Gail Dinter-Gottlieb | Academic Influence

Gail Dinter-Gottlieb's AcademicInfluence.com Rankings

Gail Dinter-Gottlieb

Education

#322

World Rank

#485

Historical Rank

education Degrees

Gail Dinter-Gottlieb

Psychology

#4100

World Rank

#4581

Historical Rank

psychology Degrees

Download Badge

Education
Psychology

Gail Dinter-Gottlieb's Degrees

PhD Education University of British Columbia
Masters Education University of British Columbia
Bachelors Psychology University of British Columbia

Similar Degrees You Can Earn

Why Is Gail Dinter-Gottlieb Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Gail Dinter-Gottlieb is an American university administrator who served as the 14th president and vice-chancellor of Acadia University until February 2008. A native of Port Chester, New York, Dinter-Gottlieb was educated at the College of Mount Saint Vincent, Northeastern University, Weizmann Institute of Science, and the Harvard Graduate School of Education.

(See a Problem?)

Gail Dinter-Gottlieb's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

Antigenomic RNA of human hepatitis delta virus can undergo self-cleavage (1988) (340)
Characterization of self-cleaving RNA sequences on the genome and antigenome of human hepatitis delta virus (1988) (275)
Fluorescence emission of ethidium bromide intercalated in defined DNA duplexes: evaluation of hydrodynamics components. (1996) (48)
An Okazaki piece of simian virus 40 may be synthesized by ligation of shorter precursor chains (1988) (46)
Viroids and virusoids are related to group I introns. (1986) (41)
Antigenomic Hepatitis delta virus ribozymes self-cleave in 18 M formamide. (1991) (33)
The unique hepatitis delta virus. (1995) (32)
Expression of the β-glucuronidase gene under the control of the CaMV 35S promoter in Schizosaccharomyces pombe (2004) (30)
Non-ribozyme sequences enhance self-cleavage of ribozymes derived from Hepatitis delta virus. (1991) (23)
Secondary structure content of the HDV ribozyme in 95% formamide. (1996) (21)
A sequence element necessary for self-cleavage of the antigenomic hepatitis delta RNA in 20 M formamide. (1992) (17)
Evidence that alternate foldings of the hepatitis delta RNA confer varying rates of self-cleavage. (1994) (16)
Uncoupling of SV40 tsA replicon activation from DNA chain elongation by temperature shifts and aphidicolin arrest. (1982) (13)
Aphidicolin arrest irreversibly impairs replicating simian virus 40 chromosomes. (1983) (13)
Single substitutions of phosphorothioates in the HDV ribozyme G73 define regions necessary for optimal self-cleaving activity. (1997) (10)
Evidence that total substitution of adenine with 7-deazaadenine in the HDV antigenomic ribozyme changes the kinetics of RNA folding (1994) (6)
Deriving a 67-nucleotide trans-cleaving ribozyme from the hepatitis delta virus antigenomic RNA. (1992) (5)
Characterizing the self-cleavage of a 135 nucleotide ribozyme from genomic hepatitis delta virus. (1991) (5)
Internally Deleted Antigenomic Hepatitis Delta RNA Self‐Cleaves Even in 18 M Formamide (1992) (1)
Efficient splicing of the Tetrahymena group I intron in transformed tobacco plants : further evidence for DNA to DNA information flow in transformation by Agrobacterium tumefaciens (1991) (1)
Self-cleavage of internally deleted hepatitis delta RNAs. (1993) (0)
QAGCYGUAUQ Q GAAACU YACGUACQGUUY AGUCUCAGGGOAAACUUUGAGA GAUCCCCGGGGAAACCUGGAGC CUC GGGGGGAAACCCCCUUG AAAAGGACGAAACGGAUG GAAAAG GAAAAG UGGCAAUAAG UGGUAAUAAG UAUCUUUCUUUG UAUUUACCUUUG (0)
Possible Viroid Origin (1987) (0)
AnOkazaki Piece ofSimian Virus40May Be Synthesized by Ligation ofShorter Precursor Chains (1988) (0)
Uncoupling ofSV40tsArepicon activation fromDNAchain elongation bytemperature shifts and aphidicolin arrest (1981) (0)

This paper list is powered by the following services:

Other Resources About Gail Dinter-Gottlieb

en.wikipedia.org

What Schools Are Affiliated With Gail Dinter-Gottlieb?

Gail Dinter-Gottlieb is affiliated with the following schools: