a single-nucleotide polymorphism in the immunoglobulin μ-binding protein 2 gene with immunoglobulin A nephropathy (2005) (29)
- Significant Effect of Polymorphisms in CYP2D6 on Response to Tamoxifen Therapy for Breast Cancer: A Prospective Multicenter Study (2016) (29)
- Multiplex Mutation Screening of the BRCA1 Gene in 1000 Japanese Breast Cancers (1998) (29)
- Association study of the polymorphisms on chromosome 12p13 with atherothrombotic stroke in the Japanese population (2010) (28)
- Identification of CDCA1‐derived long peptides bearing both CD4+ and CD8+ T‐cell epitopes: CDCA1‐specific CD4+ T‐cell immunity in cancer patients (2014) (28)
- Localization of the gene responsible for Peutz-Jeghers syndrome within a 6-cM region of chromosome 19p13.3 (1998) (28)
- HLA-DRB1*0901 lowers anti-cyclic citrullinated peptide antibody levels in Japanese patients with rheumatoid arthritis (2009) (28)
- CLCA2 as a p53-inducible senescence mediator. (2012) (28)
- Pharmacoethnicity in Paclitaxel-Induced Sensory Peripheral Neuropathy (2015) (28)
- DDX31 regulates the p53-HDM2 pathway and rRNA gene transcription through its interaction with NPM1 in renal cell carcinomas. (2012) (28)
- Morphological Changes, Cadherin Switching, and Growth Suppression in Pancreatic Cancer by GALNT6 Knockdown1 (2016) (28)
- Effects of structural variations of APOBEC3A and APOBEC3B genes in chronic hepatitis B virus infection (2009) (28)
- Isolation of a novel gene on 8p21.3–22 whose expression is reduced significantly in human colorectal cancers with liver metastasis (2000) (28)
- Establishment of CYP2D6 Reference Samples by Multiple Validated Genotyping Platforms (2014) (28)
- Identification of neoantigen-specific T cells and their targets: implications for immunotherapy of head and neck squamous cell carcinoma (2019) (27)
- Identification of independent risk loci for Graves’ disease within the MHC in the Japanese population (2011) (27)
- WHSC1L1 drives cell cycle progression through transcriptional regulation of CDC6 and CDK2 in squamous cell carcinoma of the head and neck (2016) (27)
- Catalog of 178 variations in the Japanese population among eight human genes encoding G protein-coupled receptors (GPCRs) (2003) (27)
- Detailed analysis of loss of heterozygosity on chromosome band 17p13 in breast carcinoma on the basis of a high‐resolution physical map with 29 markers (1994) (27)
- Common variants on 14q32 and 13q12 are associated with DLBCL susceptibility (2011) (27)
- Importance of immunopharmacogenomics in cancer treatment: Patient selection and monitoring for immune checkpoint antibodies (2016) (27)
- A functional SNP in the NKX2.5-binding site of ITPR3 promoter is associated with susceptibility to systemic lupus erythematosus in Japanese population (2008) (27)
- Molecular nature of chromosome 5q loss in colorectal tumors and desmoids from patients with familial adenomatous polyposis (1990) (27)
- Identification of brain-specific splicing variants of the hDLG1 gene and altered splicing in neuroblastoma cell lines (1998) (26)
- Mapping of a gene responsible for twy (tip-toe walking Yoshimura), a mouse model of ossification of the posterior longitudinal ligament of the spine (OPLL) (1998) (26)
- SMYD3 interacts with HTLV‐1 Tax and regulates subcellular localization of Tax (2011) (26)
- Diversity in immunogenomics: the value and the challenge (2020) (26)
- SUV420H1 enhances the phosphorylation and transcription of ERK1 in cancer cells (2015) (26)
- A functional SNP in ITIH3 is associated with susceptibility to myocardial infarction (2007) (26)
- Predicting response of bladder cancers to gemcitabine and carboplatin neoadjuvant chemotherapy through genome-wide gene expression profiling. (2011) (26)
- Accumulation of genetic alterations during esophageal carcinogenesis (1994) (25)
- Association of the RIP2 gene with childhood atopic asthma. (2006) (25)
- Identification of a significant association of a single nucleotide polymorphism in TNXB with systemic lupus erythematosus in a Japanese population (2008) (25)
- Structural and functional analysis of native peroxiredoxin 2 in human red blood cells. (2012) (25)
- High-resolution SNP and haplotype maps of the human gamma-glutamyl carboxylase gene (GGCX) and association study between polymorphisms in GGCX and the warfarin maintenance dose requirement of the Japanese population (2007) (25)
- Characterization of a VNTR polymorphism in the coding region of the CEL gene (2002) (25)
- Highly clonal regulatory T-cell population in follicular lymphoma – inverse correlation with the diversity of CD8+ T cells (2015) (25)
- Chromosomal imbalances in adult T-cell leukemia revealed by comparative genomic hybridization: gains at 14q32 and 2p16-22 in cell lines (1999) (25)
- Correlation of genetic etiology with response to β-adrenergic blockade among symptomatic patients with familial long-QT syndrome (2001) (25)
- The Textile Plot: A New Linkage Disequilibrium Display of Multiple-Single Nucleotide Polymorphism Genotype Data (2010) (25)
- Over‐expression of cysteine proteinase inhibitor cystatin 6 promotes pancreatic cancer growth (2008) (25)
- Plasma or Serum: Which Is Preferable for Mutation Detection in Liquid Biopsy? (2020) (25)
- Identification of novel epigenetically inactivated gene PAMR1 in breast carcinoma. (2015) (25)
- VNTR sequence on human chromosome 11p15 that affects transcriptional activity (2001) (25)
- PRMT1 promotes mitosis of cancer cells through arginine methylation of INCENP (2015) (24)
- Allelic Loss on Chromosome 9q Is Associated with Lymph Node Metastasis of Primary Breast Cancer (1998) (24)
- An algorithm for inferring complex haplotypes in a region of copy-number variation. (2008) (24)
- A Single Nucleotide Polymorphism in KCNQ1 Is Associated With Susceptibility to Diabetic Nephropathy in Japanese Subjects With Type 2 Diabetes (2010) (24)
- Successful outcomes using combination therapy of interleukin-2 and interferon-alpha for renal cell carcinoma patients with lung metastasis. (2010) (24)
- A genome-wide association study identifies four genetic markers for hematological toxicities in cancer patients receiving gemcitabine therapy (2012) (24)
- Chondrolectin Is a Novel Diagnostic Biomarker and a Therapeutic Target for Lung Cancer (2011) (24)
- GALNT6 Stabilizes GRP78 Protein by O-glycosylation and Enhances its Activity to Suppress Apoptosis Under Stress Condition (2017) (23)
- Downregulation of the tumor suppressor HSPB7, involved in the p53 pathway, in renal cell carcinoma by hypermethylation (2014) (23)
- Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms and age of onset in schizophrenia: A combined analysis of independent samples (2011) (23)
- Frequent Loss of Heterozygosity at the MCC Locus on Chromosome 5q21‐22 in Sporadic Colorectal Carcinomas (1991) (23)
- Allelic loss at the 8p22 region as a prognostic factor in large and estrogen receptor negative breast carcinomas (2000) (23)
- Contribution of a haplotype in the HLA region to anti-cyclic citrullinated peptide antibody positivity in rheumatoid arthritis, independently of HLA-DRB1. (2009) (23)
- Isolation and characterization of a novel gene CLUAP1 whose expression is frequently upregulated in colon cancer (2004) (23)
- Detailed deletion mapping of the short arm of chromosome 3 in small cell and non-small cell carcinoma of the lung (1994) (23)
- Genetic variations in five genes involved in the excitement of cardiomyocytes (2001) (23)
- ESE‐3, an Ets family transcription factor, is up‐regulated in cellular senescence (2007) (23)
- Understanding the functional significance of ghrelin processing and degradation (2011) (23)
- The role of protein methyltransferases as potential novel therapeutic targets in squamous cell carcinoma of the head and neck (2018) (22)
- Molecular cloning and characterization of a novel gene, EMILIN-5, and its possible involvement in skeletal development. (2004) (22)
- Characterization of newly developed SSLP markers for the rat (2000) (22)
- GML sensitizes cancer cells to Taxol by induction of apoptosis (1997) (22)
- Gene expression patterns as marker for 5-year postoperative prognosis of primary breast cancers (2004) (22)
- Protein lysine methyltransferase SMYD3 is involved in tumorigenesis through regulation of HER2 homodimerization (2017) (22)
- Germline mutations of the RET proto-oncogene in eight Japanese patients with multiple endocrine neoplasia type 2A (MEN2A) (1995) (22)
- Similarity of the allele frequency and linkage disequilibrium pattern of single nucleotide polymorphisms in drug-related gene loci between Thai and northern East Asian populations: implications for tagging SNP selection in Thais (2006) (22)
- Serial analysis of gene expression in progressing and regressing mouse tumors implicates the involvement of RANTES and TARC in antitumor immune responses. (2006) (22)
- Correlation of allelic losses and clinicopathological factors in 504 primary breast cancers (1997) (22)
- Cystatin 10, a Novel Chondrocyte-specific Protein, May Promote the Last Steps of the Chondrocyte Differentiation Pathway* (2003) (21)
- Involvement of C12orf32 overexpression in breast carcinogenesis. (2010) (21)
- Genomic organization and mapping of the human activin receptor type IIB (hActR-IIB) gene (1998) (21)
- Identification of HLA-A24-Restricted Novel T Cell Epitope Peptides Derived from P-Cadherin and Kinesin Family Member 20A (2012) (21)
- miR-196b, miR-378a and miR-486 are predictive biomarkers for the efficacy of vaccine treatment in colorectal cancer (2017) (21)
- Comparative FISH mapping of the ancestral fusion point of human chromosome 2 (2004) (21)
- Activation of Th1 Immunity within the Tumor Microenvironment Is Associated with Clinical Response to Lenalidomide in Chronic Lymphocytic Leukemia (2018) (21)
- Non‐transmissible Sendai virus encoding granulocyte macrophage colony‐stimulating factor is a novel and potent vector system for producing autologous tumor vaccines (2008) (21)
- p53-independent p21 induction by MELK inhibition. (2017) (21)
- A polygenic risk score for breast cancer in women receiving tamoxifen or raloxifene on NSABP P-1 and P-2 (2015) (21)
- Infrequent Replication Errors at Microsatellite Loci in Tumors of Patients with Multiple Primary Cancers of the Esophagus and Various Other Tissues (1995) (21)
- Predictive biomarkers for the efficacy of peptide vaccine treatment: based on the results of a phase II study on advanced pancreatic cancer (2017) (21)
- Intranodal Administration of Neoantigen Peptide-loaded Dendritic Cell Vaccine Elicits Epitope-specific T Cell Responses and Clinical Effects in a Patient with Chemorefractory Ovarian Cancer with Malignant Ascites (2020) (20)
- MEK inhibitors against MET-amplified non-small cell lung cancer (2016) (20)
- T-LAK cell-originated protein kinase presents a novel therapeutic target in FLT3-ITD mutated acute myeloid leukemia (2015) (20)
- Identification of sequence polymorphisms in CALM2 and analysis of association with hip osteoarthritis in a Japanese population (2010) (20)
- Critical roles of SMYD2-mediated β-catenin methylation for nuclear translocation and activation of Wnt signaling. (2017) (20)
- A gene encoding a family with sequence similarity 84, member A (FAM84A) enhanced migration of human colon cancer cells. (2006) (20)
- Amino Acid Substitution in HCV Core Region and Genetic Variation near the IL28B Gene Affect Viral Dynamics during Telaprevir, Peginterferon and Ribavirin Treatment (2012) (20)
- Shared Genetic Risk Factors of Intracranial, Abdominal, and Thoracic Aneurysms (2016) (20)
- Deglycosylation and label-free quantitative LC-MALDI MS applied to efficient serum biomarker discovery of lung cancer (2011) (20)
- Amino Acid Substitution in HCV Core/NS5A Region and Genetic Variation Near IL28B Gene Affect Treatment Efficacy to Interferon plus Ribavirin Combination Therapy (2011) (20)
- A novel method for analyzing formalin-fixed paraffin embedded (FFPE) tissue sections by mass spectrometry imaging. (2007) (20)
- Application of DNA markers to clinical genetics (1996) (19)
- Overexpression of Cohesion Establishment Factor DSCC1 through E2F in Colorectal Cancer (2014) (19)
- Critical involvement of RQCD1 in the EGFR-Akt pathway in mammary carcinogenesis. (2010) (19)
- 906 variations among 27 genes encoding cytochrome P450 (CYP) enzymes and aldehyde dehydrogenases (ALDHs) in the Japanese population (2002) (19)
- SLCO1B1 polymorphisms and plasma estrone conjugates in postmenopausal women with ER+ breast cancer: genome-wide association studies of the estrone pathway (2017) (19)
- Genetic basis of tissue specificity of vasculitis in MRL/lpr mice. (2003) (19)
- Genetic alterations in the JAG1 gene in Japanese patients with Alagille syndrome (1999) (19)
- RASEF is a Novel Diagnostic Biomarker and a Therapeutic Target for Lung Cancer (2013) (19)
- Catalog of 300 SNPs in 23 genes encoding G-protein coupled receptors (2004) (19)
- Rapid diagnosis of Miller-Dieker syndrome and isolated lissencephaly sequence by the polymerase chain reaction (1990) (19)
- Association of allelic loss at 8p22 with poor prognosis among breast cancer cases treated with high-dose adjuvant chemotherapy. (2002) (19)
- Risk prediction models for mortality in patients with cardiovascular disease: The BioBank Japan project (2016) (19)
- SLC22A4 polymorphism and rheumatoid arthritis susceptibility: a replication study in a Japanese population and a metaanalysis. (2008) (19)
- Expression of Apc2 during mouse development. (2002) (19)
- Predictive biomarkers for the outcome of vaccination of five therapeutic epitope peptides for colorectal cancer. (2014) (19)
- Characterization of the B-cell receptor repertoires in peanut allergic subjects undergoing oral immunotherapy (2018) (19)
- Molecular cloning of the chromosomal breakpoint in the LIS1 gene of a patient with isolated lissencephaly and balanced t(8;17) (1998) (18)
- Characterization of S818L mutation in HERG C‐terminus in LQT2 (2000) (18)
- Ectopic Expression of Ptf1a Induces Spinal Defects, Urogenital Defects, and Anorectal Malformations in Danforth's Short Tail Mice (2013) (18)
- Whole-genome-wide association study in the Bulgarian population reveals HHAT as schizophrenia susceptibility gene (2013) (18)
- Amino-acid substitutions in the IKAP gene product significantly increase risk for bronchial asthma in children (2001) (18)
- Survival of macrovascular disease, chronic kidney disease, chronic respiratory disease, cancer and smoking in patients with type 2 diabetes: BioBank Japan cohort (2017) (18)
- p 53 R 2-dependent Pathway for DNA Synthesis in a p 53-regulated Cell Cycle Checkpoint 1 (2001) (18)
- Identification of a novel oncogene, MMS22L, involved in lung and esophageal carcinogenesis. (2012) (18)
- MHC (Major Histocompatibility Complex)-DRB Genes and Polymorphisms in Common Marmoset (2000) (18)
- Infrequent Somatic Mutation of the MTS1 Gene in Primary Bladder Carcinomas (1995) (18)
- Effect of CYP4F2, VKORC1, and CYP2C9 in Influencing Coumarin Dose: A Single‐Patient Data Meta‐Analysis in More Than 15,000 Individuals (2019) (18)
- Mutation analysis of COL9A3, a gene highly expressed in the cochlea, in hearing loss patients. (2005) (18)
- Durvalumab and tremelimumab in metastatic breast cancer (MBC): Immunotherapy and immunopharmacogenomic dynamics. (2017) (18)
- Inhaled corticosteroid treatment modulates ZNF432 gene variant's effect on bronchodilator response in asthmatics. (2014) (18)
- Adenovirus‐mediated p53AIP1 gene transfer as a new strategy for treatment of p53‐resistant tumors (2004) (18)
- Down-Regulation of Monocyte Chemotactic Protein-3 by Activated β-Catenin (2000) (18)
- A single nucleotide polymorphism in activated Cdc42 associated tyrosine kinase 1 influences the interferon therapy in hepatitis C patients. (2011) (18)
- Characterization of the T-Cell Receptor Repertoire and Immune Microenvironment in Patients with Locoregionally Advanced Squamous Cell Carcinoma of the Head and Neck (2017) (18)
- Mapping of a gene responsible for dermatitis in NOA (Naruto Research Institute Otsuka Atrichia) mice, an animal model of allergic dermatitis (1999) (18)
- Targeting Suppressor of Variegation 3-9 Homologue 2 (SUV39H2) in Acute Lymphoblastic Leukemia (ALL)1 (2015) (18)
- Maternal Embryonic Leucine Zipper Kinase (MELK), a Potential Therapeutic Target for Neuroblastoma (2019) (17)
- Infrequent Mutation of the H‐Cadherin Gene on Chromosome 16q24 in Human Breast Cancers (1997) (17)
- High-resolution SNP map of ASPN, a susceptibility gene for osteoarthritis (2006) (17)
- Predicting response to docetaxel neoadjuvant chemotherapy for advanced breast cancers through genome-wide gene expression profiling. (2009) (17)
- Catalog of 668 SNPs detected among 31 genes encoding potential drug targets on the cell surface (2003) (17)
- MOCSphaser: a haplotype inference tool from a mixture of copy number variation and single nucleotide polymorphism data (2008) (17)
- Diagnostic evaluation of RNA sequencing for the detection of genetic abnormalities associated with Ph-like acute lymphoblastic leukemia (ALL) (2017) (17)
- Radioimmunotherapy of solid tumors targeting a cell-surface protein, FZD10: therapeutic efficacy largely depends on radiosensitivity (2009) (17)
- Automethylation of SUV39H2, an oncogenic histone lysine methyltransferase, regulates its binding affinity to substrate proteins (2016) (17)
- Loss of BRCA1 in the Cells of Origin of Ovarian Cancer Induces Glycolysis: A Window of Opportunity for Ovarian Cancer Chemoprevention (2017) (17)
- A novel method for analyzing formalin-fixed paraffin embedded (FFPE) tissue sections by mass spectrometry imaging (2007) (17)
- Clinical and histopathological characteristics of patients with prostate cancer in the BioBank Japan project (2017) (17)
- Functional Analyses of Mutations in Receptor Tyrosine Kinase Genes in Non–Small Cell Lung Cancer: Double-Edged Sword of DDR2 (2016) (17)
- Functional impact of IgA nephropathy-associated selectin gene haplotype on leukocyte–endothelial interaction (2006) (17)
- Association analysis of the NOD2 gene with susceptibility to graft-versus-host disease in a Japanese population (2011) (17)
- Identification of a gene disrupted by inv(11)(q13.5;q25) in a patient with left-right axis malformation. (2000) (17)
- Genome-wide association study of epirubicin-induced leukopenia in Japanese patients (2011) (16)
- Should CYP2D6 inhibitors be administered in conjunction with tamoxifen? (2011) (16)
- Genetic polymorphisms in the IL22 gene are associated with psoriasis vulgaris in a Japanese population. (2013) (16)
- Correlation of T-cell inflamed phenotype with mesenchymal subtype, expression of PD-L1, and other immune checkpoints in head and neck cancer. (2014) (16)
- Mutational analysis of the hMLH1 gene using an automated two‐dimensional DNA typing system (1997) (16)
- Catalog of 77 single-nucleotide polymorphisms (SNPs) in the carbohydrate sulfotransferase 1 (CHST1) and carbohydrate sulfotransferase 3 (CHST3) genes (2002) (16)
- Enhanced RASGEF1A Expression Is Involved in the Growth and Migration of Intrahepatic Cholangiocarcinoma (2006) (16)
- Identification of NOL8, a nucleolar protein containing an RNA recognition motif (RRM), which was overexpressed in diffuse‐type gastric cancer (2004) (16)
- Identification of immunogenic LY6K long peptide encompassing both CD4+ and CD8+ T-cell epitopes and eliciting CD4+ T-cell immunity in patients with malignant disease (2014) (16)
- Afatinib against Esophageal or Head-and-Neck Squamous Cell Carcinoma: Significance of Activating Oncogenic HER4 Mutations in HNSCC (2016) (16)
- Identification of candidate predictive markers of anticancer drug sensitivity using a panel of human cancer cell lines (2003) (16)
- Two distinct commonly deleted regions on chromosome 13q suggest involvement of BRCA2 and retinoblastoma genes in sporadic breast carcinomas (1996) (16)
- Phase I Study of Multiple Epitope Peptide Vaccination in Patients With Recurrent or Persistent Cervical Cancer (2018) (16)
- Genome-wide gene expression profiles of ovarian carcinoma: Identification of molecular targets for the treatment of ovarian carcinoma. (2009) (16)
- Sex- and age-dependent gene expression in human liver: An implication for drug-metabolizing enzymes. (2017) (16)
- The Transcription Factor Sp3 Regulates the Expression of a Metastasis-Related Marker of Sarcoma, Actin Filament-Associated Protein 1-Like 1 (AFAP1L1) (2013) (15)
- Integrated analysis of somatic mutations and immune microenvironment of multiple regions in breast cancers. (2017) (15)
- In vivo therapeutic effect of CDH3/P-cadherin-targeting radioimmunotherapy (2012) (15)
- Characteristics of patients with liver cancer in the BioBank Japan project (2017) (15)
- Oncogenic Role of MPHOSPH 1 , a Cancer-Testis Antigen Specific to Human Bladder Cancer (2007) (15)
- Over expression of hypoxia-inducible protein 2, hypoxia-inducible factor-1alpha and nuclear factor kappaB is putatively involved in acquired renal cyst formation and subsequent tumor transformation in patients with end stage renal failure. (2008) (15)
- Maternal isodisomy for 14q21-q24 in a man with diabetes mellitus. (2002) (15)
- Late Cornified Envelope Group I, a Novel Target of p53, Regulates PRMT5 Activity1 (2014) (15)
- Variants of C-C Motif Chemokine 22 (CCL22) Are Associated with Susceptibility to Atopic Dermatitis: Case-Control Studies (2011) (15)
- Tamoxifen Metabolism and Breast Cancer Recurrence: A Question Unanswered by CYPTAM. (2019) (15)
- Characteristics and prognosis of Japanese male and female lung cancer patients: The BioBank Japan Project (2017) (15)
- Identification of novel polymorphisms in the AXIN1 and CDX-2 genes (2000) (14)
- Presymptomatic diagnosis of familial adenomatous polyposis coli (1994) (14)
- Linkage disequilibrium of evolutionarily conserved regions in the human genome (2006) (14)
- 5αDH‐DOC (5α‐dihydro‐deoxycorticosterone) activates androgen receptor in castration‐resistant prostate cancer (2010) (14)
- Critical roles of protein methyltransferases and demethylases in the regulation of embryonic stem cell fate (2017) (14)
- A model of prediction system for adverse cardiovascular reactions by calcineurin inhibitors among patients with renal transplants using gene-based single-nucleotide polymorphisms (2005) (14)
- Presymptomatic direct detection of adenomatous polyposis coli (APC) gene mutations in familial adenomatous polyposis (1993) (14)
- Loci on murine chromosomes 7 and 13 that modify the phenotype of the NOA mouse, an animal model of atopic dermatitis (2001) (14)
- WT1 peptide vaccine in Montanide in contrast to poly ICLC, is able to induce WT1-specific immune response with TCR clonal enrichment in myeloid leukemia (2018) (14)
- Physical and genetic map of 5q31: use of fluorescence in situ hybridization data to identify errors in the CEPH database (1994) (14)
- PlatinumCNV: A Bayesian Gaussian mixture model for genotyping copy number polymorphisms using SNP array signal intensity data (2011) (14)
- Interstitial lung disease in gefitinib-treated Japanese patients with non-small-cell lung cancer: genome-wide analysis of genetic data. (2011) (14)
- Frequent Allelic Loss at 7p14‐15 Associated with Aggressive Histologic Types of Breast Cancer (1998) (14)
- Overexpression of C16orf74 is involved in aggressive pancreatic cancers (2016) (14)
- Determination of splice-site mutations in Lynch syndrome (hereditary non-polyposis colorectal cancer) patients using functional splicing assay (2009) (14)
- Critical Role of Estrogen Receptor Alpha O-Glycosylation by N-Acetylgalactosaminyltransferase 6 (GALNT6) in Its Nuclear Localization in Breast Cancer Cells12 (2018) (14)
- Serum estradiol should be monitored not only during the peri-menopausal period but also the post-menopausal period at the time of aromatase inhibitor administration (2009) (14)
- Construction and characterization of a vestibular-specific cDNA library using T7-based RNA amplification (2003) (14)
- Impact of PSCA Variation on Gastric Ulcer Susceptibility (2013) (14)
- Clinical significance of Akt2 in advanced pancreatic cancer treated with erlotinib. (2017) (14)
- Personalized immunotherapy in cancer precision medicine (2021) (14)
- Significant differences in T cell receptor repertoires in lung adenocarcinomas with and without epidermal growth factor receptor mutations (2019) (14)
- Frequent association of alternative splicing of NER, a nuclear hormone receptor gene in cancer tissues (1997) (14)
- The 11q23 breakpoint in acute leukemia with t(11;19)(q23;p13) is distal to those of t(4;11), t(6;11) and t(9;11) (1992) (13)
- MELK inhibition targets cancer stem cells through downregulation of SOX2 expression in head and neck cancer cells. (2019) (13)
- The era of immunogenomics/immunopharmacogenomics (2018) (13)
- High-resolution SNP map in the 55-kb region containing the selectin gene family on chromosome 1q24–q25 (2003) (13)
- Prediction of response to peginterferon‐alfa‐2b plus ribavirin therapy in Japanese patients infected with hepatitis C virus genotype 1b (2011) (13)
- Generation of neoantigen-specific T cells for adoptive cell transfer for treating head and neck squamous cell carcinoma (2021) (13)
- A genome-wide association study in the Japanese population confirms 9 p 21 and 14 q 23 as susceptibility loci for primary open angle glaucoma (2012) (13)
- Integrated analysis of somatic mutations and immune microenvironment of multiple regions in breast cancers (2017) (13)
- The DNA binding site specificity and antiproliferative property of ternary Pt(II) and Zn(II) complexes of phenanthroline and N,N'-ethylenediaminediacetic acid. (2013) (13)
- Clinical significance of gene mutation in ctDNA analysis for hormone receptor-positive metastatic breast cancer (2020) (13)
- Effective induction of cytotoxic T cells recognizing an epitope peptide derived from hypoxia-inducible protein 2 (HIG2) in patients with metastatic renal cell carcinoma (2016) (13)
- Combined immunotherapy with low-dose IL-2 plus IFN-alpha for metastatic renal cell carcinoma: survival benefit for selected patients with lung metastasis and serum sodium level. (2011) (13)
- Association between genetic variation in the gene for death-associated protein-3 (DAP3) and adult asthma (2004) (13)
- Association of PTEN mutation with HPV-negative adenocarcinoma of the uterine cervix. (2004) (13)
- Identification of an HLA-A2-Restricted Epitope Peptide Derived from Hypoxia-Inducible Protein 2 (HIG2) (2014) (13)
- TCR sequencing analysis of cancer tissues and tumor draining lymph nodes in colorectal cancer patients (2019) (13)
- Serum glucose, cholesterol and blood pressure levels in Japanese type 1 and 2 diabetic patients: BioBank Japan (2017) (13)
- Impact of Allele Copy Number of Polymorphisms in FCGR3A and FCGR3B Genes on Susceptibility to Ulcerative Colitis (2013) (13)
- MRG‐binding protein contributes to colorectal cancer development (2011) (12)
- Inactivation of fibroblast growth factor binding protein 3 causes anxiety-related behaviors (2011) (12)
- Immunotherapy with cancer peptides in combination with intravesical bacillus Calmette–Guerin for patients with non-muscle invasive bladder cancer (2018) (12)
- Identification and allelic frequencies of novel single-nucleotide polymorphisms in the DUSP1 and BTG1 genes (2001) (12)
- Isolation and mapping of a novel human kidney- and liver-specific gene homologous to the bacterial acetyltransferases (1998) (12)
- Enhancement of Migration and Invasion of Gastric Cancer Cells by IQGAP3 (2020) (12)
- Neoantigens elicit T cell responses in breast cancer (2021) (12)
- Ultradeep targeted sequencing of circulating tumor DNA in plasma of early and advanced breast cancer (2020) (12)
- Thirteen single-nucleotide polymorphisms (SNPs) in the alcohol dehydrogenase 4 (ADH4) gene locus (2002) (12)
- Fine-scale SNP map of an 11-kb genomic region at 22q13.1 containing the galectin-1 gene (2005) (12)
- New pharmacogenetic test for detecting an HLA-A*31: 01 allele using the InvaderPlus assay (2012) (12)
- Critical roles of SMYD2-mediated β-catenin methylation for nuclear translocation and activation of Wnt signaling (2017) (12)
- The adenomatous polyposis coli gene and human cancers (2005) (12)
- Interstitial loss of the same region of 5q in multiple adenomas and a carcinoma derived from an adenomatous polyposis coli (apc) patient (1992) (12)
- Prediction of risk of disease recurrence by genome-wide cDNA microarray analysis in patients with Philadelphia chromosome-positive acute lymphoblastic leukemia treated with imatinib-combined chemotherapy. (2007) (12)
- A unique hinge binder of extremely selective aminopyridine-based Mps1 (TTK) kinase inhibitors with cellular activity. (2015) (12)
- Identification of a functional variant in SPLUNC1 associated with nasopharyngeal carcinoma susceptibility among Malaysian Chinese (2012) (12)
- Changes of plasmalogen phospholipid levels during differentiation of induced pluripotent stem cells 409B2 to endothelial phenotype cells (2017) (12)
- Japanese single nucleotide polymorphism database for 267 possible drug‐related genes (2006) (12)
- Germline Variants and Advanced Colorectal Adenomas: Adenoma Prevention with Celecoxib Trial Genome-wide Association Study (2013) (12)
- Toward the establishment of a prediction system for the personalized treatment of chronic hepatitis C. (2012) (11)
- The vitamin D receptor gene as a determinant of survival in pancreatic cancer patients: Genomic analysis and experimental validation (2018) (11)
- Preapoptotic protease calpain-2 is frequently suppressed in adult T-cell leukemia. (2013) (11)
- Association of neutrophil extracellular traps with the development of idiopathic osteonecrosis of the femoral head. (2020) (11)
- 31st Annual Meeting and Associated Programs of the Society for Immunotherapy of Cancer (SITC 2016): part two (2016) (11)
- Frameshift Mutation of the STK11 Gene in a Sporadic Gastrointestinal Cancer with Microsatellite Instability (1999) (11)
- Expression of intelectin-1 in bronchial epithelial cells of asthma is correlated with T-helper 2 (Type-2) related parameters and its function (2017) (11)
- Isolation and characterization of the mouse ortholog of the Fukuyama-type congenital muscular dystrophy gene. (2002) (11)
- Development of novel SUV39H2 inhibitors that exhibit growth suppressive effects in mouse xenograft models and regulate the phosphorylation of H2AX (2018) (11)
- Cosmid Contigs Spanning 9q34 Including the Candidate Region for TSC1 (1995) (11)
- Inherited genetic variation in EPHA5, FGD4, and NRDG1 and paclitaxel (P)-induced peripheral neuropathy (PN): Results from a genome-wide association study (GWAS) in CALGB 40101. (2010) (11)
- A chemical compound for controlled expression of nmt1-driven gene in the fission yeast Schizosaccharomyces pombe. (2011) (11)
- Cancer peptide vaccine to suppress postoperative recurrence in esophageal SCC patients with induction of antigen-specific CD8+ T cell. (2017) (10)
- Submicroscopic deletions at 13q32.1 cause congenital microcoria. (2015) (10)
- Identification of 156 novel SNPs in 29 genes encoding G-protein coupled receptors (2005) (10)
- Development of small molecular compounds targeting cancer stem cells. (2017) (10)
- Serum tumor antigen REG4 as a useful diagnostic biomarker in gastric cancer. (2010) (10)
- Clinical implementation and current advancement of blood liquid biopsy in cancer (2021) (10)
- Linkage analysis of hereditary thyroid carcinoma with and without pheochromocytoma (1989) (10)
- Detection of circulating tumor DNA in patients of operative colorectal and gastric cancers (2020) (10)
- Design of a Millimeter-Wave Concentrator for Beam Reception in High-Power Wireless Power Transfer (2017) (10)
- PKIB expression strongly correlated with phosphorylated Akt expression in breast cancers and also with triple-negative breast cancer subtype (2012) (10)
- Abstract 1971: Genome-wide Association Study Identifies Novel Genomic Regions Associated With Drug-induced Long Qt Syndrome (2009) (10)
- Allelic Losses of Loci at 3 p 25 . 1 , 8 p 22 , 13 q 12 , 17 p 13 . 3 , and 22 q 13 Correlate with Postoperative Recurrence in Breast Cancer 1 (2001) (10)
- Comparison of inducible nitric oxide synthase mRNA expression in different airway portions and association with nitric oxide parameters from patients with asthma (2019) (10)
- Genome-wide association study for C-reactive protein levels identified pleiotropic associations in the IL 6 locus (2011) (10)
- p 53 AIP 1 Regulates the Mitochondrial Apoptotic Pathway 1 (2002) (10)
- Molecular cloning and characterization of two novel genes on chromosome 8p21.3 (2000) (10)
- Genomic organization, mapping, and polymorphisms of the gene encoding human cartilage intermediate layer protein (CILP) (1999) (10)
- Isolation and characterization of a human cDNA homologous to the Xenopus laevis XCAP-C gene belonging to the structural maintenance of chromosomes (SMC) family (1999) (10)
- WHSC 1 Promotes Oncogenesis through Regulation of NIMA-Related Kinase-7 in Squamous Cell Carcinoma of the Head and Neck (2015) (10)
- Identification of 46 novel SNPs in the 130-kb region containing a myocardial infarction susceptibility gene on chromosomal band 6p21 (2003) (10)
- A Genome-Wide Association Study of Nephrolithiasis in the Japanese Population Identifies Novel Susceptible Loci at 5 q 35 . 3 , 7 p 14 . 3 , and 13 q 14 . 1 (2012) (9)
- Single-nucleotide polymorphisms in GALNT8 are associated with the response to interferon therapy for chronic hepatitis C. (2013) (9)
- High-density SNP map of human ITR, a gene associated with vascular remodeling (2003) (9)
- Correction: Genome Wide Association Study of Age at Menarche in the Japanese Population (2013) (9)
- Bilaterally symmetrical effects of high threshold afferents from the masseteric muscle on the jaw movement (1971) (9)
- Selective Estrogen Receptor Modulators and Pharmacogenomic Variation in ZNF 423 Regulation of BRCA 1 Expression : Individualized Breast Cancer Prevention (2013) (9)
- Molecular cloning, expression, and mapping of a novel human cDNA, GRP17, highly homologous to human gadd45 and murine MyD118 (1999) (9)
- Alteration of the LIS1 gene in Japanese patients with isolated lissencephaly sequence or Miller-Dieker syndrome (1998) (9)
- Correlation of allelic loss with poor postoperative survival in breast cancer (1999) (9)
- Advances in Brief Identification of COX 17 as a Therapeutic Target for Non-Small Cell Lung Cancer 1 (2003) (9)
- Recombination rates of genes expressed in human tissues. (2008) (9)
- Identification by differential display of eight known genes induced during in vivo intimal hyperplasia (1998) (9)
- Phase II Adjuvant Cancer-specific Vaccine Therapy for Esophageal Cancer Patients Curatively Resected After Preoperative Therapy With Pathologically Positive Nodes; Possible Significance of Tumor Immune Microenvironment in its Clinical Effects (2020) (9)
- A phase II trial of low-dose docetaxel (DCT) 60 mg/m2 in platinum-pretreated advanced non-small cell lung cancer (NSCLC) (2000) (9)
- Regulatory polymorphisms in EGR 2 are associated with susceptibility to systemic lupus erythematosus (2010) (9)
- A phase I clinical trial of RNF43 peptide-related immune cell therapy combined with low-dose cyclophosphamide in patients with advanced solid tumors (2018) (9)
- Genetic differences in the two main groups of the Japanese population based on autosomal SNPs and haplotypes (2012) (9)
- Regular ArticleThe CEPH Consortium Linkage Map of Human Chromosome 11 (1995) (9)
- Recent advances in active specific cancer vaccine treatment for colorectal cancer. (2012) (9)
- Identification and characterization of a cDNA, which is highly homologous to the ribonucleoprotein gene, from a locus (D1OS102) closely linked to MEN2 (multiple endocrine neoplasia type 2) (1993) (9)
- Protein methyltransferases and demethylases dictate CD8+ T-cell exclusion in squamous cell carcinoma of the head and neck (2017) (8)
- Analysis of APCL, a Brain‐specific Adenomatous Polyposis Coli Homologue, for Mutations and Expression in Brain Tumors (1999) (8)
- Assignment of Common AlÃ-eleLoss in Osteosarcoma to the Subregion 17 pl 3 ' (2006) (8)
- Immunoglobulin profiling identifies unique signatures in patients with Kawasaki disease during intravenous immunoglobulin treatment (2018) (8)
- 612TiPTRIUMPH Study: A multicenter Phase II study to evaluate efficacy and safety of combination therapy with trastuzumab and pertuzumab in patients with HER2-positive metastatic colorectal cancer (EPOC1602) (2017) (8)
- Isolation and characterization of a novel serine threonine kinase gene on chromosome 3 p 22-21 . 3 (8)
- Dose escalation prophylactic donor lymphocyte infusion after T-cell depleted matched related donor allogeneic hematopoietic cell transplantation is feasible and results in higher donor chimerism, faster immune re-constitution, and prolonged progression-free survival (2020) (8)
- Potent anti‐myeloma activity of the TOPK inhibitor OTS514 in pre‐clinical models (2019) (8)
- High-density single-nucleotide polymorphism (SNP) map in the 96-kb region containing the entire human DiGeorge syndrome critical region 2 (DGCR2) gene at 22q11.2 (2001) (8)
- FISH mapping of a translocation breakpoint at 6q21 (or q22) in a patient with heterotaxia (1997) (8)
- Expression of hypoxia-inducible protein 2 in renal cell carcinoma: A promising candidate for molecular targeting therapy. (2010) (8)
- Novel p 53-Inducible Gene Involved in the p 53-Dependent Cell-Survival Pathway (2005) (8)
- Identification of a nuclear protein, LRRC42, involved in lung carcinogenesis. (2014) (8)
- A remote control system for FPGA-embedded modules in radiation environments (2002) (7)
- A rare polymorphic variant of NBS1 reduces DNA repair activity and elevates chromosomal instability. (2014) (7)
- Screening of 336 single-nucleotide polymorphisms in 85 obesity-related genes revealed McKusick–Kaufman syndrome gene variants are associated with metabolic syndrome (2009) (7)
- Aberrant laminin beta-3 isoforms downstream of EWS-ETS fusion genes in ewing family tumors (2005) (7)
- Cooperation of genes in HPV16 E6/E7-dependent cervico-vaginal carcinogenesis trackable by endoscopy and independent of exogenous estrogens or carcinogens. (2020) (7)
- Association of EMCN with Susceptibility to Rheumatoid Arthritis in a Japanese Population (2011) (7)
- p53-independent p21 induction by MELK inhibition (2017) (7)
- Isolation of a Novel Gene Showing Reduced Expression in Metastatic Colorectal Carcinoma Cell Lines and Carcinomas (1997) (7)
- Maturational sequence of neuroblastoma revealed by molecular analysis on cDNA microarrays. (2002) (7)
- Thrust generation experiments on microwave rocket with a beam concentrator for long distance wireless power feeding (2018) (7)
- Establishment of a standardized system to perform population structure analyses with limited sample size or with different sets of SNP genotypes (2010) (7)
- Inference from the relationships between linkage disequilibrium and allele frequency distributions of 240 candidate SNPs in 109 drug-related genes in four Asian populations (2004) (7)
- Identification of two novel breast cancer loci through large-scale genome-wide association study in the Japanese population (2019) (7)
- A clinical trial of multiple peptides vaccination for advanced head and neck cancer patients induced immune responses and prolonged OS (2015) (7)
- A high-resolution cytogenetic map of human chromosome 12: Localization of 195 new cosmid markers by direct R-banding fluorescence in situ hybridization (1993) (7)
- New correction algorithms for multiple comparisons in case-control multilocus association studies based on haplotypes and diplotype configurations (2008) (7)
- P-120 Prospective observational study monitoring circulating tumor DNA in resectable colorectal cancer patients undergoing radical surgery: GALAXY study in CIRCULATE-Japan (trial in progress) (2020) (7)
- Large scale genome-wide association study in a Japanese population identified 45 novel susceptibility loci for 22 diseases (2019) (7)
- Aberrant splicing caused by a MLH1 splice donor site mutation found in a young Japanese patient with Lynch syndrome (2012) (7)
- Institutional Profile: University of Chicago Center for Personalized Therapeutics: research, education and implementation science. (2013) (7)
- A Pilot Study of Post-Operative Adjuvant Vaccine for Advanced Gastric Cancer. (2017) (7)
- Two replication regions in the pJM1 virulence plasmid of the marine pathogen Vibrio anguillarum. (2012) (7)
- WHSC1 monomethylates histone H1 and induces stem-cell like features in squamous cell carcinoma of the head and neck (2020) (7)
- The road map of cancer precision medicine with the innovation of advanced cancer detection technology and personalized immunotherapy. (2019) (7)
- Advances in Brief Involvement of the FGF 18 Gene in Colorectal Carcinogenesis , as a Novel Downstream Target of the-Catenin / T-Cell Factor Complex 1 (2003) (6)
- Status of the APC Gene in Familial and Sporadic Colorectal Tumours as Determined by Closely Flanking Markers (1990) (6)
- [A case of inoperable gastric small cell carcinoma effectively treated by chemotherapy and radiotherapy]. (2006) (6)
- A human gene that restores the DNA-repair defect in SCID mice is located on 8p11.1→q11.1 (2004) (6)
- Overrepresentation of the EBAG 9 Gene at 8 q 23 Associated with Early-Stage Breast Cancers 1 (2001) (6)
- The N-ras oncogene is activated in a human medulloblastoma cell line (1989) (6)
- Sustained Oligoclonal T Cell Expansion Correlates with Durable Response to Immune Checkpoint Blockade in Lung Cancer (2017) (6)
- Clinicopathologic significance of protein lysine methyltransferases in cancer (2020) (6)
- Twenty single-nucleotide polymorphisms in four genes encoding cardiac ion channels (2002) (6)
- Deep-sequencing of the T-cell receptor repertoire in patients with haplo-cord and matched-donor transplants (2015) (6)
- Imaging of lysophosphatidylcholine in an induced pluripotent stem cell-derived endothelial cell network (2020) (6)
- Multicenter, phase II clinical trial of cancer vaccination for advanced esophageal cancer with three peptides derived from novel cancer-testis antigens (2012) (6)
- Similarity and difference in tumor-infiltrating lymphocytes in original tumor tissues and those of in vitro expanded populations in head and neck cancer (2017) (6)
- TCR Clonal Evolution in AML Patients in Morphologic Remission Treated with Anti-PD1 Antibody, Nivolumab (2016) (6)
- Dinucleotide repeat polymorphism on chromosome 9q32 (1995) (6)
- High expression of maternal embryonic leucine-zipper kinase (MELK) impacts clinical outcomes in patients with ovarian cancer and its inhibition suppresses ovarian cancer cells growth ex vivo (2020) (6)
- Re: Concordance between CYP2D6 genotypes obtained from tumor-derived and germline DNA. (2014) (6)
- Identification of a set of genes associated with response to interleukin-2 and interferon-α combination therapy for renal cell carcinoma through genome-wide gene expression profiling. (2010) (6)
- Integrated pathway analysis of nasopharyngeal carcinoma implicates the axonemal dynein complex in the Malaysian cohort (2016) (6)
- Quantitative analysis and clonal characterization of T-cell receptor β repertoires in patients with advanced non-small cell lung cancer treated with cancer vaccine. (2017) (6)
- A Gln/Arg polymorphism at codon 349 of the hBUBR1 gene (1999) (5)
- Heterozygosities and allelic frequencies of 358 dinucleotide-repeat marker loci in the Japanese population (1998) (5)
- Abstract 15518: Novel SNPs Associated with Warfarin Dose in a Large Multicenter Cohort of African Americans: Genome Wide Association Study and Replication Results (2011) (5)
- Automated SNPs typing system based on the Invader assay. (2009) (5)
- Immunogenomics in personalized cancer treatments (2021) (5)
- Surgical resection of a left lung cancer with attention to the path of blood vessels after induction chemotherapy: Report of a case and review of the literature (2006) (5)
- Regulation of histone modification and chromatin structure by the p53–PADI4 pathway (2012) (5)
- A Possible Mechanism of Cisplatin-Induced Tumor Necrosis Factor (TNF)-α Production in Murine Macrophages (2013) (5)
- Dinucleotide repeat polymorphism in the first intron of the CSR gene (1998) (5)
- Two-Stage-to-Orbit Transporting System Combining Microwave Rocket and Microwave Thermal Rocket for Small Satellite Launch (2016) (5)
- Identification of Fractalkine , a CX 3 C-type Chemokine , as a Direct Target of p 531 (2000) (5)
- Criterion values for multiplex SNP genotyping by the invader assay. (2010) (5)
- Morphological classification of nearby galaxies based on asymmetry and luminosity concentration (2006) (5)
- Herpes simplex virus‐induced, death receptor‐dependent apoptosis and regression of transplanted human cancers (2004) (5)
- Functional genomics for breast cancer drug target discovery (2021) (5)
- Corrigendum: Localization of a gene for Fukuyama type congenital muscular dystrophy to chromosome 9q31–33 (1994) (5)
- CD8 lymphocytes in tumors and nonsynonymous mutational load correlate with prognosis of bladder cancer patients treated with immune checkpoint inhibitors (2018) (5)
- Cholesterol levels of Japanese dyslipidaemic patients with various comorbidities: BioBank Japan (2017) (5)
- A < 1.7 cM interval is responsible for Dmo1 obesity phenotypes in OLETF rats (2004) (5)
- A human gene that restores the DNA-repair defect in SCID mice is located on 8 pl l . 1 > qll . 1 (5)
- Identification of 20 novel SNPs in the guanine nucleotide binding protein alpha 12 gene locus (2004) (5)
- The GALNT6‑LGALS3BP axis promotes breast cancer cell growth. (2019) (4)
- Allelotype Analysis in Osteosarcomas: Frequent Alà eleLoss on 3q, 13q, 17p, and ISq1 (2006) (4)
- Involvement of RQCD 1 overexpression , a novel cancer-testis antigen , in the Akt pathway in breast cancer cells (4)
- Potential involvement of p53 in ischemia/reperfusion-induced osteonecrosis (2008) (4)
- [Phase I study of combination therapy with peptide vaccine and anti-cancer drug for colorectal cancer]. (2008) (4)
- Phase 2 studies of multiple peptides cocktail vaccine for treatment-resistant cervical and ovarian cancer. (2015) (4)
- Germline PARP 4 mutations in patients with primary thyroid and breast cancers (2016) (4)
- Molecular targeting of cell-permeable peptide inhibits pancreatic ductal adenocarcinoma cell proliferation (2017) (4)
- Challenges and Future Directions of Immunopharmacogenomics (2015) (4)
- Clinical efficacy of a traditional Japanese (kampo) medicine for burning mouth syndrome (2016) (4)
- Investigation of Increase in Aerodynamic Drag Caused by a Passing Vehicle (2018) (4)
- Potential Role of BRCA 2 in a Mitotic Checkpoint after Phosphorylation by hBUBR 11 (2000) (4)
- Host molecular defense mechanisms against Chlamydophila pneumoniae and genetic studies of immune-response-related genes in asthma. (2009) (4)
- Identification of cytotoxic T cells and their T cell receptor sequences targeting COVID-19 using MHC class I-binding peptides (2022) (4)
- Stimulation of the ATPase activity of Hsp90 by zerumbone modification of its cysteine residues destabilizes its clients and causes cytotoxicity. (2018) (4)
- Association of Allelic Losses at 3p25.1, 13q12, or 17p13.3 with Poor Prognosis in Breast Cancers with Lymph Node Metastasis (2001) (4)
- Aerodynamic drag reduction of a simplified vehicle model by promoting flow separation using plasma actuator (2019) (4)
- FZD10‐targeted α‐radioimmunotherapy with 225Ac‐labeled OTSA101 achieves complete remission in a synovial sarcoma model (2021) (4)
- Crosstalk of EDA-A 2 / XEDAR in the p 53 Signaling Pathway (2010) (4)
- Anti-cancer immunotherapy using cancer-derived multiple epitope-peptides cocktail vaccination clinical studies in patients with refractory/persistent disease of uterine cervical cancer and ovarian cancer [phase 2] (2020) (4)
- Genome‐wide association study of epilepsy in a Japanese population identified an associated region at chromosome 12q24 (2021) (4)
- The efficacy of nivolumab for unresectable metastatic mucosal melanoma (2016) (4)
- P3.02c-058 In-Depth Molecular Characterization of T Cell Clonal Expansion Induced by Anti-PD1 Therapy in NSCLC: Topic: IT Biomarkers (2017) (4)
- Genetic alteration of the DCX gene in Japanese patients with subcortical laminar heterotopia or isolated lissencephaly sequence (2000) (4)
- Evaluation of Genexus system that automates specimen-to-report for cancer genomic profiling within a day using liquid biopsy. (2020) (4)
- Erratum to “Characteristics and prognosis of Japanese colorectal cancer patients: The BioBank Japan Project” [J Epidemiol 27(3S) (2017) S36–S42] (2017) (3)
- Precision Medicine for Colorectal Cancer with Liquid Biopsy and Immunotherapy (2021) (3)
- Phase I/II study of novel HLA-A24 restricted DEPDC1 and MPHOSPH1 peptide vaccine for bladder cancer. (2010) (3)
- Multistep Carcinogenesis of Esophageal Carcinoma (1997) (3)
- Signi fi cant Effect of Polymorphisms in CYP 2 D 6 on Response to Tamoxifen Therapy for Breast Cancer : A Prospective Multicenter Study (2017) (3)
- Host cell-specific effects of lentiviral accessory proteins on the eukaryotic cell cycle progression. (2009) (3)
- A prospective study to examine the accuracies and efficacies of prediction systems for response to neoadjuvant chemotherapy for muscle invasive bladder cancer (2018) (3)
- Development of new HLA-B*3505 genotyping method using Invader assay. (2010) (3)
- Phosphorylation and activation of CDCA8 by aurora kinase B plays a significant role in human lung carcinogenesis: A new pathway of oncogenesis as a molecular therapeutic target (2008) (3)
- Involvement of TMEM 22 overexpression in the growth of renal cell carcinoma cells (3)
- Genes associated with serum estrone, estrone conjugates, and androstenedione concentrations in postmenopausal women with estrogen receptor-positive breast cancer. (2014) (3)
- Contribution of pre-existing neoantigen-specific T cells to a durable complete response after tumor-pulsed dendritic cell vaccine plus nivolumab therapy in a patient with metastatic salivary duct carcinoma (2021) (3)
- Searching the Gene Responsible to Familial Polyposis Coli (FAP) (1990) (3)
- Personalizing carbamazepine therapy (2011) (3)
- Glutamic Acid Has a Liver-Protective Effect through the Suppression of Inducible Nitric Oxide Synthase in Primary Cultured Rat Hepatocytes (2015) (3)
- Molecular characterization of immune exclusion in small-cell lung cancer. (2016) (3)
- Abstract PD05-02: Genome-Wide Associations of Breast Events and Functional Genomic Studies in High-Risk Women Receiving Tamoxifen or Raloxifene on NSABP P1 and P2 Prevention Trials. A Pharmacogenomics Research Network-RIKEN-NSABP Collaboration (2010) (3)
- OA13.05 Somatic Genetic Alterations and Immune Microenvironment in Malignant Pleural Mesothelioma (2017) (3)
- Single-nucleotide polymorphisms in GALNT 8 are associated with the response to interferon therapy for chronic hepatitis C (2012) (3)
- Allelic Loss at 1 p 34 – 36 Predicts Poor Prognosis in Node-negative Breast Cancer 1 (2000) (3)
- Identification of C2orf18, termed ANT2BP (ANT2‐binding protein), as one of the key molecules involved in pancreatic carcinogenesis (2009) (3)
- Reply to T. Lang et al (2010) (3)
- [Possible role of genetic factors on reduced risk for gastric cancer among duodenal ulcer patients]. (2013) (3)
- Genetic variations in medical research in the past, at present and in the future (2021) (3)
- Frequent Allelic Loss at 6q26-27 in Breast Carcinomas of the Solid-tubular Histologic Type (1998) (3)
- Application of targeted nanopore sequencing for the screening and determination of structural variants in patients with Lynch syndrome (2021) (3)
- Genome-wide Analysis of Gene Expression in Human Hepatocellular Carcinomas Using cDNA Microarray : Identification of Genes Involved in Viral Carcinogenesis and Tumor Progression 1 (2001) (3)
- Impact of four loci on serum tamsulosin hydrochloride concentration (2012) (2)
- A phase I study of amrubicin and carboplatin for previously untreated patients with extensive stage small-cell lung cancer (2008) (2)
- A functional variant in NKX 3 . 1 associated with prostate cancer susceptibility down-regulates NKX 3 . 1 expression (2010) (2)
- 980: Predicting Response to M-VAC Neoadjuvant Chemotherapy for Bladder Cancers through Genomewide Gene Expression Profiling (2006) (2)
- Molecular and Cellular Pathobiology A Rare Polymorphic Variant of NBS 1 Reduces DNA Repair Activity and Elevates Chromosomal Instability (2014) (2)
- Current international consensus on burning mouth syndrome : systematic review of recent review articles (2017) (2)
- Metabolism Cancer Growth through Saturated Long-Chain Fatty Acid Novel Lipogenic Enzyme ELOVL 7 Is Involved in Prostate (2009) (2)
- A Genome-Wide Association Study Of Bronchodilator Response (2012) (2)
- Retraction: Curcumin targets Akt cell survival signaling pathway in HTLV-I-infected T-cell lines. (2011) (2)
- Abstract P6-05-14: Estrogen-induced genes in ductal carcinoma in situ(DCIS): their comparison with invasive ductal carcinoma. (2012) (2)
- Making a haplotype catalog with estimated frequencies based on SNP homozygotes (2010) (2)
- Advances in Brief Correlation between Expression of the Matrix Metalloproteinase-1 Gene in Ovarian Cancers and an Insertion / Deletion Polymorphism in Its Promoter Region 1 (1999) (2)
- Microsatellite instability status in metastatic colorectal cancer and effect of immune checkpoint inhibitors on survival in MSI-high metastatic colorectal cancer (2019) (2)
- 113TiP Prospective observational study monitoring circulating tumour DNA in resectable colorectal cancer patients undergoing radical surgery: GALAXY study in CIRCULATE-Japan (2020) (2)
- Efficacy of Intranodal Neoantigen Peptide-pulsed Dendritic Cell Vaccine Monotherapy in Patients With Advanced Solid Tumors: A Retrospective Analysis (2021) (2)
- Isolation and characterization of a human cDNA encoding a protein homologous to the 7.2-kDa protein (subunit X) of bovine ubiquinol-cytochrome C reductase (2000) (2)
- Aerodynamic drag change of simplified automobile models influenced by a passing vehicle (2020) (2)
- Detection by DGGE of a new polymorphism closely linked to the adenomatous polyposis coli region (1992) (2)
- Sustained oligoclonal T cell expansion correlates with durable response to anti-PD1 therapy. (2017) (2)
- Identification of HLA-A 24-Restricted Novel T Cell Epitope Peptides Derived from P-Cadherin and Kinesin Family Member 20 A (2014) (2)
- Abstract 4899: Tumor T-cell receptor (TCR) diversity elucidates the immune response to genetic alterations of muscle-invasive bladder cancer (2015) (2)
- Retraction. Cloning and expression of soluble recombinant human esophageal cancer-related gene 4 protein and its inhibitory effect on tumor growth in vitro and in vivo in esophageal carcinoma. (2011) (2)
- A Genome-Wide Association Study in Patients Experiencing Musculoskeletal Adverse Events on Aromatase Inhibitors as Adjuvant Therapy in Early Breast Cancer Entered on NCIC CTG Trial MA.27. A Pharmacogenetics Research Network-RIKEN Collaboration. (2009) (2)
- Identification of 45 novel SNPs in the 83-kb region containing peptidylarginine deiminase types 1 and 3 loci on chromosomal band 1p36.13 (2004) (2)
- Retracted: Modulation of p53 /Akt / phosphatase and tensin homolog expression by esculetin potentiates the anticancer activity of cisplatin and prevents its nephrotoxicity. (2012) (2)
- Insertion/Deletion Polymorphism and Other Restriction Fragment Length Polymorphisms in the MCC Gene (1992) (2)
- hzAnalyzer: detection, quantification, and visualization of contiguous homozygosity in high-density genotyping datasets (2011) (2)
- 2193 (2017) (2)
- Phase I clinical trial of multi-antigen peptide vaccines therapy using cancer-testis antigens for patients with advanced or recurrent breast cancer. (2012) (2)
- Abstract 29: Nectin-4 cell-surface oncoprotein in serum and tumor issue as a diagnostic and therapeutic target for lung cancer (2010) (2)
- Accurate automated clustering of two-dimensional data for single-nucleotide polymorphism genotyping by a combination of clustering methods: evaluation by large-scale real data (2007) (2)
- Allelic frequencies of twelve dinucleotide repeat marker loci on chromosome 13 in the normal Japanese population (1997) (2)
- Induced Pluripotent Stem Cells for Regenerative Medicine: Quality Control Based on Evaluation of Lipid Composition. (2019) (2)
- Genetic linkage analyses of Romano-Ward syndrome (RWS) in 13 Japanese families (1994) (2)
- PS01.05: Early and Persistent Oligoclonal T Cell Expansion Correlates with Durable Response to Anti‐PD1 Therapy in NSCLC: Topic: Medical Oncology (2016) (1)
- Anti-cancer Immunotherapy Epitope-peptides Vaccination in Patients with Refractory/Persistent Disease of Cervical Cancer and Ovarian Cancer (Phase 1 Studies) (2019) (1)
- PBK/TOPK, a mitotic Ser/Thr kinase, is a novel druggable target for breast cancer therapy (2008) (1)
- Genetic polymorphisms correlate with overall survival (OS) in advanced non-small cell lung cancer (NSCLC) treated with carboplatin (CBDCA) and paclitaxel (PTX) (2008) (1)
- Predicting Response toMethotrexate , Vinblastine , Doxorubicin , and Cisplatin Neoadjuvant Chemotherapy for Bladder Cancers through Genome-Wide Gene Expression Profiling (2005) (1)
- Ordered Phosphorylation Governs Oscillation of a Three-Protein Circadian Clock (2007) (1)
- A genome-wide association study (GWAS) of docetaxel-induced peripheral neuropathy in CALGB 90401 (Alliance). (2013) (1)
- 1275 PHASE I CLINICAL TRIAL OF NOVEL CDCA1 DERIVED EPITOPE PEPTIDE VACCINE THERAPY FOR CASTRATION-RESISTANT PROSTATE CANCER (2011) (1)
- Genome-Wide Association Study in Thai Tsunami Survivors Identified Risk Alleles for Posttraumatic Stress Disorder (2015) (1)
- A genome wide search for Kawasaki disease susceptibility genes (2003) (1)
- Abstract 5063: PSCA as a potential therapeutic and prognostic biomarker for common cancer (2014) (1)
- Cancer Genomics and Molecular Diagnosis—The Nineteenth International Symposium of Sapporo Cancer Seminar (1999) (1)
- [SNP collection, pharmacogenomics, and the future of drug therapy]. (2002) (1)
- Influence of DAP1 Genotype and Psychosocial Factors on Posttraumatic Stress Disorder in Thai Tsunami Survivors: A GxE Approach (2019) (1)
- Identification of the vortex around a vehicle by considering the pressure minimum (2020) (1)
- Abstract 1765: Ras and EF-hand domain containing as a novel tissue biomarker and a therapeutic target for lung cancer (2014) (1)
- Late-breaking abstract: Genome-wide association of GLCCI1 with asthma steroid treatment response (2011) (1)
- A NUMERICAL SIMULATION FOR THE TSUNAMI ASCENDING RIVERS (2017) (1)
- A first-in-man phase I trial of a new monoclonal antibody labelled with yttrium 90 for radioimmunotherapy of relapsed or refractory non resectable synovial-sarcomas (2013) (1)
- Abstract 952: Preclinical efficacy of maternal embryonic leucine-zipper kinase (MELK) inhibition in acute myeloid leukemia (2014) (1)
- Mapping of a new target region of allelic loss to a 6‐cM interval at 21q21 in primary breast cancers (1998) (1)
- Documents for Knitting Document Management Practices in a Craft Workshop for Bilingual Migrant Women (2003) (1)
- Association of HER2 and ErbB3 molecular alterations with afatinib sensitivity in platinum-refractory metastatic urothelial carcinoma (UC) in a phase II trial. (2015) (1)
- Abstract 18723: Genetic Variants Associated with QT Prolongation in Patients Exposed to Sotalol: A Genome Wide Association Study (2012) (1)
- Renal Cell Carcinoma Common Regions of Deletion on Chromosomes 5 q , 6 q , and 10 q Updated (2006) (1)
- Abstract P5-01-15: Monitoring of CDK4/6 inhibitor treatment response through blood liquid biopsy in metastatic breast cancer (2020) (1)
- MA15.07 Molecular Determinants of Lack of Tumor Immune Infiltration in NSCLC (2017) (1)
- FK506 a and c cyclosporin A A iinhibit g granulocyte/macrophage colony-stimulating ffactor p production b by m mononuclear cells iin a asthma (1995) (1)
- A novel glycoproteomic approach for the discovery of carbohydrate-targeting serum tumor markers for lung cancer using Lectin-coupled ProteinChip system (2008) (1)
- Molecular and Cellular Pathobiology Critical Function for Nuclear Envelope Protein TMEM 209 in Human Pulmonary Carcinogenesis (2012) (1)
- "BioBank Japan" Project toward the Personalized Medicine ; from Basic Genome Analysis to Clinic(The 69th Annual Scientific Meeting of the Japanese Circulation Society) (2005) (1)
- miR-196b and miR-486 as predictive biomarkers for the efficacy of the vaccine treatment: From the results of phase I and II studies for metastatic colorectal cancer. (2015) (1)
- Gene-based genome-wide association study on identification of susceptible genes of cerebral infarction (2005) (1)
- Abstract 868: Characterization of LASEP3 as a serological and prognostic biomarker and a therapeutic target for lung cancer (2014) (1)
- Numerical Calculation on Air-Inlet Design of Microwave Rocket (2018) (1)
- WT1 Peptide Vaccine Is Able to Induce WT1-Specifc Immune Response with TCR Clonal Enrichment to Control Minimal Residual Disease in Patients with Myeloid Leukemia (2016) (1)
- Abstract 1648: MICA variation and soluble MICA are possible prognostic biomarkers for HBV-induced hepatocellular carcinoma (2012) (1)
- Afatinib activity in platinum-refractory metastatic urothelial carcinoma (UC) patients with ErbB alterations: Results of a phase II trial. (2016) (1)
- MP49-18 IMPACT OF POLYMORPHISMS IN ABCB1 AND NRI2 WITH DOCETAXEL RESPONSE FOR CASTRATION-RESISTANT PROSTATE CANCER (2014) (1)
- Genetic Counseling for Familial Adenomatons Polyposis with Chromosome Sq Linkage Information (1990) (1)
- Orally administrative melk (maternal embryonic leucine zipper kinase)-targeting small molecule inhibitor suppresses the growth of various types of human cancer. (2013) (1)
- Aberrant splicing caused by a MLH1 splice donor site mutation found in a young Japanese patient with Lynch syndrome (2012) (1)
- 144 GENOME-WIDE ASSOCIATION STUDY IDENTIFIES MULTIPLE NEW SUSCEPTIBILITY LOCI FOR PROSTATE CANCER IN JAPANESE POPULATION (2011) (1)
- Abstract 3568: Quantitative t cell receptor (tcr) repertoire analysis by next-generation sequencing (ngs) in non-small cell lung cancer patients treated with therapeutic cancer peptide vaccines (2014) (1)
- Advances in Brief Absence of Genetic Alteration at Codon 531 of the Human csrc Gene in 479 Advanced Colorectal Cancers from Japanese and Caucasian Patients 1 (1999) (1)
- Phase II clinical trial of multiple peptide vaccination for advanced head and neck cancer patients with induced immune responses and a prolonged OS. (2014) (1)
- Cosmid clones from microdissected human chromosomal region 15q11–q13 (1993) (1)
- Abstract 353: Dickkopf-1 as a biomarker and a molecular target for antibody-based cancer immunotherapy (2011) (1)
- Biomarkers for immunotherapy: Results from the analysis of an HLA-status double-blind, biologically randomized phase II study of five therapeutic epitope-peptides with oxaliplatin-based chemotherapy as first-line therapy for advanced colorectal cancer (FXV study). (2014) (1)
- Aromatase inhibitors , estrogens and musculoskeletal pain : estrogen-dependent T-cell leukemia 1 A ( TCL 1 A (2012) (1)
- Restriction fragment length polymorphism detected by human salivary amylase cDNA (2004) (1)
- Prognostic and predictive impact on FMS-like tyrosine kinase 3 (FLT3) amplification in patients with metastatic colorectal cancer (2019) (1)
- Dual-color FISH analysis of breakpoints on robertsonian translocations (1997) (1)
- Abstract 3214: Definition of biosimilars: Energy Resolved Oxonium Ion Monitoring (Erexim) technology grasps detailed N-glycan microheterogeneity on therapeutic antibodies. (2013) (1)
- 503 Experiments for a Health Monitoring of a Structure using Accurately Controlled Elastic Waves (2013) (1)
- Eldon Gardner Memorial Lecture: Genetic Mapping and Allelic Heterogeneity of the Familial Polyposis Gene (1990) (1)
- Association of SNPs in ABCC1 gene with overall survival in stage IV pancreatic adenocarcinoma patients treated with gemcitabine monotherapy (2008) (1)
- Aromatase inhibitors, estrogens and musculoskeletal pain: estrogen-dependent T-cell leukemia 1A (TCL1A) gene-mediated regulation of cytokine expression (2012) (1)
- Characterization of LASEP3 as a serological and prognostic biomarker and a therapeutic target for lung cancer. (2015) (1)
- Abstract 2386: Molecular-cytogenetic analysis of the maternal embryonic leucine-zipper kinase (MELK) oncogene in cancer (2014) (1)
- WDRPUH, a novel WD-repeat protein highly expressed in hepatocellular carcinoma, is involved in proliferation of cancer cells (2005) (1)
- Retraction: Anti-adult T-cell leukemia effects of a novel synthetic retinoid, Am80 (Tamibarotene). (2011) (1)
- Amplification of mutant KRASG12D in a patient with advanced metastatic pancreatic adenocarcinoma detected by liquid biopsy: A case report (2021) (1)
- Biological difference of tumour mutational burden (TMB) and microsatellite instability (MSI) status in patients (pts) with somatic vs germline BRCA1/2-mutated advanced gastrointestinal (GI) cancers using cell-free DNA (cfDNA) sequencing analysis in the GOZILA study (2019) (1)
- Abstract 4687: Characterization of the cryoablation-induced immune response in kidney cancer patients (2017) (1)
- Abstract P3-14-12: High Risk of Recurrence in Japanese Patients with HER2-Positive T1N0 Breast Cancer (2010) (1)
- Enhanced RASGEF 1 A Expression Is Involved in the Growth andMigration of Intrahepatic Cholangiocarcinoma (2006) (1)
- The Monitoring of Serum Pro-Gastrin-Releasing Peptide (ProGRP) and Neuron-Specific Enolase (NSE) during Chemotherapy Is Useful for the Prognostic Assessment of Patients with Small-Cell Lung Cancer (SCLC). (2009) (1)
- A genome-wide association study (GWAS) of docetaxel-induced neutropenia in CALGB 90401/60404 (Alliance). (2014) (0)
- VAV3 mediates resistance to breast cancer endocrine therapy (2014) (0)
- Dual inhibition of BET and mutant BRAF in BRAF-mutant colon cancer cells suppresses oncogenic pathways and synergistically inhibits their growth (2016) (0)
- Identification of PAMP (pancreas cancer mitochondrial protein) as a novel molecular target for pancreatic cancer therapy (2008) (0)
- Review article The Fukuyama congenital muscular dystrophy story (2000) (0)
- Structural basis for hemi-methylated CpG DNA recognition by mouse Np95 SRA domain (2008) (0)
- Whole Exome Sequencing Elucidates Genomic Evolution of Extramedullary Acute Myeloid Leukemia (EM-AML) from Bone Marrow Acute Myeloid Leukemia (BM-AML) (2016) (0)
- Integrated genomics-based approach to identify new therapeutic targets and cancer biomarkers for lung cancer. (2019) (0)
- CRYSTAL STRUCTURE OF HUMAN MPS1 CATALYTIC DOMAIN IN COMPLEX WITH 4-[(4-amino-5-cyano-6-ethoxypyridin-2- yl)amino]benzamide (2012) (0)
- Abstract #4159: Identification of novel tumor-associated antigens, Cadherin 3 (CDH3)/P-Cadherin and RAB6KIFL/KIF20A, as targets for anticancer immunotherapy of pancreatic cancer (2009) (0)
- Abstract 75: Identification and characterization of novel MELK (maternal embryonic leucine zipper kinase) substrates in breast cancer cells (2012) (0)
- Change of Editorship 2012 (2012) (0)
- 77 Predicting responses to neoadjuvant chemotherapy for muscle invasive bladder cancers for prospective study (2013) (0)
- 1107 POSTER Phase I Study of Multiple Peptides Vaccination in Patients With Advanced Bile Duct Cancer (2011) (0)
- Abstract 2037: A discovery study to identify clinical and genetic risk factors for bevacizumab (BEV)-related gastrointestinal (GI) hemorrhage (HEM) in metastatic castration-resistant prostate cancer (mCRPC) patients (pts) treated on CALGB 90401 (Alliance) (2016) (0)
- Abstract 3040: Characterization of a lung cancer growth factor, LASEP1 as a serological biomarker and a therapeutic target (2011) (0)
- 1110P Efficacy of salvage therapies after failure of anti-PD-1 monotherapy for advanced melanoma in an Asian population: A multi-institutional historical cohort study (2020) (0)
- Retraction statement: ‘Glabridin attenuates the migratory and invasive capacity of breast cancer cells by activating microRNA-200c’ by Xianqing Ye, Fei Jiang, Yuan Li, Juan Mu, Lu Si, Xingxing Wang, Shilong Ning and Zhong L. (2015) (0)
- Abstract 977: Glycosylation of estrogen receptor alpha by N-acetylgalactosaminyltransferase 6 in breast cancer (2018) (0)
- Abstract 4788: A focused proteomics technology QUEST-MS identified a novel plasma prostate cancer biomarker polypeptide complementing PSA test (2012) (0)
- [A phase I study of combination-therapy with gemcitabine and epitope peptides derived from human vascular endothelial growth factor receptor for unresectable or recurrent pancreas cancer]. (2008) (0)
- Abstract 4535: SUV420H1 enhances the phosphorylation and transcription of ERK1 in cancer cells (2016) (0)
- A multicenter phase II study of TAS-114 in combination with S-1 in patients with pre-treated advanced gastric cancer (EPOC1604) (2019) (0)
- Abstract 690: Characterization of serine/threonine phosphatase LAPP1 as a diagnostic and therapeutic target for lung cancer (2015) (0)
- Title: WHSC1 Promotes Oncogenesis through Regulation of NIMA-related-kinase-7 in Squamous Cell Carcinoma of the Head and Neck (2014) (0)
- Tokuda Akihiro Tomida Shinya Toyokuni Hitoshi Tsuda Shoichiro Tsugane Tatsuhiko Tsunoda Heiichiro Udono Koji Ueda Yoshimasa Uehara Hiroo Ueno Kazuo Umezawa Toshikazu Ushijima Toshihiko Wakabayashi Kenji Wakai Tetsuro Watabe (2016) (0)
- for lung cancer RASEF is a novel diagnostic biomarker and a therapeutic target (2013) (0)
- Abstract 3430: Recurrent somatic mutations of nitric oxide synthaseNOS3, netrin receptorUNC5Cand DNA repair genes in muscle-invasive bladder carcinoma (2014) (0)
- Phase I and II Clinical Study of Cancer Vaccine Consisting of 5 Novel Epitope Peptides For Patients with Metastatic Colorectal Cancer (MCRC) (2012) (0)
- Abstract 2031: Association between CYP2D6 genotype and response to tamoxifen in a prospective multicenter study in Japan (2016) (0)
- OS1. gastric cancer (2012) (0)
- Abstract 5568: Development of serum glycoproteomic profiling technology for the identification of pancreatic cancer biomarkers: simultaneous identification of glycosylation sites and site-specific quantification of glycan structure changes (2010) (0)
- Abstract 1224: Identification of novel p53 targets by RNA sequencing in mice liver tissues (2015) (0)
- Abstract 4403: SMYD2-mediated lysine methylation regulates nuclear transport of beta-catenin in human cancer cells (2016) (0)
- Retraction: Epstein-Barr virus-encoded latent membrane protein 1 activates β-catenin signaling in B lymphocytes. (2011) (0)
- CRYSTAL STRUCTURE OF HUMAN MPS1 CATALYTIC DOMAIN IN COMPLEX WITH (E)-3-(4-((6-(((3s,5s,7s)-adamantan-1-yl)amino)-4-amino-5-cyanopyridin-2-yl)amino)-2-(cyanomethoxy)phenyl)-N-(2-methoxyethyl)acrylamide (2015) (0)
- 28 The relationship between maximal standardized uptake value on fluorodeoxyglucose positron emission tomography and clinical prognostic factors in non-small-cell lung cancer (2005) (0)
- Diagnosis System of Drug Sensitivity of Cancer Using cDNA Microarray and Multivariate Statistical Analysis (2000) (0)
- Characterization of a lung cancer growth factor, LASEP1, as a serologic and prognostic biomarker and a therapeutic target. (2013) (0)
- PHASE I CLINICAL TRIAL OF VACCINATION OF MPHOSPH1 AND DEPDC1 EPITOPE PEPTIDE VACCINE FOR PATIENTS WITH BLADDER CANCER (2009) (0)
- Abstract 5156: The oncogenic polycomb histone methyltransferase EZH2 methylates lysine 120 on histone H2B and competes ubiquitination in human cancer (2014) (0)
- Abstract 2186: Quantitative cell surface proteome profiling of CD4+ T cells to identify potential therapeutic targets for adult T-cell leukemia (ATL). (2013) (0)
- Abstract A46: Next-generation sequencing of circulating tumor DNA for detecting minimal residual disease and predicting recurrence in colorectal cancer patients (2020) (0)
- A genome-wide association study of chemotherapy-induced alopecia in breast cancer patients (2013) (0)
- Validation Study on the Prediction of Response to Imatinib Mesylate in Chronic Myeloid Leukemia (CML) Patients by Genome-Wide cDNA Microarray Analysis. (2004) (0)
- Cancer genomics-based approach for development of new immunotherapeutics for lung cancers. (2014) (0)
- Abstract 3226: GALNT6 stabilizes GRP78 protein by O-type glycosylation (2014) (0)
- Abstract 4613: SMYD3-mediated lysine methylation is critical for the activation of AKT1 in human cancer (2016) (0)
- Correction: Identification of cytotoxic T cells and their T cell receptor sequences targeting COVID-19 using MHC class I-binding peptides (2022) (0)
- A Bronchodilator Response Genome-Wide Association Study In Six Asthma Drug Trial Cohorts (2011) (0)
- Genomics and proteomics-based discovery of novel cancer biomarkers and molecular targets for cell-permeable peptide/small molecule-based drugs. (2012) (0)
- Abstract 3005: Characterization of a lung cancer growth factor, LASEP1 as a serological and prognostic biomarker and a therapeutic target (2012) (0)
- Discrimination between Lung Cancer and Benign Lesions with Use of High B-Value Diffusion-Weighted Images. (2009) (0)
- Auto-antibody evaluation in idiopathic interstitial pneumonia and worse survival of patients with Ro52/TRIM21auto-antibody (2020) (0)
- 453 T cell receptor repertoire analysis in the melanoma patient with myasthenic crisis and polymyositis induced by nivolumab (2016) (0)
- Comprehensive proteomic studies on ovarian cancer and biomarker discovery for molecular tumor typing (2007) (0)
- Abstract 1267: Identification and characterization of oncogenic methyltransferase ESOC1 as a diagnostic and therapeutic target for esophageal cancer (2016) (0)
- A Chitinase-Like Protein, YKL-40, in Serum and Bronchoalveolar Lavage Fluid (BALF) of Patients with Idiopathic Pulmonary Fibrosis (IPF). (2009) (0)
- Abstract 2549: A genome-wide association study identifies PSCA as a susceptibility locus for gastric cancer and duodenal ulcer in the Japanese population. (2013) (0)
- Erratum: COGENT (COlorectal cancer GENeTics): An international consortium to study the role of polymorphic variation on the risk of colorectal cancer (British Journal of Cancer 102 (447-454) DOI: 10.1038/sj.bjc.6605338)) (2010) (0)
- Abstract 1657: Genome-wide association study of lung cancer: Variation in TP63 gene confers the risk of lung adenocarcinoma (2012) (0)
- Growth Inhibitory Function Of a Novel T-LAK Cell-Originated Protein Kinase Inhibitor On FLT3-ITD Positive Acute Myeloid Leukemia (AML) Cells (2013) (0)
- Genome-wide association meta-analysis identifies new endometriosis risk loci | NOVA. The University of Newcastle's Digital Repository (2012) (0)
- Characterization of the B-cell receptor repertoires in peanut allergic subjects undergoing oral immunotherapy (2017) (0)
- E124 Estimation of accuracy of measurement apparatus for thermal conductivity by using numerical simulation (2015) (0)
- Abstract P6-10-03: The contribution of common genetic variation to breast cancer risk among women receiving tamoxifen or raloxifene within the National Surgical Adjuvant Breast and Bowel Project (NSABP) P-1 and P-2 trials (2015) (0)
- Identification of LASEP3 as a new serological and prognostic biomarker for lung and various type of cancer. (2012) (0)
- Abstract 2500: Identification of promiscuous oncofetal antigen (IMP-3)-derived long peptides, bearing both Th cell and CTL epitopes (2015) (0)
- Characterization of the immunogenomic landscape of follicular lymphoma. (2018) (0)
- Minichromosome Maintenance Protein 7 Plays Essential Roles in Cancer Cell Growth and is a Potential Therapeutic Target in Human Cancer (2012) (0)
- Abstract 4569: Serum proteome analysis by label-free quantification system and LC-MALDI mass spectrometry for the discovery of novel biomarkers for lung cancer (2010) (0)
- Ordering of markers in the pericentromeric region of chromosome 10 (1995) (0)
- Genome-Wide Analysis of Gene Expression in Intestinal-Type Gastric Cancers Using a Complementary DNA Microarray Representing 23 , 040 Genes 1 (2002) (0)
- Abstract 3356: Diversity of CD8+ and rgulatory T cells is inversely correlated in follicular lymphoma: A potential predictive biomarker (2015) (0)
- Correlation between Exons and Dispersed Repetitive DNA Distribution on the Human Genome (1998) (0)
- Systematic approach for development of new immunotherapeutics for lung cancers through cancer genomics analysis. (2013) (0)
- Long‐Term Survival of Stage IIIA‐N2 NSCLC Patients with Interstitial Lung Diseases: P050 (2018) (0)
- Integrated analysis of somatic genetic alterations and immune microenvironment in malignant pleural mesothelioma. (2016) (0)
- P2.07-042 Feasibility Study of Nivolumab and Docetaxel in Previously Treated Patients with Advanced Non-Small Cell Lung Cancer (2017) (0)
- Effects of Dexamethasone and a High Dose of γ-Globulin on Allergic Granulomatous Angitis in the Experimental Model with Mice. (2009) (0)
- Abstract P2-09-33: Not presented (2018) (0)
- LocalizationoftheGenetic Defect inFamilial Adenomatous Polyposis within a SmallRegion ofChromosome 5 (1988) (0)
- Novel Associations of TNFRSF 13 B , TNFSF 13 , and ANXA 3 with Serum levels of Non-albumin Protein and Immunoglobulin Isotypes in the Japanese Population ” (2011) (0)
- CRYSTAL STRUCTURE OF HUMAN MPS1 CATALYTIC DOMAIN IN COMPLEX WITH N-cyclopropyl-4-(8-((thiophen-2-ylmethyl)amino)imidazo[1,2-a]pyrazin-3-yl)benzamide (2015) (0)
- Mutations of the gene related to chromosome 17q, susceptibility to cancer of breast and ovary. (1995) (0)
- Abstract 3581: Characterization of T cell repertoire in transplanted patients with graft versus host disease using next generation DNA sequencer (2014) (0)
- Cancer genomics-based screening of new therapeutic targets and biomarkers for esophageal cancer. (2018) (0)
- 2234 A COMMON GENETIC VARIANTS BASED RISK PREDICTION MODEL FOR PROSTATE CANCER IS HIGHLY REPRODUCIBLE IN JAPANESE, AND COMPENSATES FOR PROSTATE SPECIFIC ANTIGEN AT GRAY-ZONE (2013) (0)
- [Early diagnosis of metastatic spinal tumor is a key for effective palliative radiotherapy in patients with lung cancer]. (2011) (0)
- Abstract 5482: CYP2D6 genotype and response to neoadjuvant tamoxifen therapy: a prospective study in Japan (2015) (0)
- 3319 Outcomes of local treatment for malignant melanoma brain metastases: A single institution retrospective study (2015) (0)
- Analysis on low-frequency fluctuation of aerodynamic force acting on an automobile and flow using proper orthogonal decomposition (2020) (0)
- P5-13-21: Japanese Patients with Discordance in Estrogen Receptor between Primary Breast Cancer and Recurrent Tumor Have a Poorer Outcome. (2011) (0)
- Abstract 4819: Wolf-Hirschhorn syndrome candidate 1, a histone lysine methyltransferase, is involved in human carcinogenesis (2011) (0)
- Abstract 1875: Identification of LASEP3 as a serological and tissue biomarker and a therapeutic target for lung cancer (2016) (0)
- Identification of a NovelTumor-Associated Antigen , Cadherin 3 / P-Cadherin , as a PossibleTarget for Immunotherapy of Pancreatic , Gastric , and Colorectal Cancers (2008) (0)
- Pretreatment prognostic factors and early markers for outcome in advanced melanoma treated with nivolumab (2016) (0)
- Abstract 5153: Wolf-Hirschhorn syndrome candidate 1 as a potential novel therapeutic target for head and neck cancer (2014) (0)
- Integrated genomics-based discovery of new oncoproteins as a biomarker and a molecular target for lung cancer. (2010) (0)
- Abstract 101: WHSC1L1 as a therapeutic target in squamous cell carcinoma of the head and neck (2015) (0)
- Abstract 2359: Characterization of a lung cancer growth factor, LASEP3, as a serological and prognostic biomarker and a therapeutic target. (2013) (0)
- Advances in Brief Isolation and Characterization of a Novel Human Gene , DRCTNNB 1 A , the Expression of Which Is Down-Regulated by b-Catenin (2000) (0)
- Abstract 4803: Quantitative proteome profiling of CD4+CD25+CCR4+ T-cells to identify potential therapeutic targets for adult T-cell leukemia (ATL) and Human T-lymphotropic virus type-1 associated myelopathy (HAM) (2012) (0)
- Crystal structure of Human MPS1 catalytic domain in complex with 5-(5-ethoxy-6-(1-methyl-1H-pyrazol-4-yl)-1H-indazol-3-yl)-2-methylbenzenesulfonamide (2013) (0)
- Screening of neoantigen-specific T cells and establishment of T-cell receptor-engineered T cells: Implications for head and neck squamous carcinoma. (2018) (0)
- Abstract 544: Characterization of serine/threonine kinase LASK2 as a biomarker and therapeutic target for lung cancer (2018) (0)
- Discrimination of Drug Sensitivity of Cancer Using cDNA Microarray and Multivariate Statistical Analysis (1999) (0)
- Abstract 2158: Pharmacologic, pharmacodynamic action of MELK kinase inhibitor OTS167 in cancer cells (2016) (0)
- Monitoring of therapeutic efficacy to CDK4/6 inhibitors and early detection of metastatic relapse in breast cancer by ultra-deep sequencing of plasma cell-free DNA. (2020) (0)
- CRYSTAL STRUCTURE OF HUMAN MPS1 CATALYTIC DOMAIN IN COMPLEX WITH 4-(6-(cyclohexylamino)-8-(((tetrahydro-2H-pyran-4-yl)methyl)amino)imidazo[1,2-b]pyridazin-3-yl)-N-cyclopropylbenzamide (2015) (0)
- Abstract P3-06-26: Serum anti-p53 antibody titers predict pathological response to preoperative chemotherapy in women with HER2 positive or triple negative breast cancer. (2012) (0)
- GENOME-WIDE ASSOCIATION STUDY IDENTIFIES NEW SUSCEPTIBILITY LOCI FOR UROLITHIASIS (2009) (0)
- Title: A Polymorphism in MAPKAPK3 Affects Response to Interferon Therapy for Chronic Hepatitis C Short Title: MAPKAPK3 and IFN therapy for HCV infection (2009) (0)
- Biloma after Transcatheter Arterial Chemoembolization with Drug-Eluting Beads Managed with Sclerotherapy and Stent Placement (2018) (0)
- Abstract LB-50: Identification and functional analysis of p53MRA as a novel p53 target gene. (2013) (0)
- 2297 Clinical features of exceptional responders with unresectable and metastatic gastric cancers by palliative chemotherapy: A long follow-up (2015) (0)
- 255P Predictive value of ERCC1, ERCC2, ERCC4, and glutathione S-transferase P1 for FOLFIRINOX in unresectable pancreatic cancer (2016) (0)
- Abstract 3102: Analysis of plasma and serum as a source of circulating tumor DNA for hotspot mutations detection in liquid biopsy (2020) (0)
- [A Case of Severe Aortic Thrombosis during the First Chemotherapy Regimen of CapeOX plus Bevacizumab for Metastatic Colon Cancer]. (2020) (0)
- Advances in Brief Transformation and Morphological Changes of Murine L Cells by Transfection with a Mutated Form of b-Catenin 1 (1999) (0)
- 1P-044 Thermodynamic analysis of the hemi-methylated CpG DNA recognition by SRA domain of mouse NP95(The 46th Annual Meeting of the Biophysical Society of Japan) (2008) (0)
- O3-13-1Characterization of LASEP1 as a new serological and prognostic biomarker and a therapeutic target for lung cancer (2015) (0)
- EP1.18-19 Patients with Unresectable Stage III Non-Small Cell Lung Cancer Eligible to Receive Durvalumab in Clinical Practice (2019) (0)
- Mutations associated with the 17q ovarian and breast sensitivity gens (1995) (0)
- Abstract 5015: Regulation of histone modification and chromatin structure by p53-PADI4 pathway (2012) (0)
- Abstract P5-01-22: Genomic landscape of circulating tumor DNA in early-stage breast cancer (2020) (0)
- Abstract LB-300: Development of an orally-administrative MELK (maternal embryonic leucine zipper kinase)-targeting small molecule inhibitor that suppresses the growth of various types of human cancer. (2013) (0)
- Abstract 4041: SUV39H2 inhibition enhances sensitivity of breast cancer cells to doxorubicin through downregulation of γ-H2AX production (2017) (0)
- Genetic Linkage Study of Juvenile Polyposis: Preliminary Analysis (1990) (0)
- Abstract P6-07-10: Cytogenetic analysis of squamous cell carcinoma of the breast reveals inter- and intra-tumoral heterogeneity (2016) (0)
- Understanding of Molecular Aspects of Lung Carcinogenesis and New Therapeutic Target Discovery Based on Comprehensive Gene and Protein-expression Profiles (2009) (0)
- 607 A FUNCTIONAL VARIANT IN NKX3.1 ASSOCIATED WITH PROSTATE CANCER SUSCEPTIBILITY DOWN-REGULATES NKX3.1 EXPRESSION (2011) (0)
- Positional Cloning of Genes Responsible for Diseases through Analysis of Patients with Chromosomal Translocation. (1996) (0)
- Abstract 1652: MRGBP (C20orf20) contributes to development of colorectal cancer (2011) (0)
- Characterization of four VNTR loci on human Chromosome 6 (2004) (0)
- Abstract 4887: TCR profiling of T lymphocytes in ovarian tumors and malignant ascites using next-generation sequencing (2015) (0)
- Abstract 625: Eradication of cancer cells by T-cell receptor-engineered T cells targeting neoantigens/oncoantigens (2017) (0)
- Abstract 2551: A genome-wide association study of HCV induced liver cirrhosis in the Japanese population identifies novel susceptibility loci at MHC region. (2013) (0)
- Abstract 217: Functional analysis of the protein citrullination through p53/PADI4 network in carcinogenesis (2011) (0)
- Genetic Alterations in Colorectal Tumorgenesis (1991) (0)
- Analysis of the EGFR mutations in non-small cell lung cancer patients after EGFR-TKI treatment. (2010) (0)
- Abstract 5159: The histone methyltransferase SUV39H2 is a novel target of anticancer therapy (2014) (0)
- From Cancer Genomics to Cancer Treatment (2007) (0)
- Abstract 1562: Proteomic analysis of citrullinated targets regulated by the p53-PADI4 pathway (2014) (0)
- 7TH ANNUAL SCIENTIFIC MEETING (2014) (0)
- Novel biomarkers for immunotherapy: from the results of phase I and II study of five therapeutic peptides for advanced colorectal cancer. (2016) (0)
- 77 PHASE I CLINICAL TRIAL OF NOVEL HIG2 DERIVED EPITOPE PEPTIDE VACCINE TREATMENT FOR KIDNEY CANCER (2010) (0)
- Abstract 115: SMYD2-mediated methylation regulates PTEN activity (2015) (0)
- Novel cancer vaccines in combination with oxaliplatin-based chemotherapy as first-line therapy in advanced colorectal cancer: A randomized phase II study. (2013) (0)
- Switching control device for automatic transmission (2011) (0)
- Abstract 3095: JMJDX interacts with DEAH (Asp-Glu-Ala-His) box polypeptide 9 (DHX9) (2010) (0)
- Abstract 3587: TCR-transduced T cells targeting a truncal mutation caused by a nsSNV destroy large solid tumors despite intratumoral genetic heterogeneity (2018) (0)
- 448PThe possibility of personalized chemotherapy for non-small cell lung cancer using interactome analyses of PDX/NOG models (2017) (0)
- Instructions for use Title Demographic and lifestyle factors and survival among patients with esophageal and gastric cancer : The Biobank (2019) (0)
- Abstract P5-14-18: Indication of post-mastectomy radiation associated with risk of local recurrence in breast cancer patients with 1-3 lymph node metastasis (2013) (0)
- Abstract P4-12-02: Adjuvant trastuzumab improved the prognosis of HER2-positive early breast cancer: Single institutional cohort study from clinical practice (2016) (0)
- The potential target of double negative T cells in cancer immunotherapy. (2020) (0)
- Abstract OT3-01-01: A phase II study of PD-L1 and CTLA-4 inhibition and immunopharmcogenomics in metastatic breast cancer (2017) (0)
- Frequent LOH of CYP2D6 in ER+ breast cancer determined by next-generation sequencing (NGS). (2013) (0)
- Two dinucleotide repeat polymorphisms at the D8S1442 and D8S1443 loci (1995) (0)
- ANLN (anillin, actin binding protein) (2011) (0)
- The 79 th Annual Meeting of the Japanese Cancer Association Day 3 October 3 ( Saturday ) (2020) (0)
- Abstract 1338: The application of circulating tumor DNA analysis for detecting minimal residual disease and predicting recurrence in colorectal cancer patients (2019) (0)
- Abstract 3604: Significant effect of polymorphisms in CYP2D6 and DT-1 on clinical outcomes of adjuvant tamoxifen therapy for breast cancer patients (2010) (0)
- A case of spindle cell dominant histiocytic sarcoma showing a complete remission after first-line chemotherapy with doxorubicin and ifosfamide (2020) (0)
- Phase I Clinical Trial of Cancer Vaccine Combined with Chemotherapy Targeting both Tumor Antigen and Immune Tolerance Against Advanced Solid Tumors (2012) (0)
- 569 OVEREXPRESSION OF HYPOXIA-INDUCIBLE PROTEIN2, HYPOXIA-INDUCIBLE FACTOR-1 AND NF-KB IN ACQUIRED RENAL CYSTIC DISEASE OF THE KIDNEY ASSOCIATED WITH RENAL CELL CARCINOMA (2007) (0)
- EGF-dependent enhancement of invasive ability in squamous cell carcinoma of the breast. (2009) (0)
- Development of prediction system of chemosensitivity to anti-cancer drugs towards personalized-medicine (2005) (0)
- Molecular and Cellular Pathobiology Histone Lysine Methyltransferase SETD 8 Promotes Carcinogenesis by Deregulating PCNA Expression (2012) (0)
- Abstract B27: Morphological changes, cadherin switching, and growth suppression in pancreatic cancer by GALNT6 knockdown (2017) (0)
- Abstract 377: SMYD2-dependent PARP1 methylation promotes Poly(ADP-ribosyl)ation activity in cancer cells (2014) (0)
- Treatment with the Novel TOPK Inhibitor OTS514 Exhibits Potent Anti-Myeloma Activity in Pre-Clinical Models (2017) (0)
- Allelotype of Renal Cell Carcinoma1 (2006) (0)
- Abstract A29: Next-generation sequencing of circulating tumor DNA to monitor treatment response to CDK4/6 inhibitors in breast cancer (2020) (0)
- MP49-13 SELECTIVE NEOADJUVANT CHEMOTHERAPY BY PREDICTION SYSTEMS IMPROVES THE CHEMO-SENSITIVITY OF THE MUSCLE INVASIVE BLADDER CANCERS (2016) (0)
- O2–032CHARACTERIZATION OF A LUNG CANCER GROWTH FACTOR, LASEP3 AS A SEROLOGICAL AND PROGNOSTIC BIOMARKER AND THERAPEUTIC TARGET (2012) (0)
- Abstract 1102: Regulation of protein citrullination through p53/PADI4 network in DNA damage response (2010) (0)
- Effective screening of neoantigen-specific cytotoxic t cells. (2018) (0)
- 96 Development of multiple endocrine neoplasia type 2A does not involve substantial deletions of chromosome 10 (1989) (0)
- Abstract 3753: Genome wide association study of HCV-induced hepatocellular carcinoma (2011) (0)
- Abstract 1228: Identification of a novel p53 target regulating p53-induced apoptotic pathway (2015) (0)
- Identification of CAG repeat-containing genes expressed in human brain as candidate genes for autosomal dominant spinocerebellar ataxias and other neurodegenerative diseases (2002) (0)
- The application of dynamic monitoring of circulating tumor DNA for detecting minimal residual disease and predicting recurrence in colorectal cancer patients. (2020) (0)
- Genetic Detection of Circulating Cancer Cells and Micrometastasis in the Lymph Node. (1997) (0)
- anti-CDH3 antibodies tagged radioisotope and uses thereof (2009) (0)
- Epithelia Laser-Capture Microdissection of Tumor Tissues and Normal Carcinogenesis Revealed by cDNA Microarrays after Alterations of Gene Expression during Colorectal Updated (2001) (0)
- Screening of p53 regulated genes by cDNA microarray and analysis of its expression in cancer tissue (2006) (0)
- 1046P First-line anti-PD-1 antibody monotherapy versus anti-PD-1 plus anti-CTLA-4 combination therapy in Japanese mucosal melanoma: A retrospective, multicenter study (JMAC study) (2021) (0)
- INVESTIGATION OF THE IMPORTANCE OF OATP 1 B 3 AND MRP 2 IN DOCETAXEL-INDUCED HEMATOPOIETIC TOXICITY (2009) (0)
- Abstract 3480: Germline PARP4 mutations in patients with primary thyroid and breast cancers (2016) (0)
- Characterization of the cryosurgery-induced immune response in kidney cancer patients. (2016) (0)
- Immunogenomics-based development of personalized immunotherapy for lung cancers. (2015) (0)
- Abstract 379: TARBP1, a member of the SPOUT methyltransferase family, is involved in human carcinogenesis (2014) (0)
- [A case with an ovarian cancer patient who could receive anti-cancer therapy and palliative care simultaneously at home through seamless collaboration in healthcare linkage]. (2010) (0)
- Abstract 2834: Cancer testis antigens-specific CD4+ T-cell immunity augmented by CTL-epitopes vaccination in cancer patients. (2013) (0)
- Abstract 4381: High efficacy of T-LAK cell-originated protein kinase inhibitor in acute myeloid leukemia with FLT3-ITD mutation (2015) (0)
- Functional analysis of a novel lipogenic factor, FARM (fatty acid-related molecule), over-expressed in prostate cancer cells (2008) (0)
- Mucosal CTL Epitope-Loaded Dendritic Cell Vaccine Confers Protection Against Intracellular Pathogens. (2009) (0)
- Comparison of gene-expression profiles between liver fluke- and non-liver fluke-associated intrahepatic cholangiocarcinomas using a genome-wide cDNA microarray (2005) (0)
- Laser Capture Microdissection and Microarray Expression Analysis of Lung Adenocarcinoma Reveals Tobacco Smoking-and Prognosis-related Molecular Profiles 1 (2002) (0)
- Phase I trial of cancer vaccine with multiple peptides derived from novel onco-antigen and anti-angiogenic antigens for patients with advanced non-small cell lung cancer (NSCLC). (2012) (0)
- Expression of long noncoding RNA and clinical outcomes of pancreatic cancer patients who received adjuvant chemotherapy by S-1 or GEM after curative resection (2019) (0)
- Abstract 4783: Identification of a novel TAA, SPARC, as a target for immunotherapy of various cancers (2010) (0)
- Proteomic profiling of HTLV-1 infected T-cells for the identification of potential biomarkers and therapeutic targets for HTLV-1 associated myelopathy/ tropical spastic paraparesis and adult T-cell leukemia (2011) (0)
- Liquid biopsy for detection of actionable mutation in various cancer patients (2019) (0)
- Mutations linked to chromosome 17q, susceptibility breast cancer and ovarian gene. (1995) (0)
- Crystal structure of unliganded SRA domain of mouse Np95 (2008) (0)
- 1439 A PROSPECTIVE STUDY TO EXAMINE THE AVAILABILITY OF THE PREDICTION SYSTEM OF NEOADJUVANT CHEMOTHERAPY FOR MUSCLE INVASIVE BLADDER CANCER (2013) (0)
- Reproducibility, performance, and clinical utility of a genetic risk prediction model for prostate cancer in Japanese patients. (2012) (0)
- CRYSTAL STRUCTURE OF HUMAN MPS1 CATALYTIC DOMAIN IN COMPLEX WITH 6-((3-(cyanomethoxy)-4-(1-methyl-1H-pyrazol-4-yl)phenyl)amino)-2-(cyclohexylamino)nicotinonitrile (2015) (0)
- Meta-Analysis of GWA Studies Identifies New Endometriosis Risk Loci (2013) (0)
- Human Genome Analysis and Medicine in the 21 st Century (1999) (0)
- Correction: Preclinical evaluation of biomarkers associated with antitumor activity of MELK inhibitor (2020) (0)
- Crystal structure of the SRA domain of mouse Np95 in complex with hemi-methylated CpG DNA (2008) (0)
- 1099: Development of the Prediction System for Chemosensitivity of Methotrexate, Vinblastine, Doxorubicin, and Cisplatin Neoadjuvant Chemotherapy in Invasive Bladder Cancer Patients (2007) (0)
- 9117 A phase I study of amrubicin and carboplatin for previously untreated patients with extensive-disease small-cell lung cancer (2009) (0)
- THE METHYLENETETRAHYDROFOLATE REDUCTASE GENE (MTHFR) AND RISK FOR SCHIZOPHRENIA. ARE FUNCTIONAL MTHFR GENE POLYMORPHISMS ASSOCIATED WITH AGE OF ONSET? (2010) (0)
- Corrigendum to "The role of protein methyltransferases as potential novel therapeutic targets in squamous cell carcinoma of the head and neck" [Oral Oncol. 81 (2018) 100-108]. (2018) (0)
- Contents Vol. 55, 2012 (2012) (0)
- Prenatal diagnosis in 2 Fukuyama type congenital muscular dystrophy families by genetic linkage analysis (1994) (0)
- Isolation and characterization of factors interacting with breast cancer susceptibility gene BRCA2 (1998) (0)
- A Refinement System for Large Amount of cDNA Data (1996) (0)
- Expression of NovelMolecules , MICAL 2-PV ( MICAL 2 Prostate Cancer Variants ) , Increaseswith High Gleason Score and Prostate Cancer Progression (2006) (0)
- Subregion 17 p 13 Assignment of Common Allele Loss in Osteosarcoma to the Updated Version (2006) (0)
- IMS-KN08 plays a critical role in human lung carcinogenesis by interacting with and activating RHOA (2005) (0)
- [S-1/CDDP combined neoadjuvant chemotherapy and surgical resection for advanced gastric cancer. Analysis of 12 patients with lymph node metastasis in Saitama Red Cross Hospital]. (2009) (0)
- Abstract 391: Serine/threonine kinase LASK2 as a biomarker and therapeutic target for lung cancer (2019) (0)
- Assessment of mutation burden after clinical intervention in pancreatic ductal adenocarcinomas (PDAC), and biliary tract cancers (BTC) via profiling circulating tumor DNA (ctDNA). (2020) (0)
- Abstract 2979: Wolf-Hirschhorn syndrome candidate 1 plays an important role in the pathogenesis of head and neck cancer. (2013) (0)
- Abstract LB-235: Functional SNP in MICA binding to SP1 is associated with HCV-induced hepatocellular carcinoma. (2013) (0)
- 434 Four loci at 11q12, 10q26, 3p11.2, and 2p11 are associated with prostate cancer susceptibility in the Japanese population (2012) (0)
- Abstract 963: Screening of neoantigen-specific T cells in head and neck cancer and establishment of T-cell receptor-engineered T cells with cytotoxic reactivity (2018) (0)
- Integrated genomics-based discovery of new druggable kinases as a therapeutic target and cancer biomarker for lung cancer. (2017) (0)
- University of Groningen Integration of mouse and human genome-wide association data identifies KCNIP 4 as an asthma gene (2017) (0)
- Xenografts to Anticancer Drugs Expression Profiles with Sensitivity of 85 Human Cancer Genome-wide cDNA Microarray Screening to Correlate Gene Updated (2002) (0)
- NEWLY DEVELOPED MULTIPLEX SNPS TYPING SYSTEM BASED ON INVADER ASSAY (2009) (0)
- Characterization of Tcra and Tcrb Repertoires in Acute Myeloid Leukemia Patients before and after Combined Haploidentical and Umbilical Cord Blood Transplant (2014) (0)
- Abstract 1091: Comparison of TCR repertoires between cancer tissues and lymph nodes in colorectal cancer patients (2019) (0)
- Characterization of the T-cell receptor repertoire and immune microenvironment in patients with locoregionally advanced squamous cell carcinoma of the head and neck. (2017) (0)
- Human genome analysis and medicine in the 21st century (abstract only) (2000) (0)
- Corrigendum to "Genetic polymorphisms in the IL22 gene are associated with psoriasis vulgaris in a Japanese population" [J. Dermatol. Sci. 71 (2013) 148-150] (2014) (0)
- Abstract 294: BCL-2 family compensation regulates T cell homeostasis and reveals a BIM:BCL-W axis in T-ALL (2018) (0)
- W1395 Serum Tumor Antigen Reg4 As a Diagnostic Biomarker in Pancreatic Ductal Adenocarcinoma (2008) (0)
- P3.01-37 Phase II Study of Amrubicin Plus Erlotinib in Previously Treated, Advanced Non-Small Cell Lung Cancer Patients with Wild-Type EGFR: TORG 1320 (2018) (0)
- Mutations in the 17q-linked breast and ovariecancerprædisponeringen (1995) (0)
- Inhibition of FLT3-ITD and Melk By Small Molecule Inhibitor OTS167 in FLT3 mutant Acute Myeloid Leukemia (AML) (2017) (0)
- Abstract P1-13-15: Risk of late recurrence of hormone receptor positive breast cancer in cases with no recurrent disease at five years after surgery (2013) (0)
- TGTAAAACGACGGCCAGTCCTCCTTCCTCTTCCCTGAG CAGGAAACAGCTATGACCGAGAGGGCTGTTCCTGGAG TGTAAAACGACGGCCAGTCTCAAAACTCTTCATCTAGACC CAGGAAACAGCTATGACCGTTTCAGTGGAAAACACACTC TGTAAAACGACGGCCAGTTGGGGAGAAAGTAAGCAGTG CAGGAAACAGCTATGACCTTATCTGAACATAGGAACATCTG TGTAAAACGACGGCCAGTCTCCAGAACCATCAGTACAGC CAGGAAACAGCTATGACCTAC (0)
- Abstract 3920: Identification of LASEP1 as a new serological and prognostic biomarker and a therapeutic target for lung cancer (2015) (0)
- Abstract CN2-2: Development of therapeutic cancer vaccine and construction of clinical research network in Japan (2010) (0)
- p53-regulated GML gene expression in non-small cell lung cancer: Relation to cisplatin chemosensitivity (2000) (0)
- Abstract 1251: Significant growth suppressive effects of TOPK and MELK inhibitors in kidney cancer (2016) (0)
- Interstitial lung diseases associated with amyopathic dermatomyositis. Commentary (2006) (0)
- Mutations in the gene for susceptibility to breast and ovarian cancer linked to 17q (1995) (0)
- ISAC-1-8 Identification of Asian-specific target genes in paclitaxel-induced sensory peripheral neuropathy using an integrative GWAS approach and human iPSC-derived neurons(Group 1 Oncology,IS Award Candidate,International Session) (2015) (0)
- 322 RISK ESTIMATION MODEL WITH MULTIPLE COMMON GENETIC VARIANTS FOR JAPANESE PROSTATE CANCER (2012) (0)
- In vivo mutations and polymorphisms in the 17.alpha.-coupled breast and ovarian cancer susceptibility genes (1997) (0)
- Detection of known missense mutation ofhMLH1 in a hereditary non-polyposis colorectal cancer family using DNA extracts from mouthwash samples (1998) (0)
- 280. RANTES and TARC Enhanced the Antitumor Immune Effects of GM-CSF (2006) (0)
- Abstract 2370: Epstein-Barr Virus-induced gene 3 as a novel serum and tissue biomarker and a therapeutic target for lung cancer. (2013) (0)
- Advances in Brief Correlation between the Location of GermLine Mutations in the APC Gene and the Number of Colorectal Polyps in Familial Adenomatous Polyposis Patients 1 (2006) (0)
- Erratum: The effects of telmisartan treatment on the abdominal fat depot in patients with metabolic syndrome and essential hypertension: Abdominal fat Depot Intervention Program of Okayama (ADIPO) (Diabetes and Vascular Disease Research (2013) 10:1 (93-96)(DOI: 10.1177/1479164112444640)) (2013) (0)
- Advances in Brief Frequent Somatic Mutations of the APC Gene in Human Pancreatic Cancer 1 (2007) (0)
- Chapter 7 Mutational Analysis of Familial Long QT Syndrome in Japan (1999) (0)
- Abstract 2051: Regulation of RNA processing by PADI4 pathway (2015) (0)
- Allelotype of Human Ovarian Cancer 1 (2006) (0)
- Abstract 1608: Novel lipogenic enzyme ELOVL7 is involved in prostate cancer growth through saturated long-chain fatty acid metabolism (2010) (0)
- Phenotyping asthma : a clue for treatments ? (2011) (0)
- Abstract 5094: OSBPL10 is Identified as a Novel Susceptible Gene for Peripheral Arterial Disease by Genome-Wide Association Study in Japan (2008) (0)
- Mutations associated with the 17q ovarian and breast cancer susceptibility gene (1995) (0)
- Abstract C114: Androstenedione levels in postmenopausal women with resected early-stage breast cancer are associated with SNPs in CYP11B1 and CYP11B2 identified by a genome-wide association study (GWAS). (2011) (0)
- Adjuvant cancer peptide vaccine for pathological node-positive esophageal SCC patients who underwent preoperative therapy followed by R0 resection. (2016) (0)
- Correlation of CD8 lymphocytes in tumors and nonsynonymous mutational load with prognosis of bladder cancer patients treated with immune checkpoint inhibitors. (2018) (0)
- Abstract 4453: Identification and characterization of oncogenic kinase LASK2 as a diagnostic and therapeutic target for lung cancer (2017) (0)
- Two polymorphic gene loci associated with treprostinil dose in pulmonary arterial hypertension (2019) (0)
- Identification of genes associated with the development of IgA nephropathy: genome-wide screening by SNP markers (2004) (0)
- Abstract 4727: Breast cancer prevention and selective estrogen response modulators (SERMs): Pharmacogenomics and differential estrogen and SERM regulation of BRCA1 and BRCA2 expression (2011) (0)
- 546 Immune biomarkers to predict response of nivolumab, intratumoral gene expression and T cell receptor repertoire analysis (2017) (0)
- P2.12-07 Phase I Study of Amrubicin and Cisplatin with Concurrent Thoracic Radiotherapy (TRT) in Limited-Disease Small Cell Lung Cancer (LD-SCLC) (2019) (0)
- Abstract 342: WHSC1L1-mediated EGFR mono-methylation enhances the cytoplasmic and nuclear oncogenic activity of EGFR in head and neck cancer (2017) (0)
- Abstract P5-08-47: Clinical outcome of pathological T1N0 breast cancer according to the hormone receptor and HER2 status and adjuvant therapy (2016) (0)
- Verification of Outdoor Environmental Factors-Induced Asthma Exacerbations by Monitor of Weather and Air Particle. (2009) (0)
- Abstract 2148: Screening of cancer-reactive T cells in lymph nodes in colorectal cancer patients (2020) (0)
- Comprehensive cancer genomics-based screening of new therapeutic targets and biomarkers for lung cancer. (2021) (0)
- Large-scale genome-wide association study in a Japanese population identifies novel susceptibility loci across different diseases (2020) (0)
- 24P Establishment of patient-derived xenografts from malignant pleural effusion using NOG mice (2016) (0)
- OJ-212 Identification of a Novel non-coding RNA, MIAT, that Confers Risk of Myocardial Infarction(Genetics/Genetically engineered models/Gene therapy-2(H/M), The 71st Annual Scientific Meeting of the Japanese Circulation Society) (2007) (0)
- FRS-004 Large Scale SNPs Association Study to Identify Genes Confer Risk of Myocardial Infarction(FRS1,New Molecules for Cardiovascular Regulation (M),Featured Research Session (English),The 73rd Annual Scientific Meeting of The Japanese Circulation Society) (2009) (0)
- 103 A GENOME-WIDE STUDY IDENTIFIES SUSCEPTIBILITY LOCI FOR HEPATITIS C VIRUS-INDUCED HEPATOCELLULAR CARCINOMA (2011) (0)
- Pathway analysis of genome-wide data improves warfarin dose prediction (2013) (0)
- OE-009 Identification of a Locus on Chromosome 5p that Confers Risk of Coronary Artery Disease by Genome Wide Association Study(OE02,ACS/AMI (Basic) (IHD),Oral Presentation (English),The 73rd Annual Scientific Meeting of The Japanese Circulation Society) (2009) (0)
- PJ-152 A functional SNP in the Proteasome Subunit Alpha Type 6 Gene confers Risk of Myocardial Infarction in Japanese Population(Acute myocardial infarction, basic-2, The 71st Annual Scientific Meeting of the Japanese Circulation Society) (2007) (0)
- MMK4 is a promising therapeutic target for breast cancer (2006) (0)
- 2193: Targeting MELK in acute lymphoblastic leukemia, new therapeutic approach (2017) (0)
- VASODILATORY EFFECT OF GLUCOSE-INSULIN-POTASSIUM SOLUTION IN PATIENTS WITH ACUTE MYOCARDIAL INFARCTION : Ischemic Heart Disease (III) : III : 48 Annual Scientific Meeting, Japanese Circulation Society (1984) (0)
- -0213-APPROXIMATION OF CANINE LEFT VENTRICULAR END-SYSTOLIC RELATION BY A CYLINDER MODEL (1990) (0)
- SNP projects in Japan (2002) (0)
- Genome-wide association study to identify genes related to myocardial infarction (2002) (0)
- Randomized phase II trial of S-1 plus cisplatin or docetaxel plus cisplatin with concurrent thoracic radiotherapy for inoperable stage III non-small cell lung cancer (TORG1018): An interim report (2016) (0)
- Abstract 5415: Therapeutic effects of TOPK inhibitor on triple-negative breast cancer (2015) (0)
- 1204 Vibration energy evaluation using structural intensity and modal property (2013) (0)
- Data processing using b-spline and controller design for data conversion method (2013) (0)
- 824 Evaluation of Maneuverability of Power Assist System Using Bio logical Information (2011) (0)
- Identification method of vortex structures around vehicle (2019) (0)
- Engine noise measurement with acoustic shield wall (1984) (0)
- Identification of the vortex around a vehicle by considering the pressure minimum (2020) (0)
- Identification of wake vortices using a simplified automobile model under parallel running and crosswind conditions (2023) (0)
- Apparatus and method for automatically producing a emulsionsmedikament (2009) (0)
- Development of radiation detector using PZT ceramics (2004) (0)
- A healthier Japan. Interview by David Cyranoski. (2011) (0)
- Aerodynamic drag reduction by controlling flow structure of simplified vehicle model using plasma actuator (2018) (0)
- Title Response from piezoelectric elements appearing immediatelyafter collisions with silver particles (2018) (0)
- Design of multi-rate filter using control theory technique (2008) (0)
- Self-information management system by dynamic negotiation for medical and welfare fields (2008) (0)
- Identification of wake vortices in a simplified car model during significant aerodynamic drag increase under crosswind conditions (2022) (0)
- Mutations of the 17q associated ovarian and breast cancer susceptibility gene (1995) (0)
This paper list is powered by the following services:
Other Resources About Yusuke Nakamura
What Schools Are Affiliated With Yusuke Nakamura ?
Yusuke Nakamura is affiliated with the following schools:
