Carlo M. Croce | Academic Influence

Carlo M. Croce's AcademicInfluence.com Rankings

Carlo M. Croce

Medical

#113

World Rank

#184

Historical Rank

#59

USA Rank

Oncology

#2

World Rank

#2

Historical Rank

#1

USA Rank

medical Degrees

Download Badge

Medical

Carlo M. Croce's Degrees

Doctorate Medicine University of Milan
PhD Biochemistry University of Milan

Why Is Carlo M. Croce Influential?

(Suggest an Edit or Addition)

According to Wikipedia, Carlo Maria Croce is an Italian–American professor of medicine at Ohio State University, specializing in oncology and the molecular mechanisms underlying cancer. Croce and his research have attracted public attention because of multiple allegations of scientific misconduct.

(See a Problem?)

Carlo M. Croce's Published Works

Number of citations in a given year to any of this author's works

Total number of citations to an author for the works they published in a given year. This highlights publication of the most important work(s) by the author

Published Works

MicroRNA signatures in human cancers (2006) (7459)
A microRNA expression signature of human solid tumors defines cancer gene targets (2006) (5850)
Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia (2002) (5130)
Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. (2004) (4236)
MicroRNA gene expression deregulation in human breast cancer. (2005) (4126)
miR-15 and miR-16 induce apoptosis by targeting BCL2. (2005) (3655)
MicroRNAs in Cancer. (2009) (3595)
Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. (2006) (3121)
Causes and consequences of microRNA dysregulation in cancer (2009) (2934)
A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. (2005) (2499)
Involvement of the bcl-2 gene in human follicular lymphoma. (1985) (1884)
MicroRNA-133 controls cardiac hypertrophy (2007) (1801)
Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. (1984) (1793)
MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review (2012) (1621)
MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. (2008) (1618)
Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. (1982) (1608)
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B (2007) (1603)
The role of MicroRNAs in human cancer (2016) (1463)
Targeting microRNAs in cancer: rationale, strategies and challenges (2010) (1423)
miRNAs, Cancer, and Stem Cell Division (2005) (1362)
MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. (2004) (1350)
Modulation of miR-155 and miR-125b Levels following Lipopolysaccharide/TNF-α Stimulation and Their Possible Roles in Regulating the Response to Endotoxin Shock1 (2007) (1346)
MicroRNA signatures in human ovarian cancer. (2007) (1314)
MicroRNAs bind to Toll-like receptors to induce prometastatic inflammatory response (2012) (1273)
The role of microRNA genes in papillary thyroid carcinoma. (2005) (1244)
MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. (2007) (1163)
Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. (1986) (1154)
Extensive modulation of a set of microRNAs in primary glioblastoma. (2005) (1146)
Structure-based discovery of an organic compound that binds Bcl-2 protein and induces apoptosis of tumor cells. (2000) (1129)
A microRNA DNA methylation signature for human cancer metastasis (2008) (1093)
The FHIT Gene, Spanning the Chromosome 3p14.2 Fragile Site and Renal Carcinoma–Associated t(3;8) Breakpoint, Is Abnormal in Digestive Tract Cancers (1996) (1051)
MicroRNA-cancer connection: the beginning of a new tale. (2006) (1050)
A MicroRNA Signature of Hypoxia (2006) (1032)
The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. (1985) (1028)
Induced pluripotent stem cells and embryonic stem cells are distinguished by gene expression signatures. (2009) (1003)
MicroRNAs in cancer: small molecules with a huge impact. (2009) (973)
An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. (2004) (957)
Molecular cloning of a new transforming gene from a chemically transformed human cell line (1984) (924)
Interferon modulation of cellular microRNAs as an antiviral mechanism (2007) (898)
Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice. (2006) (883)
E2F1-regulated microRNAs impair TGFbeta-dependent cell-cycle arrest and apoptosis in gastric cancer. (2008) (883)
The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene (1992) (877)
Relation between microRNA expression and progression and prognosis of gastric cancer: a microRNA expression analysis. (2010) (825)
Cyclin G1 is a target of miR-122a, a microRNA frequently down-regulated in human hepatocellular carcinoma. (2007) (818)
miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. (2009) (793)
MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. (2005) (787)
MicroRNA expression and function in cancer. (2006) (778)
MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors are associated with distinctive pathologic features and clinical behavior. (2006) (777)
Inactivation of Bcl-2 by phosphorylation. (1995) (775)
ALL-1 is a histone methyltransferase that assembles a supercomplex of proteins involved in transcriptional regulation. (2002) (773)
MiR-15a and miR-16-1 cluster functions in human leukemia (2008) (763)
MicroRNA-29b induces global DNA hypomethylation and tumor suppressor gene reexpression in acute myeloid leukemia by targeting directly DNMT3A and 3B and indirectly DNMT1. (2009) (751)
Ultraconserved regions encoding ncRNAs are altered in human leukemias and carcinomas. (2007) (734)
miR-221 overexpression contributes to liver tumorigenesis (2009) (730)
Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. (2008) (730)
Identification of metastasis‐related microRNAs in hepatocellular carcinoma (2008) (726)
Expression of apoptosis-regulating proteins in chronic lymphocytic leukemia: correlations with In vitro and In vivo chemoresponses. (1998) (722)
Taxol induces bcl-2 phosphorylation and death of prostate cancer cells. (1996) (707)
Molecular cloning of the chromosomal breakpoint of B-cell lymphomas and leukemias with the t(11;14) chromosome translocation. (1984) (687)
Oncogenes and cancer. (2008) (668)
MicroRNA signatures associated with cytogenetics and prognosis in acute myeloid leukemia. (2008) (664)
The detection of differentially expressed microRNAs from the serum of ovarian cancer patients using a novel real-time PCR platform. (2009) (652)
MicroRNA signatures in tissues and plasma predict development and prognosis of computed tomography detected lung cancer (2011) (650)
MicroRNA expression, survival, and response to interferon in liver cancer. (2009) (643)
Bcl2 is the guardian of microtubule integrity. (1997) (634)
MiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinoma (2008) (634)
MicroRNAs in cancer. (2014) (633)
Micro-RNA profiling in kidney and bladder cancers. (2007) (629)
microRNA-29 can regulate expression of the long non-coding RNA gene MEG3 in hepatocellular cancer (2011) (621)
The FHIT Gene at 3p14.2 Is Abnormal in Lung Cancer (1996) (595)
Long noncoding RNA in prostate, bladder, and kidney cancer. (2014) (590)
miR-15a and miR-16-1 in cancer: discovery, function and future perspectives (2010) (585)
Biological Functions of miR-29b Contribute to Positive Regulation of Osteoblast Differentiation* (2009) (566)
microRNA involvement in human cancer. (2012) (559)
MicroRNA and cancer--a brief overview. (2015) (556)
MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis (2008) (556)
miR-328 Functions as an RNA Decoy to Modulate hnRNP E2 Regulation of mRNA Translation in Leukemic Blasts (2010) (555)
NF-kappaB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. (2008) (549)
Genomic and epigenetic alterations deregulate microRNA expression in human epithelial ovarian cancer (2008) (533)
A microRNA signature for a BMP2-induced osteoblast lineage commitment program (2008) (531)
Identification of microRNA‐181 by genome‐wide screening as a critical player in EpCAM–positive hepatic cancer stem cells (2009) (530)
Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin (2008) (529)
MiR-21 is an EGFR-regulated anti-apoptotic factor in lung cancer in never-smokers (2009) (508)
CD34+ hematopoietic stem-progenitor cell microRNA expression and function: A circuit diagram of differentiation control (2006) (504)
Human chronic lymphocytic leukemia modeled in mouse by targeted TCL1 expression (2002) (501)
Localization of gene for human p53 tumour antigen to band 17p13 (1986) (500)
Translocation and rearrangements of the c-myc oncogene locus in human undifferentiated B-cell lymphomas. (1983) (496)
Akt induces enhanced myocardial contractility and cell size in vivo in transgenic mice (2002) (496)
Down-regulation of bcl-2 by p53 in breast cancer cells. (1994) (494)
Pancreatic endocrine tumors: expression profiling evidences a role for AKT-mTOR pathway. (2010) (493)
p53 regulates epithelial–mesenchymal transition through microRNAs targeting ZEB1 and ZEB2 (2011) (493)
MicroRNA expression profiling of human metastatic cancers identifies cancer gene targets (2009) (490)
Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181. (2006) (486)
MicroRNAs 17-5p–20a–106a control monocytopoiesis through AML1 targeting and M-CSF receptor upregulation (2007) (466)
Clinical response and miR-29b predictive significance in older AML patients treated with a 10-day schedule of decitabine (2010) (458)
Methylation mediated silencing of MicroRNA-1 gene and its role in hepatocellular carcinogenesis. (2008) (458)
MicroRNA expression in cytogenetically normal acute myeloid leukemia. (2008) (454)
MicroRNA 29b functions in acute myeloid leukemia. (2009) (447)
Clustering of breakpoints on chromosome 11 in human B-cell neoplasms with the t(11 ; 14) chromosome translocation (1985) (439)
Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke (2009) (439)
Downregulation of p53-inducible microRNAs 192, 194, and 215 impairs the p53/MDM2 autoregulatory loop in multiple myeloma development. (2010) (436)
MicroRNAs (miR)-221 and miR-222, both overexpressed in human thyroid papillary carcinomas, regulate p27Kip1 protein levels and cell cycle. (2007) (435)
A potential role for interleukin-15 in the regulation of human natural killer cell survival. (1997) (425)
MicroRNA deregulation in human thyroid papillary carcinomas. (2006) (418)
MicroRNA-21 is Overexpressed in Pancreatic Cancer and a Potential Predictor of Survival (2008) (414)
Mch3, a novel human apoptotic cysteine protease highly related to CPP32. (1995) (408)
Emerging role of miR-106b-25/miR-17-92 clusters in the control of transforming growth factor beta signaling. (2008) (404)
MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. (2010) (401)
Detection of hematogenous micrometastasis in patients with prostate cancer. (1992) (397)
A program of microRNAs controls osteogenic lineage progression by targeting transcription factor Runx2 (2011) (396)
Knockdown of ALR (MLL2) Reveals ALR Target Genes and Leads to Alterations in Cell Adhesion and Growth (2006) (393)
miRNA profiling of cancer. (2013) (390)
MicroRNA Expression in Squamous Cell Carcinoma and Adenocarcinoma of the Esophagus: Associations with Survival (2009) (390)
MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia (2007) (387)
MiR-122/cyclin G1 interaction modulates p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma cells. (2009) (383)
Replacement of Fhit in cancer cells suppresses tumorigenicity. (1997) (382)
FLAME-1, a Novel FADD-like Anti-apoptotic Molecule That Regulates Fas/TNFR1-induced Apoptosis* (1997) (375)
Reprogramming of miRNA networks in cancer and leukemia. (2010) (374)
Global and Hox-specific roles for the MLL1 methyltransferase. (2005) (373)
Fhit, a putative tumor suppressor in humans, is a dinucleoside 5',5"'-P1,P3-triphosphate hydrolase. (1996) (371)
Single-nucleotide polymorphisms inside microRNA target sites influence tumor susceptibility. (2010) (369)
MicroRNA fingerprints during human megakaryocytopoiesis. (2006) (367)
miRNA signatures associate with pathogenesis and progression of osteosarcoma. (2012) (367)
EGFR and MET receptor tyrosine kinase-altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers (2011) (366)
Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22. (1988) (364)
Specific microRNAs are downregulated in human thyroid anaplastic carcinomas (2007) (363)
Breast cancer signatures for invasiveness and prognosis defined by deep sequencing of microRNA (2012) (363)
MicroRNA microarray identifies Let-7i as a novel biomarker and therapeutic target in human epithelial ovarian cancer. (2008) (363)
MicroRNAs modulate the chemosensitivity of tumor cells (2008) (360)
Clinical Applications for microRNAs in Cancer (2013) (356)
microRNA-205 regulates HER3 in human breast cancer. (2009) (356)
Mammalian microRNAs: a small world for fine-tuning gene expression (2006) (352)
MicroRNA-21 induces resistance to 5-fluorouracil by down-regulating human DNA MutS homolog 2 (hMSH2) (2010) (350)
Papillomavirus sequences integrate near cellular oncogenes in some cervical carcinomas. (1987) (341)
miR-155: On the Crosstalk Between Inflammation and Cancer (2009) (338)
A network connecting Runx2, SATB2, and the miR-23a∼27a∼24-2 cluster regulates the osteoblast differentiation program (2010) (335)
Modulation of mismatch repair and genomic stability by miR-155 (2010) (331)
Molecular basis of human B cell neoplasia. (1985) (331)
MicroRNA cluster 221-222 and estrogen receptor alpha interactions in breast cancer. (2010) (326)
MicroRNA-221/222 confers breast cancer fulvestrant resistance by regulating multiple signaling pathways (2011) (325)
Mechanisms of microRNA deregulation in human cancer (2008) (323)
Chromosomal location of the genes for human immunoglobulin heavy chains. (1979) (321)
MicroRNA-221 Targets Bmf in Hepatocellular Carcinoma and Correlates with Tumor Multifocality (2009) (312)
The cut-off limits of the GH response to GH-releasing hormone-arginine test related to body mass index. (2005) (308)
MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. (2008) (308)
Src homology 2 domain-containing inositol-5-phosphatase and CCAAT enhancer-binding protein beta are targeted by miR-155 in B cells of Emicro-MiR-155 transgenic mice. (2009) (307)
miR221/222 in cancer: their role in tumor progression and response to therapy. (2012) (307)
Expression of human and suppression of mouse nucleolus organizer activity in mouse-human somatic cell hybrids. (1976) (307)
Antisense-mediated inhibition of BCL2 protooncogene expression and leukemic cell growth and survival: comparisons of phosphodiester and phosphorothioate oligodeoxynucleotides. (1990) (305)
Interplay between microRNAs and the epigenetic machinery: an intricate network. (2010) (301)
Differential expression of the translocated and the untranslocated c-myc oncogene in Burkitt lymphoma. (1983) (299)
Parkin, a gene implicated in autosomal recessive juvenile parkinsonism, is a candidate tumor suppressor gene on chromosome 6q25–q27 (2003) (299)
MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer (2008) (298)
Stromal control of cystine metabolism promotes cancer cell survival in chronic lymphocytic leukemia (2012) (297)
microRNAs: Master regulators as potential therapeutics in cancer. (2011) (296)
Production of human hybridomas secreting antibodies to measles virus (1980) (292)
Oncogenic role of miR-483-3p at the IGF2/483 locus. (2010) (292)
Transcriptional activation of the translocated c-myc oncogene in burkitt lymphoma. (1983) (290)
Effect of morphine on resistance to infection. (1983) (289)
Role of microRNA‐155 at early stages of hepatocarcinogenesis induced by choline‐deficient and amino acid–defined diet in C57BL/6 mice (2009) (289)
Causes and Consequences of MicroRNA Dysregulation (2012) (286)
mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer (2007) (283)
Small non-coding RNA and cancer (2017) (280)
Association of a microRNA/TP53 feedback circuitry with pathogenesis and outcome of B-cell chronic lymphocytic leukemia. (2011) (280)
Gene for alpha-chain of human T-cell receptor: location on chromosome 14 region involved in T-cell neoplasms. (1985) (279)
Nanoparticle Orientation to Control RNA Loading and Ligand Display on Extracellular Vesicles for Cancer Regression (2017) (274)
MicroRNA-135b Promotes Cancer Progression by Acting as a Downstream Effector of Oncogenic Pathways in Colon Cancer (2014) (273)
Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. (2008) (272)
Nucleotide sequence of cloned cDNA of human c-myc oncogene (1983) (272)
MicroRNA expression profiling using microarrays (2008) (271)
Loss of FHIT function in lung cancer and preinvasive bronchial lesions. (1998) (270)
Aberrant chromatin at genes encoding stem cell regulators in human mixed-lineage leukemia. (2008) (269)
MicroRNAs in normal and malignant hematopoiesis (2008) (267)
miR-218 Directs a Wnt Signaling Circuit to Promote Differentiation of Osteoblasts and Osteomimicry of Metastatic Cancer Cells* (2012) (266)
Epigenetically deregulated microRNA-375 is involved in a positive feedback loop with estrogen receptor alpha in breast cancer cells. (2010) (261)
MicroRNA involvement in hepatocellular carcinoma (2008) (261)
miR-181b negatively regulates activation-induced cytidine deaminase in B cells (2008) (261)
ATM mutations in B-cell chronic lymphocytic leukemia. (1999) (260)
Tcl1 enhances Akt kinase activity and mediates its nuclear translocation. (2000) (258)
Roles of small RNAs in tumor formation. (2010) (257)
Identification of the TCL1 gene involved in T-cell malignancies. (1994) (256)
MicroRNA expression profiles for the NCI-60 cancer cell panel (2007) (255)
MicroRNAs and chromosomal abnormalities in cancer cells (2006) (255)
FHIT gene alterations in head and neck squamous cell carcinomas. (1996) (255)
The C-terminal SET domains of ALL-1 and TRITHORAX interact with the INI1 and SNR1 proteins, components of the SWI/SNF complex. (1998) (251)
miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-α in human breast cancer cells (2010) (249)
HMGA2 induces pituitary tumorigenesis by enhancing E2F1 activity. (2006) (248)
elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints. (1989) (248)
MicroRNAs in human cancer: from research to therapy (2007) (248)
Resveratrol decreases the levels of miR-155 by upregulating miR-663, a microRNA targeting JunB and JunD. (2010) (247)
BMP7 null mutation in mice: developmental defects in skeleton, kidney, and eye. (1997) (244)
The E3 ubiquitin ligase Itch controls the protein stability of p63 (2006) (242)
Functional association between Wwox tumor suppressor protein and p73, a p53 homolog. (2004) (240)
A 14;18 and an 8;14 chromosome translocation in a cell line derived from an acute B-cell leukemia. (1984) (239)
ALL-1 partial duplication in acute leukemia. (1994) (237)
SnapShot: MicroRNAs in Cancer (2009) (237)
Molecular cloning and characterization of an antigen associated with early stages of melanoma tumor progression. (1988) (235)
Sp1/NFkappaB/HDAC/miR-29b regulatory network in KIT-driven myeloid leukemia. (2010) (233)
MicroRNA-29a regulates intestinal membrane permeability in patients with irritable bowel syndrome (2009) (232)
Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia. (2000) (229)
The FHIT gene at 3p14.2 is abnormal in breast carcinomas. (1996) (227)
Identification of AF-6 and Canoe as Putative Targets for Ras (*) (1996) (227)
Interactions in the Error-prone Postreplication Repair Proteins hREV1, hREV3, and hREV7* (2001) (226)
MiRNAs and cancer. (2009) (225)
Chromosomal localization of the human homolog (c-sis) of the simian sarcoma virus onc gene. (1982) (223)
Epstein-Barr Virus-Induced miR-155 Attenuates NF-κB Signaling and Stabilizes Latent Virus Persistence (2008) (222)
Resveratrol modulates the levels of microRNAs targeting genes encoding tumor-suppressors and effectors of TGFβ signaling pathway in SW480 cells. (2010) (221)
The tumor-suppressor gene FHIT is involved in the regulation of apoptosis and in cell cycle control. (1999) (221)
The miR-17/92 polycistron is up-regulated in sonic hedgehog-driven medulloblastomas and induced by N-myc in sonic hedgehog-treated cerebellar neural precursors. (2009) (221)
Trithorax and dCBP Acting in a Complex to Maintain Expression of a Homeotic Gene (2001) (218)
Involvement of the TCL5 gene on human chromosome 1 in T-cell leukemia and melanoma. (1989) (217)
NOTCH1 mutations in CLL associated with trisomy 12. (2012) (216)
Small molecule enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2-mediated microRNA processing (2011) (216)
The human gene encoding GM-CSF is at 5q21-q32, the chromosome region deleted in the 5q- anomaly. (1985) (216)
Expression and functional role of a transcribed noncoding RNA with an ultraconserved element in hepatocellular carcinoma (2010) (215)
Targeted deletion of Wwox reveals a tumor suppressor function (2007) (214)
Identification of differentially expressed microRNAs by microarray: A possible role for microRNA genes in pituitary adenomas (2007) (214)
Differential expression of the normal and of the translocated human c-myc oncogenes in B cells. (1983) (214)
The expression of a truncated HMGI-C gene induces gigantism associated with lipomatosis. (1999) (213)
Characterization of the protein product of bcl-2, the gene involved in human follicular lymphoma. (1987) (213)
WW domain-containing proteins, WWOX and YAP, compete for interaction with ErbB-4 and modulate its transcriptional function. (2005) (212)
Overexpression of the HMGA2 gene in transgenic mice leads to the onset of pituitary adenomas (2002) (211)
Mutator activity induced by microRNA-155 (miR-155) links inflammation and cancer (2011) (211)
Partial tandem duplication of ALL1 as a recurrent molecular defect in acute myeloid leukemia with trisomy 11. (1996) (210)
Structure and expression of the human FHIT gene in normal and tumor cells. (1997) (210)
Lack of the architectural factor HMGA1 causes insulin resistance and diabetes in humans and mice (2005) (209)
Role of chromosome translocations in human neoplasia (1987) (209)
Regulation of bcl-2 proto-oncogene expression during normal human lymphocyte proliferation. (1987) (207)
miR-221 silencing blocks hepatocellular carcinoma and promotes survival. (2011) (207)
Low frequency of alterations of the α (PPP2R1A) and β (PPP2R1B) isoforms of the subunit A of the serine-threonine phosphatase 2A in human neoplasms (2000) (205)
Expression and prognostic impact of lncRNAs in acute myeloid leukemia (2014) (205)
Involvement of BCL-2 in glucocorticoid-induced apoptosis of human pre-B-leukemias. (1992) (205)
Rarity of somatic and germline mutations of the cyclin-dependent kinase 4 inhibitor gene, CDK4I, in melanoma. (1994) (205)
Molecular analysis of mbcl-2: Structure and expression of the murine gene homologous to the human gene involved in follicular lymphoma (1987) (205)
A new fused transcript in Philadelphia chromosome positive acute lymphocytic leukaemia (1987) (205)
Karyotype-specific microRNA signature in chronic lymphocytic leukemia. (2009) (202)
MicroRNAs play a central role in molecular dysfunctions linking inflammation with cancer (2013) (202)
Association between cigarette smoking and FHIT gene alterations in lung cancer. (1997) (200)
MicroRNAs in the pathogenesis of cancer. (2011) (200)
A common mechanism of chromosomal translocation in T- and B-cell neoplasia. (1986) (198)
Upregulation of Meis1 and HoxA9 in acute lymphocytic leukemias with the t(4 : 11) abnormality (2001) (195)
CpG island hypermethylation-associated silencing of non-coding RNAs transcribed from ultraconserved regions in human cancer (2010) (194)
Preclinical activity of a novel CRM1 inhibitor in acute myeloid leukemia. (2012) (194)
PP2A-activating drugs selectively eradicate TKI-resistant chronic myeloid leukemic stem cells. (2013) (193)
miR-130a targets MET and induces TRAIL-sensitivity in NSCLC by downregulating miR-221 and 222 (2012) (193)
In hepatocellular carcinoma miR‐519d is up‐regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2 (2012) (190)
Transcriptionally active c-myc oncogene is contained within NIARD, a DNA sequence associated with chromosome translocations in B-cell neoplasia. (1983) (189)
Cloning of ALL-1, the locus involved in leukemias with the t(4;11)(q21;q23), t(9;11)(p22;q23), and t(11;19)(q23;p13) chromosome translocations. (1991) (189)
Microvesicles containing miRNAs promote muscle cell death in cancer cachexia via TLR7 (2014) (189)
Chronic lymphocytic leukaemia (2017) (187)
Association of Inflammation-Related and microRNA Gene Expression with Cancer-Specific Mortality of Colon Adenocarcinoma (2009) (186)
Stem cell-like micro-RNA signature driven by Myc in aggressive liver cancer (2010) (184)
Deregulation of c-myc by translocation of the alpha-locus of the T-cell receptor in T-cell leukemias. (1986) (183)
The role of the FHIT/FRA3B locus in cancer. (1998) (183)
ALL-1 tandem duplication in acute myeloid leukemia with a normal karyotype involves homologous recombination between Alu elements. (1994) (182)
FRA3B and other common fragile sites: the weakest links (2001) (181)
miR-155 regulates IFN-γ production in natural killer cells. (2012) (180)
The t(8; 14) chromosomal translocation occurring in B-cell malignancies results from mistakes in V–D–J joining (1986) (179)
Protective role of miR-155 in breast cancer through RAD51 targeting impairs homologous recombination after irradiation (2014) (178)
Cloning of three human tyrosine phosphatases reveals a multigene family of receptor-linked protein-tyrosine-phosphatases expressed in brain. (1990) (178)
B cell receptors in TCL1 transgenic mice resemble those of aggressive, treatment-resistant human chronic lymphocytic leukemia. (2006) (178)
Serine-70 is one of the critical sites for drug-induced Bcl2 phosphorylation in cancer cells. (1998) (177)
Oncogenic potential of bcl-2 demonstrated by gene transfer (1988) (176)
Akt phosphorylates and regulates the orphan nuclear receptor Nur77 (2001) (176)
The tumor spectrum in FHIT-deficient mice (2001) (176)
tsRNA signatures in cancer (2017) (176)
miR-221/222 overexpession in human glioblastoma increases invasiveness by targeting the protein phosphate PTPμ (2012) (174)
Assignment of the genes for human λ immunoglobulin chains to chromosome 22 (1981) (174)
CXCR4 downregulation of let-7a drives chemoresistance in acute myeloid leukemia. (2013) (173)
MicroRNAs as therapeutic targets in cancer. (2011) (173)
A microRNA signature defines chemoresistance in ovarian cancer through modulation of angiogenesis (2013) (171)
miR-29ab1 Deficiency Identifies a Negative Feedback Loop Controlling Th1 Bias That Is Dysregulated in Multiple Sclerosis (2012) (171)
A novel zinc finger gene is fused to EWS in small round cell tumor (2000) (171)
Relationships of microRNA expression in mouse lung with age and exposure to cigarette smoke and light (2009) (171)
Chromosomal rearrangements and microRNAs: a new cancer link with clinical implications. (2007) (171)
A Human REV7 Homolog That Interacts with the Polymerase ζ Catalytic Subunit hREV3 and the Spindle Assembly Checkpoint Protein hMAD2* (2000) (171)
Cell permeable Bcl-2 binding peptides: a chemical approach to apoptosis induction in tumor cells. (2000) (170)
MicroRNA-1 is a candidate tumor suppressor and prognostic marker in human prostate cancer (2011) (170)
Long-range interaction and correlation between MYC enhancer and oncogenic long noncoding RNA CARLo-5 (2014) (169)
The FEZ1 gene at chromosome 8p22 encodes a leucine-zipper protein, and its expression is altered in multiple human tumors. (1999) (169)
Human Cytomegalovirus Infection Alters the Expression of Cellular MicroRNA Species That Affect Its Replication (2008) (166)
Integrated MicroRNA and mRNA Signatures Associated with Survival in Triple Negative Breast Cancer (2013) (165)
Heart-targeted overexpression of caspase3 in mice increases infarct size and depresses cardiac function (2001) (165)
MiR-494 is regulated by ERK1/2 and modulates TRAIL-induced apoptosis in non–small-cell lung cancer through BIM down-regulation (2012) (164)
Molecular rearrangement of the ALL-1 gene in acute myeloid leukemia without cytogenetic evidence of 11q23 chromosomal translocations. (1994) (164)
Genomics of chronic lymphocytic leukemia microRNAs as new players with clinical significance. (2006) (163)
Dysregulation of a family of short noncoding RNAs, tsRNAs, in human cancer (2016) (162)
Chronic lymphocytic leukemia modeled in mouse by targeted miR-29 expression (2010) (162)
The c-kit ligand suppresses apoptosis of human natural killer cells through the upregulation of bcl-2. (1994) (161)
Human TCR-gamma+/delta+, CD8+ T lymphocytes recognize tetanus toxoid in an MHC-restricted fashion (1989) (159)
Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia. (1994) (159)
MicroRNA-155 influences B-cell receptor signaling and associates with aggressive disease in chronic lymphocytic leukemia. (2014) (158)
Role of miR-15/16 in CLL (2014) (158)
Heterogeneity of chromosome 22 breakpoint in Philadelphia-positive (Ph+) acute lymphocytic leukemia. (1986) (158)
Expression of microRNAs and protein‐coding genes associated with perineural invasion in prostate cancer (2008) (156)
Translocation of an immunoglobulin kappa locus to a region 3' of an unrearranged c-myc oncogene enhances c-myc transcription. (1983) (156)
Characterization of the 13q14 tumor suppressor locus in CLL: identification of ALT1, an alternative splice variant of the LEU2 gene. (2001) (156)
Amplification of the c-myc oncogene in one of five human breast carcinoma cell lines. (1984) (155)
Genetic and Epigenetic Silencing of microRNA-203 Enhances ABL 1 and BCR-ABL 1 Oncogene Expression (2008) (154)
Deregulated expression of TCL1 causes T cell leukemia in mice. (1998) (154)
Oncogene activation by chromosome translocation in human malignancy. (1987) (153)
Restoration of fragile histidine triad (FHIT) expression induces apoptosis and suppresses tumorigenicity in lung and cervical cancer cell lines (2002) (153)
BCL2-mediated tumorigenicity of a human T-lymphoid cell line: synergy with MYC and inhibition by BCL2 antisense. (1990) (152)
Liver tumorigenicity promoted by microRNA‐221 in a mouse transgenic model (2012) (151)
MicroRNA profiling as a tool to understand prognosis, therapy response and resistance in breast cancer. (2008) (151)
GOK: a gene at 11p15 involved in rhabdomyosarcoma and rhabdoid tumor development. (1997) (150)
Domains with transcriptional regulatory activity within the ALL1 and AF4 proteins involved in acute leukemia. (1995) (150)
Overexpressed full-length human BCL2 extends the survival of baculovirus-infected Sf9 insect cells. (1992) (150)
Oncosuppressive role of p53‐induced miR‐205 in triple negative breast cancer (2012) (149)
Production of antibodies against influenza virus by somatic cell hybrids between mouse myeloma and primed spleen cells. (1977) (149)
Translocation of immunoglobulin VH genes in Burkitt lymphoma. (1982) (149)
Allele loss and promoter hypermethylation of VHL, RAR-beta, RASSF1A, and FHIT tumor suppressor genes on chromosome 3p in esophageal squamous cell carcinoma. (2003) (149)
MicroRNA genes are frequently located near mouse cancer susceptibility loci (2007) (149)
Transgenic mice overexpressing the wild-type form of the HMGA1 gene develop mixed growth hormone/prolactin cell pituitary adenomas and natural killer cell lymphomas (2005) (148)
DNA rearrangements in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene. (1987) (147)
Akt phosphorylates and regulates Pdcd4 tumor suppressor protein. (2005) (147)
Prognostic microRNA/mRNA signature from the integrated analysis of patients with invasive breast cancer (2013) (147)
Association of amplified oncogene c-myc with an abnormally banded chromosome 8 in a human leukaemia cell line (1983) (145)
Suppression of tumorigenicity of breast cancer cells by microcell-mediated chromosome transfer: studies on chromosomes 6 and 11. (1994) (145)
Insulin growth factor signaling is regulated by microRNA-486, an underexpressed microRNA in lung cancer (2013) (144)
WWOX gene restoration prevents lung cancer growth in vitro and in vivo (2005) (142)
Estrogen Mediated-Activation of miR-191/425 Cluster Modulates Tumorigenicity of Breast Cancer Cells Depending on Estrogen Receptor Status (2013) (142)
Altered expression of Fhit in carcinoma and precarcinomatous lesions of the esophagus. (2000) (142)
Role of MYC-regulated long noncoding RNAs in cell cycle regulation and tumorigenesis. (2015) (142)
Analysis of the murine All-1 gene reveals conserved domains with human ALL-1 and identifies a motif shared with DNA methyltransferases. (1993) (141)
Chromosomal mapping of members of the cdc2 family of protein kinases, cdk3, cdk6, PISSLRE, and PITALRE, and a cdk inhibitor, p27Kip1, to regions involved in human cancer. (1995) (141)
At Least Ten Genes Define the Imprinted Dlk1-Dio3 Cluster on Mouse Chromosome 12qF1 (2009) (141)
Leucine-zipper dimerization motif encoded by the AF17 gene fused to ALL-1 (MLL) in acute leukemia. (1994) (140)
MicroRNAs as therapeutic targets in chemoresistance. (2013) (140)
Genetic alterations of the tumor suppressor gene WWOX in esophageal squamous cell carcinoma. (2002) (140)
MicroRNAs/TP53 feedback circuitry in glioblastoma multiforme (2012) (139)
Absence of Fhit protein in primary lung tumors and cell lines with FHIT gene abnormalities. (1997) (139)
Altered microRNA expression profile in human pituitary GH adenomas: down-regulation of miRNA targeting HMGA1, HMGA2, and E2F1. (2012) (139)
Muir-Torre-like syndrome in Fhit-deficient mice. (2000) (138)
Molecular profiling of blastic plasmacytoid dendritic cell neoplasm reveals a unique pattern and suggests selective sensitivity to NF-kB pathway inhibition (2013) (138)
Mutational landscape of gastric adenocarcinoma in Chinese: Implications for prognosis and therapy (2015) (138)
microRNA expression profiling identifies a four microRNA signature as a novel diagnostic and prognostic biomarker in triple negative breast cancers (2014) (137)
Unique MicroRNA Profile in End-stage Heart Failure Indicates Alterations in Specific Cardiovascular Signaling Networks* (2009) (136)
Genetic, biochemical, and crystallographic characterization of Fhit-substrate complexes as the active signaling form of Fhit. (1998) (135)
Negative Regulation of BRCA1 Gene Expression by HMGA1 Proteins Accounts for the Reduced BRCA1 Protein Levels in Sporadic Breast Carcinoma (2003) (135)
ATM mutations in cancer families. (1996) (135)
The Tumor Suppressor Gene WWOX at FRA16D Is Involved in Pancreatic Carcinogenesis (2004) (135)
FHIT gene therapy prevents tumor development in Fhit-deficient mice (2001) (133)
MicroRNA-224 promotes tumor progression in nonsmall cell lung cancer (2015) (133)
Characterization of the TCL-1 transgenic mouse as a preclinical drug development tool for human chronic lymphocytic leukemia. (2006) (133)
Loss of WWOX Expression in Gastric Carcinoma (2004) (133)
miR-212 increases tumor necrosis factor-related apoptosis-inducing ligand sensitivity in non-small cell lung cancer by targeting the antiapoptotic protein PED. (2010) (133)
Mechanism of Enhanced Cardiac Function in Mice with Hypertrophy Induced by Overexpressed Akt* (2003) (132)
miR-155 targets histone deacetylase 4 (HDAC4) and impairs transcriptional activity of B-cell lymphoma 6 (BCL6) in the Eµ-miR-155 transgenic mouse model (2012) (132)
Crystal structure of the worm NitFhit Rosetta Stone protein reveals a Nit tetramer binding two Fhit dimers (2000) (131)
Sequence of the FRA3B common fragile region: implications for the mechanism of FHIT deletion. (1997) (131)
Transcriptional activation of an unrearranged and untranslocated c-myc oncogene by translocation of a C lambda locus in Burkitt. (1983) (131)
MicroRNA 29 targets nuclear factor-κB-repressing factor and Claudin 1 to increase intestinal permeability. (2015) (130)
Exosome-Derived miR-25-3p and miR-92a-3p Stimulate Liposarcoma Progression. (2017) (130)
Cancer-specific chromosome alterations in the constitutive fragile region FRA3B. (1999) (130)
Aberrant regulation of pVHL levels by microRNA promotes the HIF/VEGF axis in CLL B cells. (2009) (130)
ALL-1 gene at chromosome 11q23 is consistently altered in acute leukemia of early infancy. (1993) (129)
Regulation of acute graft-versus-host disease by microRNA-155. (2010) (129)
MicroRNAs, the immune system and rheumatic disease (2008) (129)
Loss of heterozygosity at 11q22-q23 in breast cancer. (1994) (129)
miR-181b is a biomarker of disease progression in chronic lymphocytic leukemia. (2011) (128)
WWOX in biological control and tumorigenesis (2007) (127)
Activation of MYC in a masked t(8;17) translocation results in an aggressive B-cell leukemia. (1989) (127)
Association of SV40 with human tumors (2002) (127)
Eμ-TCL1 mice represent a model for immunotherapeutic reversal of chronic lymphocytic leukemia-induced T-cell dysfunction (2009) (126)
A methodology for the combined in situ analyses of the precursor and mature forms of microRNAs and correlation with their putative targets (2009) (126)
MicroRNA profiling for the identification of cancers with unknown primary tissue‐of‐origin (2011) (125)
Role of the high mobility group A proteins in human lipomas. (2001) (125)
huASH1 protein, a putative transcription factor encoded by a human homologue of the Drosophila ash1 gene, localizes to both nuclei and cell-cell tight junctions. (2000) (125)
Disrupted microRNA expression caused by Mecp2 loss in a mouse model of Rett syndrome (2010) (124)
In vivo NCL targeting affects breast cancer aggressiveness through miRNA regulation (2013) (124)
Detection and cloning of a common region of loss of heterozygosity at chromosome 1p in breast cancer. (1995) (123)
Location of gene for beta subunit of human T-cell receptor at band 7q35, a region prone to rearrangements in T cells. (1985) (123)
WW domain containing oxidoreductase gene expression is altered in non-small cell lung cancer. (2003) (123)
A new role for microRNAs, as ligands of Toll-like receptors (2013) (122)
MicroRNA miR-30 family regulates non-attachment growth of breast cancer cells (2013) (122)
The (4;11)(q21;q23) chromosome translocations in acute leukemias involve the VDJ recombinase. (1992) (121)
Chromosome translocations and human cancer. (1986) (121)
Molecular cloning and nucleotide sequence of a full-length cDNA for human alpha enolase. (1986) (121)
The WWOX Tumor Suppressor Is Essential for Postnatal Survival and Normal Bone Metabolism* (2008) (120)
Allelic loss on chromosome 3p21.3 and promoter hypermethylation of semaphorin 3B in non-small cell lung cancer. (2003) (120)
Regulation of TCL1 expression in B- and T-cell lymphomas and reactive lymphoid tissues. (2000) (120)
Locus of the alpha-chain of the T-cell receptor is split by chromosome translocation in T-cell leukemias. (1985) (120)
Evolution of B-cell malignancy: pre-B-cell leukemia resulting from MYC activation in a B-cell neoplasm with a rearranged BCL2 gene. (1988) (119)
A novel transcriptional unit of the tre oncogene widely expressed in human cancer cells. (1992) (119)
FHIT: from gene discovery to cancer treatment and prevention. (2002) (119)
MicroRNA expression profiling in human Barrett's carcinogenesis (2011) (118)
Potential gastrointestinal tumor suppressor locus at the 3p14.2 FRA3B site identified by homozygous deletions in tumor cell lines. (1996) (118)
Cancer and the FRA3B/FHIT fragile locus: it's a HIT (2003) (118)
Alterations of the Tumor Suppressor Gene Parkin in Non-Small Cell Lung Cancer (2004) (118)
Low frequency of alterations of the alpha (PPP2R1A) and beta (PPP2R1B) isoforms of the subunit A of the serine-threonine phosphatase 2A in human neoplasms. (2000) (117)
Loss of heterozygosity at chromosome 11q in lung adenocarcinoma: identification of three independent regions. (1995) (117)
The dual epigenetic role of PRMT5 in acute myeloid leukemia: gene activation and repression via histone arginine methylation (2016) (116)
Hepatitis C Virus Proteins Modulate MicroRNA Expression and Chemosensitivity in Malignant Hepatocytes (2010) (116)
MicroRNA expression profiling of male breast cancer (2009) (115)
SOMATIC CELL HYBRIDS BETWEEN MOUSE PERITONEAL MACROPHAGES AND SV40-TRANSFORMED HUMAN CELLS (1974) (115)
Association of Wwox with ErbB4 in breast cancer. (2007) (115)
MicroRNA Profiles Discriminate among Colon Cancer Metastasis (2014) (115)
Chemoprevention of Cigarette Smoke–Induced Alterations of MicroRNA Expression in Rat Lungs (2010) (115)
Loss of FHIT expression in gastric carcinoma. (1998) (114)
The role of microRNA and other non-coding RNA in the pathogenesis of chronic lymphocytic leukemia. (2007) (114)
The different epidemiologic subtypes of Burkitt lymphoma share a homogenous micro RNA profile distinct from diffuse large B-cell lymphoma (2011) (113)
Tcl1 functions as a transcriptional regulator and is directly involved in the pathogenesis of CLL (2008) (113)
MicroRNA-106b-25 cluster expression is associated with early disease recurrence and targets caspase-7 and focal adhesion in human prostate cancer (2013) (113)
Effect of miR-21 and miR-30b/c on TRAIL-induced apoptosis in glioma cells (2013) (113)
Characterization of a cDNA clone encoding human filaggrin and localization of the gene to chromosome region 1q21. (1989) (112)
Dysregulation of miR-31 and miR-21 induced by zinc deficiency promotes esophageal cancer. (2012) (111)
microRNA involvement in hepatocellular carcinoma. (2011) (111)
17-DMAG targets the nuclear factor-kappaB family of proteins to induce apoptosis in chronic lymphocytic leukemia: clinical implications of HSP90 inhibition. (2008) (110)
A role for the WWOX gene in prostate cancer. (2006) (109)
Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2 (2013) (109)
Identification and characterization of the ARP1 gene, a target for the human acute leukemia ALL1 gene. (1998) (109)
FHIT loss of function in human primary breast cancer correlates with advanced stage of the disease. (1999) (108)
Oral Contraceptive-induced Expression of Prostate-specific Antigen in the Female Breast (*) (1995) (108)
Is miR-29 an oncogene or tumor suppressor in CLL? (2010) (108)
Altered Runx1 subnuclear targeting enhances myeloid cell proliferation and blocks differentiation by activating a miR-24/MKP-7/MAPK network. (2009) (108)
Familial cancer associated with a polymorphism in ARLTS1. (2005) (107)
Haploinsufficiency of the Hmga1 gene causes cardiac hypertrophy and myelo-lymphoproliferative disorders in mice. (2006) (107)
hMSH5: a human MutS homologue that forms a novel heterodimer with hMSH4 and is expressed during spermatogenesis. (1999) (107)
Molecular characterization of prostate-specific antigen messenger RNA expressed in breast tumors. (1994) (107)
Role of FHIT in Human Cancer (1999) (107)
Minimal region of loss at 13q14 in B-cell chronic lymphocytic leukemia. (1996) (107)
ERK Activation Globally Downregulates miRNAs through Phosphorylating Exportin-5. (2016) (107)
T-cell-directed TAL-1 expression induces T-cell malignancies in transgenic mice. (1996) (106)
Chronic lymphocytic leukemia: interplay between noncoding RNAs and protein-coding genes. (2009) (106)
Deregulation of microRNA expression in follicular-cell-derived human thyroid carcinomas. (2010) (105)
A human c-erbA oncogene homologue is closely proximal to the chromosome 17 breakpoint in acute promyelocytic leukemia. (1984) (105)
Role of microRNAs in maintaining cancer stem cells. (2015) (105)
Isoform-specific monoubiquitination, endocytosis, and degradation of alternatively spliced ErbB4 isoforms (2008) (105)
Infant acute leukemias show the same biased distribution of ALL1 gene breaks as topoisomerase II related secondary acute leukemias. (1997) (105)
Abnormalities at 14q32.1 in T cell malignancies involve two oncogenes. (1999) (104)
Pre-B-cell leukemia with a t(8; 14) and a t(14; 18) translocation is preceded by follicular lymphoma. (1988) (104)
13q14 deletions in CLL involve cooperating tumor suppressors. (2010) (104)
Induction of homokaryocyte, heterokaryocyte and hybrid formation by lysolecithin. (1971) (104)
Onset of natural killer cell lymphomas in transgenic mice carrying a truncated HMGI-C gene by the chronic stimulation of the IL-2 and IL-15 pathway (2001) (103)
Deletion mapping of chromosome region 9p21‐p22 surrounding the CDKN2 locus in melanoma (1996) (103)
Structure and expression pattern of human ALR, a novel gene with strong homology to ALL-1 involved in acute leukemia and to Drosophila trithorax (1997) (103)
Fragile histidine triad expression delays tumor development and induces apoptosis in human pancreatic cancer. (2001) (103)
Potential topoisomerase II DNA-binding sites at the breakpoints of a t(9;11) chromosome translocation in acute myeloid leukemia. (1993) (103)
Effect of adenoviral transduction of the fragile histidine triad gene into esophageal cancer cells. (2001) (102)
Cloning and characterization of CLLD6, CLLD7, and CLLD8, novel candidate genes for leukemogenesis at chromosome 13q14, a region commonly deleted in B-cell chronic lymphocytic leukemia. (2001) (102)
Molecular analysis of a t(7;14)(g35;g32) chromosome translocation in a T cell leukemia of a patient with ataxia telangiectasia (1988) (102)
Non‐coding RNAs in cancer initiation and progression and as novel biomarkers (2011) (102)
Molecular analysis of a t(14;14) translocation in leukemic T-cells of an ataxia telangiectasia patient. (1989) (101)
The down-regulation of miR-125b in chronic lymphocytic leukemias leads to metabolic adaptation of cells to a transformed state. (2012) (101)
MiR-34a/c-Dependent PDGFR-α/β Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer (2013) (101)
Positions of chromosome 3p14.2 fragile sites (FRA3B) within the FHIT gene. (1997) (100)
Assignment of the T-antigen gene of simian virus 40 to human chromosome C-7. (1973) (99)
Loss of heterozygosity for chromosome 11 in adenocarcinoma of the stomach. (1996) (99)
The Nedd4-binding partner 1 (N4BP1) protein is an inhibitor of the E3 ligase Itch (2007) (99)
The High Mobility Group A2 gene is amplified and overexpressed in human prolactinomas. (2002) (99)
Decreased miR-199 augments visceral pain in patients with IBS through translational upregulation of TRPV1 (2015) (99)
MicroRNAs as regulators of death receptors signaling (2010) (99)
TCL1 participates in early embryonic development and is overexpressed in human seminomas (2002) (98)
Cytogenetic profile of lymphoma of follicle mantle lineage: correlation with clinicobiologic features. (1999) (98)
FEZ1/LZTS1 gene at 8p22 suppresses cancer cell growth and regulates mitosis (2001) (98)
Role of FHIT in human cancer. (1999) (98)
RNA Nanoparticle-Based Targeted Therapy for Glioblastoma through Inhibition of Oncogenic miR-21. (2017) (96)
Expression profiles of acute lymphoblastic and myeloblastic leukemias with ALL-1 rearrangements (2003) (96)
Cyclin G 1 Is a Target of miR-122 a , a MicroRNA Frequently Down-regulated in Human Hepatocellular Carcinoma (2007) (96)
Nucleophosmin (NPM) gene rearrangements in Ki-1-positive lymphomas. (1994) (96)
The chromosome 14 breakpoint in neoplastic B cells with the t(11;14) translocation involves the immunoglobulin heavy chain locus. (1984) (95)
MicroRNA regulation of tumorigenesis, cancer progression and interpatient heterogeneity: towards clinical use (2014) (95)
Cloning of the gene encoding the delta subunit of the human T-cell receptor reveals its physical organization within the alpha-subunit locus and its involvement in chromosome translocations in T-cell malignancy. (1988) (95)
Gain of imprinting at chromosome 11p15: A pathogenetic mechanism identified in human hepatocarcinomas. (2000) (95)
MicroRNA-31 Predicts the Presence of Lymph Node Metastases and Survival in Patients with Lung Adenocarcinoma (2013) (95)
miR-579-3p controls melanoma progression and resistance to target therapy (2016) (95)
Human DNA topoisomerase I is encoded by a single-copy gene that maps to chromosome region 20q12-13.2. (1988) (95)
Characterization of the human TESTIN gene localized in the FRA7G region at 7q31.2. (2000) (95)
Critical Role of the HMGI(Y) Proteins in Adipocytic Cell Growth and Differentiation (2001) (95)
p62/SQSTM1 synergizes with autophagy for tumor growth in vivo (2014) (94)
Mechanisms of PD-L1/PD-1-mediated CD8 T-cell dysfunction in the context of aging-related immune defects in the Eµ-TCL1 CLL mouse model. (2015) (94)
Cloning and sequencing of a c-myc oncogene in a Burkitt's lymphoma cell line that is translocated to a germ line alpha switch region (1985) (94)
Finally, An Apoptosis-Targeting Therapeutic for Cancer. (2016) (94)
Comprehensive miRNA profiling of surgically staged endometrial cancer. (2010) (93)
Targeting Leukemia Stem Cells in vivo with AntagomiR-126 Nanoparticles in Acute Myeloid Leukemia (2015) (93)
Suppression of production of mouse 28S ribosomal RNA in mouse-human hybrids segregating mouse chromosomes. (1977) (93)
Physical and functional interactions between the Wwox tumor suppressor protein and the AP-2gamma transcription factor. (2004) (92)
Morphine and methadone impact on human phagocytic physiology. (1985) (92)
MicroRNAs: fundamental facts and involvement in human diseases. (2006) (91)
MicroRNA-148a reduces tumorigenesis and increases TRAIL-induced apoptosis in NSCLC (2015) (91)
miR-29 Acts as a Decoy in Sarcomas to Protect the Tumor Suppressor A20 mRNA from Degradation by HuR (2013) (91)
MicroRNAs in melanoma development and resistance to target therapy (2017) (90)
MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review (2017) (90)
Physical association with WWOX suppresses c-Jun transcriptional activity. (2006) (90)
Epigenetic changes during disease progression in a murine model of human chronic lymphocytic leukemia (2009) (89)
Physical and Functional Interactions between the Wwox Tumor Suppressor Protein and the AP-2γ Transcription Factor (2004) (89)
Oncogenic All1 fusion proteins target Drosha-mediated microRNA processing (2007) (89)
The structure and nucleotide sequence of the 5' end of the human c-myc oncogene. (1983) (89)
MIR21 Drives Resistance to Heat Shock Protein 90 Inhibition in Cholangiocarcinoma (2017) (88)
Effects of Calorie Restriction and Diet-Induced Obesity on Murine Colon Carcinogenesis, Growth and Inflammatory Factors, and MicroRNA Expression (2014) (88)
Tp44 molecules involved in antigen-independent T cell activation are expressed on human plasma cells. (1987) (87)
Altered expression of selected microRNAs in melanoma: antiproliferative and proapoptotic activity of miRNA-155. (2009) (87)
Localization of the human pim oncogene (PIM) to a region of chromosome 6 involved in translocations in acute leukemias. (1986) (87)
EGFR and MET receptor tyrosine kinase–altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers (2011) (86)
NF-κ B – YY 1 – miR-29 Regulatory Circuitry in Skeletal Myogenesis and Rhabdomyosarcoma (2008) (86)
Prognostic implications of tumor invasion or adhesion to peripancreatic vessels in resected pancreatic cancer. (2009) (85)
The role of TCL1 in human T-cell leukemia (2001) (85)
Expression profiling of microRNA using oligo DNA arrays. (2008) (85)
miR-15b/16-2 deletion promotes B-cell malignancies (2015) (84)
Human glial fibrillary acidic protein: complementary DNA cloning, chromosome localization, and messenger RNA expression in human glioma cell lines of various phenotypes. (1991) (84)
Molecular biology of lymphomas. (1993) (84)
Centennial-Scale Holocene Climate Variability Revealed by a High-Resolution Speleothem d 18 O Record from SW Ireland (84)
MicroRNAs in diseases and drug response. (2008) (83)
Hypoxia induces the overexpression of microRNA-21 in pancreatic cancer cells. (2013) (83)
The Role of microRNAs in the Tumorigenesis of Ovarian Cancer (2013) (83)
Synthesis of kappa light chains by cell lines containing an 8;22 chromosomal translocation derived from a male homosexual with Burkitt's lymphoma. (1983) (82)
Self-fusion of the ALL1 gene. A new genetic mechanism for acute leukemia. (1995) (81)
Alternate splicing of mRNAs encoding human mast cell growth factor and localization of the gene to chromosome 12q22-q24. (1991) (81)
ROR1 can interact with TCL1 and enhance leukemogenesis in Eµ-TCL1 transgenic mice (2013) (81)
Trithorax and ASH1 Interact Directly and Associate with the Trithorax Group-Responsive bxd Region of theUltrabithorax Promoter (1999) (81)
MicroRNAs in carcinogenesis (2007) (80)
Variant translocation of the bcl-2 gene to immunoglobulin lambda light chain gene in chronic lymphocytic leukemia. (1989) (80)
LSD1 demethylates HIF1α to inhibit hydroxylation and ubiquitin-mediated degradation in tumor angiogenesis (2017) (80)
Chromosomal assignment of the human homologues of feline sarcoma virus and avian myeloblastosis virus onc genes. (1982) (79)
MicroRNAs and Cancer: A Long Story for Short RNAs. (2017) (79)
Prostate specific antigen in breast cancer, benign breast disease and normal breast tissue (2005) (78)
Androgen Receptor Status Is a Prognostic Marker in Non-Basal Triple Negative Breast Cancers and Determines Novel Therapeutic Options (2014) (78)
Chromosomal mapping of human keratin genes: evidence of non-linkage. (1988) (78)
Double knockout of the ALL-1 gene blocks hematopoietic differentiation in vitro. (1996) (78)
MiR-221 promotes stemness of breast cancer cells by targeting DNMT3b (2015) (78)
Lineage infidelity of a human myelogenous leukemia cell line. (1984) (78)
Inactivation of the Wwox gene accelerates forestomach tumor progression in vivo. (2007) (78)
PANCREAS PRESERVATION WITH UNIVERSITY OF WISCONSIN AND CELSIOR SOLUTIONS: A SINGLE-CENTER, PROSPECTIVE, RANDOMIZED PILOT STUDY (2004) (78)
Mapping chromosomal breakpoints of Burkitt's t(8;14) translocations far upstream of c-myc. (1992) (78)
Identification of a risk dependent microRNA expression signature in myelodysplastic syndromes (2011) (77)
Aberrant FHIT transcripts in Merkel cell carcinoma. (1996) (77)
Genetic and Epigenetic Silencing of MicroRNA-203 Enhances ABL1 and BCR-ABL1 Oncogene Expression. (2008) (77)
Effect of rapamycin on mouse chronic lymphocytic leukemia and the development of nonhematopoietic malignancies in Emu-TCL1 transgenic mice. (2006) (77)
A differentially expressed set of microRNAs in cerebro-spinal fluid (CSF) can diagnose CNS malignancies (2015) (76)
The self-assembly of anticancer camptothecin-dipeptide nanotubes: a minimalistic and high drug loading approach to increased efficacy. (2015) (76)
Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer. (2010) (76)
Chromosome walking on the TCL1 locus involved in T-cell neoplasia. (1993) (76)
Restoration of fragile histidine triad (FHIT) expression induces apoptosis and suppresses tumorigenicity in breast cancer cell lines. (2003) (75)
The BAFF receptor TACI controls IL-10 production by regulatory B cells and CLL B cells (2015) (75)
Targeted ablation of the WW domain-containing oxidoreductase tumor suppressor leads to impaired steroidogenesis. (2009) (75)
Expression of the prostate-specific antigen gene by a primary ovarian carcinoma. (1995) (74)
Fhit is a physiological target of the protein kinase Src. (2004) (74)
The role of chromosomal translocations in B- and T-cell neoplasia. (1987) (74)
Loss of mouse chromosomes in somatic cell hybrids between HT-1080 human fibrosarcoma cells and mouse peritioneal macrophages. (1976) (74)
RNA nanoparticle as a vector for targeted siRNA delivery into glioblastoma mouse model (2015) (73)
Sequence conservation at human and mouse orthologous common fragile regions, FRA3B/FHIT and Fra14A2/Fhit (2001) (73)
The reciprocal partners of both the t(14; 18) and the t(11; 14) translocations involved in B-cell neoplasms are rearranged by the same mechanism. (1988) (73)
Chromosomal localization of the human osteocalcin gene. (1989) (73)
Loss of miR-125b-1 contributes to head and neck cancer development by dysregulating TACSTD2 and MAPK pathway (2014) (72)
miR-21 and miR-155 are associated with mitotic activity and lesion depth of borderline melanocytic lesions (2011) (72)
Nitrilase and Fhit homologs are encoded as fusion proteins in Drosophila melanogaster and Caenorhabditis elegans. (1998) (72)
MicroRNA in Cancer and Cachexia--A Mini-Review. (2015) (72)
Upregulation of long noncoding RNA MIAT in aggressive form of chronic lymphocytic leukemias (2016) (72)
Chronic lymphocytic leukaemia (2017) (72)
Cytogenetic and interphase cytogenetic characterization of atypical chronic lymphocytic leukemia carrying BCL1 translocation. (1997) (72)
microRNA classifiers are powerful diagnostic/prognostic tools in ALK-, EGFR-, and KRAS-driven lung cancers (2015) (71)
Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering. (1991) (71)
Designed FHIT alleles establish that Fhit-induced apoptosis in cancer cells is limited by substrate binding (2003) (71)
Pituitary imaging abnormalities in patients with and without hypopituitarism after traumatic brain injury (2007) (71)
Control of expression of histocompatibility antigens (H-2) and beta 2-microglobulin in F9 teratocarcinoma stem cells. (1981) (71)
B-cell malignancies in microRNA Eμ-miR-17∼92 transgenic mice (2013) (71)
The human c-ros gene (ROS) is located at chromosome region 6q16----6q22. (1986) (71)
A Pentamer Transcriptional Complex Including tal-1 and Retinoblastoma Protein Downmodulates c-kit Expression in Normal Erythroblasts (2000) (71)
Expression of FRA16D/WWOX and FRA3B/FHIT genes in hematopoietic malignancies. (2003) (70)
Role of microRNA in chronic lymphocytic leukemia onset and progression (2015) (70)
Trisomy 12 chronic lymphocytic leukemia cells exhibit upregulation of integrin signaling that is modulated by NOTCH1 mutations. (2014) (70)
MicroRNAs in the pathogeny of chronic lymphocytic leukaemia (2007) (70)
BCL2 and miR-15/16: from gene discovery to treatment. (2018) (70)
Selective suppression of the transcription of ribosomal genes in mouse‐human hybrid cells (1979) (69)
Restoration of receptor-type protein tyrosine phosphatase eta function inhibits human pancreatic carcinoma cell growth in vitro and in vivo. (2004) (69)
Effect of environmental pH on the efficiency of cellular hybridization. (1972) (69)
Erratum: miR-15 and miR-16 induce apoptosis by targeting BCL2 (Proceedings of the National Academy of Sciences of the United States of America (September 27, 2005) 102, 39 (13944-13949) DOI: 10.1073/pnas.0506654102) (2006) (69)
Human histone genes map to multiple chromosomes. (1986) (69)
rs4919510 in hsa-mir-608 Is Associated with Outcome but Not Risk of Colorectal Cancer (2012) (69)
Potential cancer therapy with the fragile histidine triad gene: review of the preclinical studies. (2001) (68)
Down-regulation of homeobox genes MEIS1 and HOXA in MLL-rearranged acute leukemia impairs engraftment and reduces proliferation (2011) (68)
Protumorigenic effects of mir-145 loss in malignant pleural mesothelioma (2014) (68)
Pluripotent stem cell miRNAs and metastasis in invasive breast cancer. (2014) (68)
Translocated c-myc oncogene of Burkitt lymphoma is transcribed in plasma cells and repressed in lymphoblastoid cells. (1984) (68)
TNF‐α signal transduction in rat neonatal cardiac myocytes: definition of pathways generating from the TNF‐α receptor (2002) (68)
Regulation of BRCA1 Transcription by Specific Single-Stranded DNA Binding Factors (2003) (68)
Functional implications of microRNAs in acute myeloid leukemia by integrating microRNA and messenger RNA expression profiling (2011) (68)
Human hybridomas secreting anti-islet autoantibodies (1982) (67)
Complete exon structure of the ALL1 gene. (1996) (67)
Suppression of microRNA-9 by mutant EGFR signaling upregulates FOXP1 to enhance glioblastoma tumorigenicity. (2014) (67)
Expression of H–2, laminin and SV40T and TASA on differentiation of transformed murine teratocarcinoma cells (1980) (67)
Reactivation of silent rRNA genes by simian virus 40 in human-mouse hybrid cells. (1979) (67)
Molecular basis of mature T-cell leukemia. (2001) (67)
Strong Inverse Correlation Between MicroRNA-125b and Human Papillomavirus DNA in Productive Infection (2010) (66)
miR-302b enhances breast cancer cell sensitivity to cisplatin by regulating E2F1 and the cellular DNA damage response (2015) (66)
MicroRNAs in the ontogeny of leukemias and lymphomas (2009) (66)
MicroRNA-224 is implicated in lung cancer pathogenesis through targeting caspase-3 and caspase-7 (2015) (66)
The FHIT gene, a multiple tumor suppressor gene encompassing the carcinogen sensitive chromosome fragile site, FRA3B. (1997) (65)
Fez1/Lzts1 absence impairs Cdk1/Cdc25C interaction during mitosis and predisposes mice to cancer development. (2007) (65)
Clustering of breakpoints on chromosome 10 in acute T-cell leukemias with the t(10;14) chromosome translocation. (1989) (65)
Amplified C lambda and c-abl genes are on the same marker chromosome in K562 leukemia cells. (1983) (65)
The AKT1 proto-oncogene maps to human chromosome 14, band q32. (1988) (65)
Circulating miR-106b-3p, miR-101-3p and miR-1246 as diagnostic biomarkers of hepatocellular carcinoma (2018) (65)
Diagnosis of adult GH deficiency (2008) (65)
Chromosome translocations and B cell neoplasia. (1984) (65)
Loss of Hmga1 gene function affects embryonic stem cell lymphohematopoietic differentiation (2003) (64)
Human urokinase gene is located on the long arm of chromosome 10. (1985) (64)
miR-196b-5p–mediated downregulation of TSPAN12 and GATA6 promotes tumor progression in non-small cell lung cancer (2020) (64)
Loss of FHIT expression in transitional cell carcinoma of the urinary bladder. (2000) (64)
Overexpression of miR-155 causes expansion, arrest in terminal differentiation and functional activation of mouse natural killer cells. (2013) (64)
WWOX Expression in Different Histologic Types and Subtypes of Non–Small Cell Lung Cancer (2007) (64)
Transcriptional map of 170-kb region at chromosome 11p15.5: identification and mutational analysis of the BWR1A gene reveals the presence of mutations in tumor samples. (1998) (64)
Fhit modulation of the Akt-survivin pathway in lung cancer cells: Fhit-tyrosine 114 (Y114) is essential (2006) (63)
Noncoding RNA: Current Deep Sequencing Data Analysis Approaches and Challenges (2016) (63)
Intramitochondrial calcium regulation by the FHIT gene product sensitizes to apoptosis (2009) (63)
Promoter hypermethylation of RASSF1A in esophageal squamous cell carcinoma. (2003) (63)
Dietary zinc deficiency fuels esophageal cancer development by inducing a distinct inflammatory signature (2012) (63)
BCL2 and miR-15/16: from gene discovery to treatment (2017) (63)
Pharmacological targeting of miR-155 via the NEDD8-activating enzyme inhibitor MLN4924 (Pevonedistat) in FLT3-ITD acute myeloid leukemia (2015) (63)
Selected MicroRNAs Define Cell Fate Determination of Murine Central Memory CD8 T Cells (2010) (62)
MicroRNAs 221 and 222 Inhibit Normal Erythropoiesis and Erythroleukemic Cell Growth Via Kit Receptor Downmodulation. (2005) (62)
Molecular basis of CLL. (2010) (62)
FHIT in human cancer. (1998) (62)
Overexpression of TCL1 activates the endoplasmic reticulum stress response: a novel mechanism of leukemic progression in mice. (2012) (62)
Transcription signatures encoded by ultraconserved genomic regions in human prostate cancer (2013) (62)
Characterization of the human PIM-1 gene: a putative proto-oncogene coding for a tissue specific member of the protein kinase family. (1987) (61)
A set of NF-κB–regulated microRNAs induces acquired TRAIL resistance in Lung cancer (2015) (61)
MicroRNA-375 and MicroRNA-221: Potential Noncoding RNAs Associated with Antiproliferative Activity of Benzyl Isothiocyanate in Pancreatic Cancer. (2011) (61)
A unique microRNA profile in end-stage heart failure indicates alterations in specific cardiovascular signaling networks. (2016) (61)
TCL1 oncogene activation in preleukemic T cells from a case of ataxia-telangiectasia. (1995) (61)
Tumour predisposition and cancer syndromes as models to study gene–environment interactions (2020) (61)
E 2 F 1-Regulated MicroRNAs Impair TGF b-Dependent Cell-Cycle Arrest and Apoptosis in Gastric Cancer (60)
Human homeo box-containing genes located at chromosome regions 2q31----2q37 and 12q12----12q13. (1987) (60)
Tcl1 protein functions as an inhibitor of de novo DNA methylation in B-cell chronic lymphocytic leukemia (CLL) (2012) (60)
The gene encoding the T-cell surface protein T4 is located on human chromosome 12. (1986) (59)
FHIT Suppresses Epithelial-Mesenchymal Transition (EMT) and Metastasis in Lung Cancer through Modulation of MicroRNAs (2014) (59)
TCL1 targeting miR-3676 is codeleted with tumor protein p53 in chronic lymphocytic leukemia (2015) (59)
Tumor and growth suppression of breast cancer cells by chromosome 17-associated functions. (1994) (59)
Molecular resemblance of an AIDS-associated lymphoma and endemic Burkitt lymphomas: implications for their pathogenesis. (1989) (59)
Wwox inactivation enhances mammary tumorigenesis (2011) (59)
Role of microRNAs in lymphoid biology and disease (2011) (58)
miR-27a and miR-27a* contribute to metastatic properties of osteosarcoma cells (2015) (58)
Uniparental propagation of mitochondrial DNA in mouse-human cell hybrids. (1980) (58)
p 53 regulates epithelial – mesenchymal transition through microRNAs targeting ZEB 1 and ZEB 2 (2011) (58)
The Novel Deacetylase Inhibitor AR-42 Demonstrates Pre-Clinical Activity in B-Cell Malignancies In Vitro and In Vivo (2010) (57)
Toll-like receptor 3 (TLR3) activation induces microRNA-dependent reexpression of functional RARβ and tumor regression (2013) (57)
Genetic ablation of Ptprj, a mouse cancer susceptibility gene, results in normal growth and development and does not predispose to spontaneous tumorigenesis. (2006) (57)
Fragile site orthologs FHIT/FRA3B and Fhit/Fra14A2: Evolutionarily conserved but highly recombinogenic (2003) (57)
Bortezomib Treatment Sensitizes Oncolytic HSV-1–Treated Tumors to NK Cell Immunotherapy (2016) (57)
Characterization and localization of the TCL-1 oncogene product. (1994) (57)
ALL-1 gene rearrangements in acute myeloid leukemia: association with M4-M5 French-American-British classification subtypes and young age. (1995) (57)
Fhit-deficient normal and cancer cells are mitomycin C and UVC resistant (2004) (57)
The alpha-spectrin gene is on chromosome 1 in mouse and man. (1985) (57)
Knockout mice reveal a tumor suppressor function for Testin. (2005) (57)
The bcl-2 gene encodes a novel G protein (1989) (57)
Micro-RNAs in gastrointestinal and liver disease. (2008) (56)
MicroRNAs as anti-cancer therapy. (2014) (56)
Role of the tRNA-Derived Small RNAs in Cancer: New Potential Biomarkers and Target for Therapy. (2017) (56)
Chromosome translocations and human cancer. (1985) (56)
Regression of upper gastric cancer in mice by FHIT gene delivery (2003) (55)
Fez1/lzts1 alterations in gastric carcinoma. (2001) (55)
Ectopic TAL-1/SCL expression in phenotypically normal or leukemic myeloid precursors: proliferative and antiapoptotic effects coupled with a differentiation blockade (1997) (55)
HMGA proteins promote ATM expression and enhance cancer cell resistance to genotoxic agents (2011) (55)
Enucleation of cells made simple and rescue of SV40 by enucleated cells made even simpler. (1973) (55)
Positive Regulation of the BRCA1 Promoter* (1999) (55)
WW-domain-containing oxidoreductase is associated with low plasma HDL-C levels. (2008) (55)
Apoptomirs: small molecules have gained the license to kill. (2010) (55)
Nucleotide sequence analysis of human abl and bcr-abl cDNAs. (1989) (55)
Specific microRNAs are downregulated in human thyroid anaplastic carcinomas (2016) (55)
Mutated β-catenin evades a microRNA-dependent regulatory loop (2011) (54)
MicroRNAs and leukemias: how strong is the connection? (2006) (54)
Chronic lymphocytic leukemia of Emu-TCL1 transgenic mice undergoes rapid cell turnover that can be offset by extrinsic CD257 to accelerate disease progression. (2009) (54)
Alterations of the tumor suppressor gene ARLTS1 in ovarian cancer. (2006) (54)
Exon structure and promoter identification of STIM1 (alias GOK), a human gene causing growth arrest of the human tumor cell lines G401 and RD (1999) (54)
Mechanisms of chromosome translocation in B- and T-cell neoplasia (1987) (54)
The gene that encodes the human CD20 (B1) differentiation antigen is located on chromosome 11 near the t(11;14)(q13;q32) translocation site. (1989) (54)
Self-assembly of a 5-fluorouracil-dipeptide hydrogel. (2016) (54)
IRF4 mutations in chronic lymphocytic leukemia. (2011) (54)
The BCSC-1 locus at chromosome 11q23-q24 is a candidate tumor suppressor gene (2003) (54)
Disruption of miR-29 Leads to Aberrant Differentiation of Smooth Muscle Cells Selectively Associated with Distal Lung Vasculature (2015) (53)
Liver xanthine oxidase increase in mice in three patholgoical models. A possible defence mechanism. (1980) (53)
Mapping of four distinct BCR-related loci to chromosome region 22q11: order of BCR loci relative to chronic myelogenous leukemia and acute lymphoblastic leukemia breakpoints. (1987) (53)
Human regulatory gene for inducible tyrosine aminotransferase in rat-human hybrids. (1973) (53)
MYC-repressed long noncoding RNAs antagonize MYC-induced cell proliferation and cell cycle progression (2015) (53)
Human anti-nucleolin recombinant immunoagent for cancer therapy (2015) (53)
HIF-1&agr; promotes autophagic proteolysis of Dicer and enhances tumor metastasis (2017) (53)
Chromosomal location of murine and human IL-1 receptor genes. (1991) (52)
Cleavage of the transactivation-inhibitory domain of p63 by caspases enhances apoptosis (2007) (52)
Involvement of RhoH GTPase in the Development of B-Cell Chronic Lymphocytic Leukemia (2009) (52)
Methadone vs morphine: comparison of their effect on phagocytic functions. (1987) (52)
A human hybrid myeloma for production of human monoclonal antibodies. (1984) (52)
Hepatic miR-29ab1 expression modulates chronic hepatic injury (2012) (52)
ALL1 fusion proteins induce deregulation of EphA7 and ERK phosphorylation in human acute leukemias (2007) (52)
Loss of p53 and altered miR15-a/16-1MCL-1 pathway in CLL: insights from TCL1-Tg:p53−/− mouse model and primary human leukemia cells (2014) (51)
Mechanism of human Hb switching: a possible role of the kit receptor/miR 221-222 complex (2010) (51)
Localization of the human JUN protooncogene to chromosome region 1p31-32. (1988) (51)
Transcriptional Activation of an Unrearranged and Untranslocated c-myc Oncogene by Translocation of a Clambda Locus in Burkitt Lymphoma Cells (1983) (50)
The t(8;14) chromosome translocation of the Burkitt lymphoma cell line Daudi occurred during immunoglobulin gene rearrangement and involved the heavy chain diversity region. (1987) (50)
Characterization of t(11;14) translocation in mantle cell lymphoma by fluorescent in situ hybridization. (1996) (50)
Elimination of Chronic Lymphocytic Leukemia Cells in Stromal Microenvironment by Targeting CPT with an Anti-Angina Drug Perhexiline (2016) (50)
Complementation by BCL2 and C-HA-RAS oncogenes in malignant transformation of rat embryo fibroblasts (1990) (50)
Gene for the human T cell differentiation antigen Leu-2/T8 is closely linked to the kappa light chain locus on chromosome 2 (1985) (49)
Somatic cell hybrids between mouse peritoneal macrophages and simian-virus-40-transformed human cells: II. Presence of human chromosome 7 carrying simin virus 40 genome in cells of tumors induced by hybrid cells. (1975) (49)
Chromosome aberrations in atypical chronic lymphocytic leukemia: a cytogenetic and interphase cytogenetic study (1997) (49)
TCL1 is overexpressed in patients affected by adult T-cell leukemias. (1997) (49)
Repression of rearranged mu gene and translocated c-myc in mouse 3T3 cells X Burkitt lymphoma cell hybrids. (1984) (49)
Positive Control of Transformed Phenotype in Hybrids between SV40-Transformed and Normal Human Cells (1974) (49)
Fhit modulates the DNA damage checkpoint response. (2006) (49)
Genomic analysis of human and mouse TCL1 loci reveals a complex of tightly clustered genes. (1999) (49)
UCbase & miRfunc: a database of ultraconserved sequences and microRNA function (2008) (49)
Definition and refinement of chromosome 8p regions of loss of heterozygosity in gastric cancer. (2000) (49)
FoxO1 regulates allergic asthmatic inflammation through regulating polarization of the macrophage inflammatory phenotype (2016) (49)
MiR-181b: new perspective to evaluate disease progression in chronic lymphocytic leukemia (2012) (49)
Identification of the Genes Up- and Down-Regulated by the High Mobility Group A1 (HMGA1) Proteins (2004) (48)
Long noncoding RNAs: Undeciphered cellular codes encrypting keys of colorectal cancer pathogenesis (2018) (48)
Onconase Mediated NFKβ Down-Regulation in Malignant Pleural Mesothelioma (2011) (48)
Adenoviral transduction of TESTIN gene into breast and uterine cancer cell lines promotes apoptosis and tumor reduction in vivo. (2005) (48)
Preferential retention of the human chromosome C-7 in human-(thymidine kinase deficient) mouse hybrid cells. (1973) (48)
DNA-transformed murine teratocarcinoma cells: regulation of expression of simian virus 40 tumor antigen in stem versus differentiated cells. (1980) (48)
Characterization of a New Chronic Lymphocytic Leukemia Cell Line for Mechanistic In Vitro and In Vivo Studies Relevant to Disease (2013) (48)
Antiapoptosis potential of bcl-2 oncogene by dephosphorylation. (1994) (47)
Animal models for chronic lymphocytic leukemia (2007) (47)
Common region of ALL-1 gene disrupted in epipodophyllotoxin-related secondary acute myeloid leukemia. (1993) (47)
Detection of myc translocations in lymphoma cells by fluorescence in situ hybridization with yeast artificial chromosomes. (1995) (47)
cMyc/miR-125b-5p Signalling Determines Sensitivity to Bortezomib in Preclinical Model of Cutaneous T-Cell Lymphomas (2013) (47)
The 2p breakpoint of a 2;8 translocation in Burkitt lymphoma interrupts the V kappa locus. (1984) (47)
Assignment of the integration site for simian virus 40 to chromosome 17 in GM54VA, a human cell line transformed by simian virus 40. (1977) (47)
miR-130a Deregulates PTEN and Stimulates Tumor Growth. (2017) (47)
Fhit tumor suppressor: guardian of the preneoplastic genome. (2008) (47)
Characterization of the receptor protein tyrosine phosphatase gene product PTP gamma: binding and activation by triphosphorylated nucleosides. (1995) (47)
MicroRNAs in intestinal barrier function, inflammatory bowel disease and related cancers — their effects and therapeutic potentials (2017) (47)
Biological Functions of Mammalian Nit1, the Counterpart of the Invertebrate NitFhit Rosetta Stone Protein, a Possible Tumor Suppressor* (2006) (46)
p53 deficiency accelerates induction and progression of esophageal and forestomach tumors in zinc-deficient mice. (2003) (46)
Inflammation regulates microRNA expression in cooperation with p53 and nitric oxide (2012) (46)
Tcl1 interacts with Atm and enhances NF-κB activation in hematologic malignancies. (2012) (46)
Pathogenetic and clinical relevance of microRNAs in colorectal cancer. (2009) (46)
MicroRNA in cancer: New hopes for antineoplastic chemotherapy (2012) (46)
MicroRNA-29b mediates altered innate immune development in acute leukemia. (2016) (45)
Two types of BCR interactions are positively selected during leukemia development in the Eμ-TCL1 transgenic mouse model of CLL. (2015) (45)
Repertoire of antiviral antibodies expressed by somatic cell hybrids. (1978) (45)
Zinc replenishment reverses overexpression of the proinflammatory mediator S100A8 and esophageal preneoplasia in the rat. (2009) (45)
FEZ1/LZTS1 is down-regulated in high-grade bladder cancer, and its restoration suppresses tumorigenicity in transitional cell carcinoma cells. (2002) (45)
A Differential MicroRNA Profile Distinguishes Cholangiocarcinoma from Pancreatic Adenocarcinoma (2011) (45)
Micro-RNA Expression and Function in Lymphomas (2011) (45)
MicroRNA-Cancer Connection: The Beginning of a New Tale (2008) (45)
Identification of microRNA activity by Targets' Reverse EXpression (2009) (45)
The human eps15 gene, encoding a tyrosine kinase substrate, is conserved in evolution and maps to 1p31-p32. (1994) (45)
The murine Tcl1 oncogene: embryonic and lymphoid cell expression (1997) (45)
Implications of the miR-10 family in chemotherapy response of NPM1-mutated AML. (2014) (44)
ALL-1/MLL1, a homologue of Drosophila TRITHORAX, modifies chromatin and is directly involved in infant acute leukaemia (2004) (44)
Self-association of the SET domains of human ALL-1 and of Drosophila TRITHORAX and ASH1 proteins (2000) (44)
FHIT as Tumor Suppressor: Mechanisms and Therapeutic Opportunities (2002) (44)
Endocrine dysfunction in patients operated on for non-pituitary intracranial tumors. (2006) (44)
Tumorigenicity of mouse-human diploid hybrids in nude mice (1975) (43)
Cytokine-driven loss of plasmacytoid dendritic cell function in chronic lymphocytic leukemia (2014) (43)
The localization of the HRX/ALL1 protein to specific nuclear subdomains is altered by fusion with its eps15 translocation partner. (1997) (43)
Molecular cloning of a human immunoglobulin λ chain variable sequence (1984) (43)
Order of genes on human chromosome 5q with respect to 5q interstitial deletions. (1990) (43)
Investigation of microRNA alterations in leukemias and lymphomas. (2007) (43)
Regulation of bcl-2 gene expression in lymphoid cell lines containing normal #18 or t(14;18) chromosomes. (1989) (43)
Sequence analysis of the MYC oncogene involved in the t(8;14)(q24;q11) chromosome translocation in a human leukemia T-cell line indicates that putative regulatory regions are not altered. (1988) (43)
Reduced FEZ1/LZTS1 expression and outcome prediction in lung cancer. (2005) (43)
MYC oncogene involved in a t(8;22) chromosome translocation is not altered in its putative regulatory regions. (1987) (43)
Bdp, a new member of a family of DNA-binding proteins, associates with the retinoblastoma gene product. (1999) (42)
Alpha-chain locus of the T-cell antigen receptor is involved in the t(10;14) chromosome translocation of T-cell acute lymphocytic leukemia. (1987) (42)
A novel POU homeodomain gene specifically expressed in cells of the developing mammalian nervous system. (1992) (41)
DNA synthesis in rabbit spermatozoa after treatment with lysolecithin and fusion with somatic cells. (1972) (41)
Tumorigenicity of simian virus 40-transformed human cells and mouse--human hybrids in nude mice. (1977) (41)
Identification of the c-myc oncogene product in normal and malignant B cells. (1983) (41)
Involvement of the ALL-1 gene in a solid tumor. (1995) (41)
Sp1/NF κ B/HDAC/ miR-29b Regulatory Network in KIT-driven Myeloid Leukemia (2010) (40)
Impaired T- and B-cell development in Tcl1-deficient mice. (2005) (40)
CD5+CD23+ leukemic cell populations in TCL1 transgenic mice show significantly increased proliferation and Akt phosphorylation (2010) (40)
Chromosomal localization of the human genes for lipocortin I and lipocortin II. (1988) (40)
MicroRNA‐29a in Adult Muscle Stem Cells Controls Skeletal Muscle Regeneration During Injury and Exercise Downstream of Fibroblast Growth Factor‐2 (2016) (40)
Standardized karyotype of deer mice, Peromyscus (Rodentia) (1977) (39)
Identification of tRNA‐derived small RNA (tsRNA) responsive to the tumor suppressor, RUNX1, in breast cancer (2020) (39)
Extracellular circulating viral microRNAs: current knowledge and perspectives (2013) (39)
miR-340 predicts glioblastoma survival and modulates key cancer hallmarks through down-regulation of NRAS (2016) (39)
Assignment of the erythropoietin receptor (EPOR) gene to mouse chromosome 9 and human chromosome 19. (1990) (39)
Autoantigen can promote progression to a more aggressive TCL1 leukemia by selecting variants with enhanced B-cell receptor signaling (2013) (39)
Dysregulation of different classes of tRNA fragments in chronic lymphocytic leukemia (2019) (39)
Philip Levine award lecture. Chromosome translocations and oncogenes in human lymphoid tumors. (1990) (39)
Modulation of gene expression in precancerous rat esophagus by dietary zinc deficit and replenishment. (2005) (39)
miRNAs in the spotlight: Understanding cancer gene dependency (2011) (39)
A major human histone gene cluster on the long arm of chromosome 1. (1984) (39)
Purification and crystallization of complexes modeling the active state of the fragile histidine triad protein. (1997) (39)
Translocation breakpoint mapping: molecular and cytogenetic studies of chromosome 22. (1986) (38)
ROR1 expression as a biomarker for predicting prognosis in patients with colorectal cancer (2017) (38)
Genomic organization of the ATM locus involved in ataxia-telangiectasia. (1995) (38)
Molecular cloning and characterization of LOH11CR2A, a new gene within a refined minimal region of LOH at 11q23. (1997) (38)
Early loss of Fhit in the respiratory tract of rodents exposed to environmental cigarette smoke. (2006) (38)
microRNA editing in seed region aligns with cellular changes in hypoxic conditions (2016) (38)
MicroRNAs in diagnosis and prognosis in cancer: what does the future hold? (2010) (38)
Genetic approaches to the study of the molecular basis of human cancer. (1991) (38)
Genetics of type II glycogenosis: assignment of the human gene for acid alpha-glucosidase to chromosome 17. (1979) (38)
Cloning and expression of the human substance K receptor and analysis of its role in mitogenesis. (1991) (37)
MicroRNA Expression Profiling in the Histological Subtypes of Barrett's Metaplasia (2013) (37)
Quaking and miR-155 interactions in inflammation and leukemogenesis (2015) (37)
In situ hybridization and translocation breakpoint mapping (1985) (37)
Reexpression of the rat hypoxanthine phosphoribosyltransferase gene in rat-human hybrids. (1973) (37)
Prognostic and biological significance of the proangiogenic factor EGFL7 in acute myeloid leukemia (2017) (37)
Fragile gene product, Fhit, in oxidative and replicative stress responses (2009) (37)
Familial uveal melanoma: absence of germline mutations involving the cyclin-dependent kinase-4 inhibitor gene (p16). (1996) (37)
Virus-encoded microRNA contributes to the molecular profile of EBV-positive Burkitt lymphomas (2015) (37)
Characterization of the human homologue of RAD54: a gene located on chromosome 1p32 at a region of high loss of heterozygosity in breast tumors. (1997) (37)
MicroRNA dysregulation to identify therapeutic target combinations for chronic lymphocytic leukemia (2017) (37)
Novel mechanisms of regulation of miRNAs in CLL. (2016) (37)
MicroRNAs and lung cancer: From markers to targets (2011) (36)
TNF-alpha signal transduction in rat neonatal cardiac myocytes: definition of pathways generating from the TNF-alpha receptor. (2002) (36)
CONCORDANT SEGREGATION OF THE EXPRESSION OF SV40 T ANTIGEN AND HUMAN CHROMOSOME 7 IN MOUSE-HUMAN HYBRID SUBCLONES (1974) (36)
Zinc deficiency activates S100A8 inflammation in the absence of COX-2 and promotes murine oral-esophageal tumor progression (2010) (36)
Transcribed ultraconserved noncoding RNAs (T-UCR) are involved in Barrett's esophagus carcinogenesis (2014) (36)
The High Mobility Group A proteins contribute to thyroid cell transformation by regulating miR‐603 and miR‐10b expression (2013) (36)
Chimeric mice derived from human-mouse hybrid cells. (1978) (36)
Collecting duct carcinoma of the kidney: an immunohistochemical study of 11 cases (2004) (36)
FHIT-proteasome degradation caused by mitogenic stimulation of the EGF receptor family in cancer cells (2006) (36)
MicroRNA in chronic lymphocytic leukemia: transitioning from laboratory-based investigation to clinical application. (2010) (36)
Screen for MicroRNA and Drug Interactions in Breast Cancer Cell Lines Points to miR-126 as a Modulator of CDK4/6 and PIK3CA Inhibitors (2018) (36)
Repression of Esophageal Neoplasia and Inflammatory Signaling by Anti-miR-31 Delivery In Vivo. (2015) (36)
WWOX and p53 Dysregulation Synergize to Drive the Development of Osteosarcoma. (2016) (35)
A large scale expression study associates uc.283-plus lncRNA with pluripotent stem cells and human glioma (2014) (35)
Alternative splicing, genomic structure, and fine chromosome localization of REV3L (1999) (35)
Localization of the gene encoding human erythroid-potentiating activity to chromosome region Xp11.1----Xp11.4. (1986) (35)
Effect of acute or daily cocaine administration on cellular immune response and virus infection in mice. (1990) (35)
13q14 deletion in non-Hodgkin's lymphoma: correlation with clinicopathologic features. (1999) (35)
Selective targeting of point-mutated KRAS through artificial microRNAs (2017) (34)
Tissue and exosomal miRNA editing in Non-Small Cell Lung Cancer (2018) (34)
The role of deletions at the FRA3B/FHIT locus in carcinogenesis. (1998) (34)
Chromosome localization of human ARH genes, a ras-related gene family. (1990) (34)
Molecular genetics of 11q23 chromosome translocations. (1995) (34)
Southern blot analysis of ALL-1 rearrangements at chromosome 11q23 in acute leukemia. (1993) (34)
Chromosomes, genes, and cancer. (1986) (34)
The murine Fhit locus: isolation, characterization, and expression in normal and tumor cells. (1998) (33)
miRNA-mediated TUSC3 deficiency enhances UPR and ERAD to promote metastatic potential of NSCLC (2018) (33)
TCL1 transgenic mouse model as a tool for the study of therapeutic targets and microenvironment in human B-cell chronic lymphocytic leukemia (2016) (33)
Molecular cloning of the chromosomal breakpoint of a B-cell lymphoma with the t(11;14)(q23;q32) translocation. (1991) (33)
MicroRNAs in cancer: personalizing diagnosis and therapy (2010) (33)
Frag1, a homolog of alternative replication factor C subunits, links replication stress surveillance with apoptosis. (2005) (33)
Human homologue of Moloney leukemia virus integration-4 locus (MLVI-4), located 20 kilobases 3' of the myc gene, is rearranged in multiple myelomas. (1990) (33)
HMGA1 protein expression sensitizes cells to cisplatin-induced cell death (2005) (33)
miRNAs in precancerous lesions of the gastrointestinal tract. (2011) (33)
Relationship of the human protooncogene CBL2 on 11q23 to the t(4;11), t(11;22), and t(11;14) breakpoints. (1991) (33)
A Sleeping Beauty screen reveals NF-kB activation in CLL mouse model. (2013) (33)
The CD37-targeted antibody-drug conjugate IMGN529 is highly active against human CLL and in a novel CD37 transgenic murine leukemia model (2014) (33)
Lung cancer susceptibility in Fhit-deficient mice is increased by Vhl haploinsufficiency. (2005) (32)
Assignment of the genes for human lambda immunoglobulin chains to chromosome 22. (1981) (32)
Fhit–Fdxr interaction in the mitochondria: modulation of reactive oxygen species generation and apoptosis in cancer cells (2019) (32)
Restoration of hypoxanthine phosphoribosyl transferase activity in mouse 1R cells after fusion with chick-embryo fibroblasts. (1973) (32)
A rearranged transforming gene, tre, is made up of human sequences derived from chromosome regions 5q, 17q and 18q. (1988) (32)
Analysis of the 3' flanking region of the human c-myc gene in lymphomas with the t(8;22) and t(2;8) chromosomal translocations. (1986) (32)
Knockout of both miR-15/16 loci induces acute myeloid leukemia (2018) (31)
579 MIR-221 OVEREXPRESSION CONTRIBUTES TO LIVER TUMORIGENESIS (2010) (31)
Extracellular Vesicle Biology in the Pathogenesis of Lung Disease (2017) (31)
The translocated c-myc oncogene of Raji Burkitt lymphoma cells is not expressed in human lymphoblastoid cells. (1985) (31)
Expression of a translocated c-abl gene in hybrids of mouse fibroblasts and chronic myelogenous leukaemia cells (1986) (31)
Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools (2014) (31)
Corrigendum to “MicroRNA and cancer – A brief overview” [Adv Biol Regul 57 (2015) 1–9] (2015) (31)
Crystal structure of MTCP-1: implications for role of TCL-1 and MTCP-1 in T cell malignancies. (1998) (31)
Isolation and functional characterization of peptide agonists of PTPRJ, a tyrosine phosphatase receptor endowed with tumor suppressor activity. (2012) (31)
Fhit Interaction with Ferredoxin Reductase Triggers Generation of Reactive Oxygen Species and Apoptosis of Cancer Cells* (2008) (30)
Somatic cell hybrids producing antibodies specific for the tumor antigen of simian virus 40. (1978) (30)
Zinc supplementation suppresses 4-nitroquinoline 1-oxide-induced rat oral carcinogenesis. (2011) (30)
The FGF-related oncogene, K-FGF, maps to human chromosome region 11q13, possibly near int-2. (1988) (30)
GAM/ZFp/ZNF512B is central to a gene sensor circuitry involving cell-cycle regulators, TGFβ effectors, Drosha and microRNAs with opposite oncogenic potentials (2010) (30)
MicroRNA expression profiling in acute myeloid and chronic lymphocytic leukaemias. (2009) (30)
cDNA cloning and chromosomal localization of the human α‐adrenergic receptor kinase (1991) (30)
Species‐specific monoclonal antibodies in the assignment of the gene for human fibronectin to chromosome 2. (1982) (30)
A TSH-CREB1-microRNA loop is required for thyroid cell growth. (2011) (30)
Allele-specific loss and transcription of the miR-15a/16-1 cluster in chronic lymphocytic leukemia (2014) (30)
Lineage-specific gene rearrangement/deletion: a nonconservative model. (1989) (30)
Regulation of microRNA expression by HMGA1 proteins (2009) (30)
The t(6;16)(p21;q22) chromosome translocation in the LNCaP prostate carcinoma cell line results in a tpc/hpr fusion gene. (1996) (30)
Outcome of 118 pancreas transplants with retroperitoneal portal-enteric drainage. (2005) (29)
Isolation and characterization of a novel gene, hRFI, preferentially expressed in esophageal cancer (2002) (29)
The Genetics of Human Cancer (1978) (29)
Introduction to the role of microRNAs in cancer diagnosis, prognosis, and treatment. (2012) (29)
The c-myc oncogene is translocated to the involved chromosome 12 in mouse plasmacytoma. (1985) (29)
Inactivation of the FHIT Gene Favors Bladder Cancer Development (2004) (29)
Assignment of gene(s) for cell transformation to human chromosome 7 carrying the simian virus 40 genome. (1975) (29)
Molecular cloning and characterization of ZNF202: a new gene at 11q23.3 encoding testis-specific zinc finger proteins. (1998) (29)
Molecular genetics of human B-cell neoplasia. (1986) (29)
Pancreas transplants from donors aged 45 years or older. (2005) (29)
Let-7a down-regulation plays a role in thyroid neoplasias of follicular histotype affecting cell adhesion and migration through its ability to target the FXYD5 (Dysadherin) gene. (2012) (29)
Identification of tRNA-derived ncRNAs in TCGA and NCI-60 panel cell lines and development of the public database tRFexplorer (2019) (29)
miR-Synth: a computational resource for the design of multi-site multi-target synthetic miRNAs (2014) (29)
Chromosomal translocation in T-cell leukemia line HUT 78 results in a MYC fusion transcript. (1988) (29)
Chromosomal orientation of the lambda light chain locus: Vλ is proximal to Cλ in 22q11 (1985) (29)
Synthetic microRNA cassette dosing: pharmacokinetics, tissue distribution and bioactivity. (2012) (29)
The WWOX Gene Modulates High-Density Lipoprotein and Lipid Metabolism (2014) (29)
Assignment of the structural genes for the α subunit of hexosaminidase A, mannosephosphate isomerase, and pyruvate kinase to the region q22-qter of human chromosome 15 (1977) (29)
Evolutionary conservation of the EPS8 gene and its mapping to human chromosome 12q23-q24. (1994) (28)
Introduction of macromolecules into viable mammalian cells : a Wistar symposium workshop held at Sugarloaf Center in Philadelphia, Pennsylvania, May 2-4, 1979 (1980) (28)
Role of PTPRJ genotype in papillary thyroid carcinoma risk. (2010) (28)
A human histone H2B.1 Variant gene, located on chromosome 1, utilizes alternative 3′ end processing (1992) (28)
Discovery of PTPRJ agonist peptides that effectively inhibit in vitro cancer cell proliferation and tube formation. (2013) (28)
Correlation of Fragile Histidine Triad (Fhit) Protein Structural Features with Effector Interactions and Biological Functions* (2009) (28)
Chromosome localization of the gene for human terminal deoxynucleotidyltransferase to region 10q23-q25. (1985) (28)
MAPK15 upregulation promotes cell proliferation and prevents DNA damage in male germ cell tumors (2016) (28)
Thyrotropin regulates thyroid cell proliferation by up-regulating miR-23b and miR-29b that target SMAD3. (2012) (28)
Xenogeneic gene expression in chimeric mice derived from rat--mouse hybrid cells. (1979) (27)
molecular origins of cancer Oncogenes and Cancer (2008) (27)
Therapy of human pancreatic carcinoma based on suppression of HMGA1 protein synthesis in preclinical models (2004) (27)
Cloning and characterization of the human PIM‐1 gene: A putative oncogene related to the protein kinases (1987) (27)
Unidirectional loss of human chromosomes in rat-human hybrids. (1973) (27)
Pathogenetic and diagnostic significance of microRNA deregulation in peripheral T-cell lymphoma not otherwise specified (2014) (27)
Downregulation of miR-15a and miR-16-1 at 13q14 in Chronic Lymphocytic Leukemia. (2016) (27)
c-FLIPL enhances anti-apoptotic Akt functions by modulation of Gsk3β activity (2010) (27)
An Integrated Approach Identifies Mediators of Local Recurrence in Head and Neck Squamous Carcinoma (2017) (27)
The MicroRNA Family Gets Wider: The IsomiRs Classification and Role (2021) (27)
miR-EdiTar: a database of predicted A-to-I edited miRNA target sites (2012) (26)
Friend or Foe: MicroRNAs in the p53 network. (2018) (26)
The t(8;14) breakpoint of the EW 36 undifferentiated lymphoma cell line lies 5' of MYC in a region prone to involvement in endemic Burkitt's lymphomas. (1988) (26)
MicroRNA fingerprints in juvenile myelomonocytic leukemia (JMML) identified miR-150-5p as a tumor suppressor and potential target for treatment (2016) (26)
Development of spontaneous tumours and intestinal lesions in Fhit gene knockout mice (2004) (26)
Receptor Protein Tyrosine Phosphatase Gamma, Ptpγ, Regulates Hematopoietic Differentiation (1997) (26)
MicroRNAs: new players in acute myeloid leukaemia (2009) (26)
Synteny of the genes for thymidine kinase and galactokinase in the mouse and their assignment to mouse chromosome 11. (1977) (26)
Human tumor and rodent-human hybrid cells with an increased number of active human NORs. (1978) (26)
Molecular cloning of cDNAs for the human granulocyte colony-stimulating factor receptor from HL-60 and mapping of the gene to chromosome region 1p32-34 (1992) (25)
MicroRNAs and cancer: introduction. (2011) (25)
Noncoding RNA genes in cancer pathogenesis. (2019) (25)
Chromosomal localization of a human band 3-like gene to region 7q35----7q36. (1986) (25)
WWOX Inhibits Metastasis of Triple-Negative Breast Cancer Cells via Modulation of miRNAs. (2019) (25)
Vitamin D status in primary hyperparathyroidism: a Southern European perspective (2013) (25)
DLX genes as targets of ALL‐1: DLX 2,3,4 down‐regulation in t(4;11) acute lymphoblastic leukemias (2003) (25)
MicroRNA dysregulation and esophageal cancer development depend on the extent of zinc dietary deficiency (2016) (25)
An analysis of genetic factors related to risk of inflammatory bowel disease and colon cancer. (2014) (25)
Assignment of the human gene for galactokinase to chromosome 17 (1974) (25)
Vascular Resections for Pancreatic Ductal Adenocarcinoma: Vascular Resections for PDAC (2020) (25)
MicroRNAs as regulators of death receptors signaling (2010) (25)
Cloning and sequencing of a rearranged V lambda gene from a Burkitt's lymphoma cell line expressing kappa light chains (1985) (25)
HMGA1 protein is a novel target of the ATM kinase. (2008) (24)
Association of a MicroRNA / TP 53 Feedback Circuitry With Pathogenesis and Outcome of B-Cell Chronic Lymphocytic Leukemia (2010) (24)
miR deregulation in CLL. (2013) (24)
Influence of FHIT on benzo[a]pyrene-induced tumors and alopecia in mice: Chemoprevention by budesonide and N-acetylcysteine (2006) (24)
Common fragile genes. (2004) (24)
Deregulated BCL2 expression enhances growth of a human B cell line. (1989) (24)
Trisomy 12 CLLs progress through NOTCH1 mutations (2013) (24)
Consensus report of the 8 and 9th Weinman Symposia on Gene x Environment Interaction in carcinogenesis: novel opportunities for precision medicine (2018) (24)
Loss of miR-204 expression is a key event in melanoma (2018) (24)
TCL1 promotes blastomere proliferation through nuclear transfer, but not direct phosphorylation, of AKT/PKB in early mouse embryos (2008) (24)
miR-181b as a therapeutic agent for chronic lymphocytic leukemia in the Eμ-TCL1 mouse model (2015) (24)
Prognosis Based Definition of Resectability in Pancreatic Cancer (2020) (23)
MiR-155 deletion reduces ischemia-induced paralysis in an aortic aneurysm repair mouse model: Utility of immunohistochemistry and histopathology in understanding etiology of spinal cord paralysis. (2018) (23)
Cancer genes in cell hybrids. (1980) (23)
Transcription factor-mediated epigenetic regulation of cell growth and phenotype for biological control and cancer. (2010) (23)
Expression of malignancy in hybrids between normal and malignant cells (1979) (23)
Anti-viral and anti-tumor antibodies produced by somatic cell hybrids. (1978) (23)
Coexpression of translocated and normal c-myc oncogenes in hybrids between Daudi and lymphoblastoid cells. (1985) (23)
Cancer Genes (1996) (23)
The absence of a human-specific ribosomal DNA transcription factor leads to nucleolar dominance in mouse greater than human hybrid cells (1984) (23)
Molecular characterization of a t(11;14)(q23;q32) chromosome translocation in a B-cell lymphoma. (1990) (23)
Species-specific suppression of histone H1 and H2B production in human/mouse hybrids. (1978) (23)
Regulated Expression of miR-155 is Required for iNKT Cell Development (2015) (23)
The TLR7/8/9 Antagonist IMO-8503 Inhibits Cancer-Induced Cachexia. (2018) (23)
Akt Regulates Drug-Induced Cell Death through Bcl-w Downregulation (2008) (22)
Exosomal miRNA signatures of pancreatic lesions (2020) (22)
Regulation of the corticosteroid inducibility of tyrosine aminotransferase in interspecific hybrid cells (1974) (22)
Investigating miRNA-lncRNA Interactions: Computational Tools and Resources. (2019) (22)
Current perspectives on laparoscopic robot-assisted pancreas and pancreas-kidney transplantation. (2011) (22)
Ran Binding Protein 9 (RanBP9) is a novel mediator of cellular DNA damage response in lung cancer cells (2016) (22)
Kidney transplantation from donors aged more than 65 years. (2004) (22)
Cervical dysplasia, ploidy, and human papillomavirus status correlate with loss of Fhit expression. (2001) (22)
Expression of TCL1 in Hematologic Disorders (2001) (22)
Computational Design of Artificial RNA Molecules for Gene Regulation (2014) (22)
Specific immunoglobulin production and enhanced tumorigenicity following ascites growth of human hybridomas. (1985) (22)
Regulating the Response to Endotoxin Shock Stimulation and Their Possible Roles in a following Lipopolysaccharide/TNF-Modulation of miR-155 and miR-125b Levels (2007) (22)
Oncosuppressor proteins of fragile sites are reduced in cervical cancer. (2010) (22)
The self-assembly of a camptothecin-lysine nanotube. (2016) (22)
Frontiers of MicroRNA Signature in Non-small Cell Lung Cancer (2021) (22)
LZTS1 downregulation confers paclitaxel resistance and is associated with worse prognosis in breast cancer (2013) (22)
Assignment of the human gene for hexose-1-phosphate uridylyltransferase to chromosome 3. (1974) (21)
A novel fully human anti-NCL immunoRNase for triple-negative breast cancer therapy (2016) (21)
Fez1/Lzts1 a new mitotic regulator implicated in cancer development (2007) (21)
MicroRNA and ER stress in cancer. (2021) (21)
Quantitation of the viral DNA present in somatic cell hybrids between mouse and SV40-transformed human cells (1975) (21)
Anti-leukemic activity of microRNA-26a in a chronic lymphocytic leukemia mouse model (2017) (21)
Fhit interaction with ferredoxin reductase triggers generation of reactive oxygen species and apoptosis of cancer cells. (2017) (21)
Detection of minimal residual disease in leukemic patients with the t(10;14)(q24;q11) chromosomal translocation. (1990) (20)
Pleiotropic antitumor effects of the pan‐HDAC inhibitor ITF2357 against c‐Myc‐overexpressing human B‐cell non‐Hodgkin lymphomas (2014) (20)
miRNA clusters as therapeutic targets for hormone-resistant breast cancer (2015) (20)
Normal and neoplastic human cells have different histone H1 compositions. (1982) (20)
Loss of FHIT expression in acute lymphoblastic leukemia. (1999) (20)
MicroRNA dysregulation and multi-targeted therapy for cancer treatment. (2020) (20)
AP-1 elements and TCL1 protein regulate expression of the gene encoding protein tyrosine phosphatase PTPROt in leukemia. (2011) (20)
Combined loss of function of two different loci of miR-15/16 drives the pathogenesis of acute myeloid leukemia (2020) (20)
Downregulation of p53-inducible microRNAs 192, 194, and 215 Impairs the p53/MDM2 Autoregulatory Loop in Multiple Myeloma Development. (2022) (20)
Coordinate Loss of Fragile Gene Expression in Pancreatobiliary Cancers: Correlations Among Markers and Clinical Features (2009) (20)
Targeted disruption of the murine homeodomain-interacting protein kinase-2 causes growth deficiency in vivo and cell cycle arrest in vitro. (2009) (20)
Purification and characterization of the bcl-2 protein. (1994) (20)
Fusion of the bcr and the c-abl genes in Ph'-positive acute lymphocytic leukemia with no rearrangement in the breakpoint cluster region. (1988) (20)
Tumor suppressor functions of ARLTS1 in lung cancers. (2007) (20)
Isolation and partial characterization of a 48-kDa protein which is induced in normal lymphocytes upon mitogenic stimulation. (1986) (20)
Location of rRNA genes in three inbred strains of rat and suppression of rat rRNA activity in rat-human somatic cell hybrids. (1979) (20)
Fez1/Lzts1-deficient mice are more susceptible to N-butyl-N-(4-hydroxybutil) nitrosamine (BBN) carcinogenesis. (2008) (20)
Pleiotropic tumor suppressor functions of WWOX antagonize metastasis (2020) (20)
The role of large T antigen in simian virus 40-induced reactivation of silent rRNA genes in human-mouse hybrid cells. (1980) (20)
MicroRNA dysregulation in acute myeloid leukemia. (2013) (20)
Chromosomal locations of mouse immunoglobulin genes. (1978) (20)
Akt phosphorylates Tal1 oncoprotein and inhibits its repressor activity. (2005) (19)
Functional assays for specific targeting and delivery of RNA nanoparticles to brain tumor. (2015) (19)
Antigen-specific human T-cell hybridomas with helper activity. (1982) (19)
Reversion in expression of hypoxanthine-guanine phosphoribosyl transferase following cell hybridization. (1975) (19)
Effect of zinc supplementation on N-nitrosomethylbenzylamine-induced forestomach tumor development and progression in tumor suppressor-deficient mouse strains. (2011) (19)
Endovascular Repair of an Aorto-Left Renal Vein Fistula Due to a Ruptured Abdominal Aortic Aneurysm after EVAR (2005) (19)
ncRNA Editing: Functional Characterization and Computational Resources. (2019) (19)
Rescue of defective SV40 from mouse-human hybrid cells containing human chromosome 7. (1974) (19)
Receptor protein tyrosine phosphatase gamma, Ptp gamma, regulates hematopoietic differentiation. (1997) (19)
Assignment of the structural gene for human beta glucuronidase to chromosome 7 and tetrameric association of subunits in the enzyme molecule. (1976) (19)
Genetics of cell transformation by simian virus 40. (1975) (19)
The human ALL-1/MLL/HRX antigen is predominantly localized in the nucleus of resting and proliferating peripheral blood mononuclear cells. (1997) (19)
Heat shock protein 70 regulates Tcl1 expression in leukemia and lymphomas. (2013) (19)
The gene encoding the T4 antigen maps to human chromosome 12. (1986) (18)
Somatic cell hybrids between totipotent mouse teratocarcinoma and rat hepatoma cells (1979) (18)
Erratum: Downregulation of p53-inducible microRNAs 192, 194, and 215 Impairs the p53/MDM2 Autoregulatory Loop in Multiple Myeloma Development (Cancer Cell (2010) 18(4) (367–381) (S1535610810003429) (10.1016/j.ccr.2010.09.005)) (2016) (18)
Compatible solutes from hyperthermophiles improve the quality of DNA microarrays (2007) (18)
A Novel Ultrasensitive Hybridization-Based ELISA Method for 2-Methoxyphosphorothiolate MicroRNAs and Its In vitro and In vivo Application (2010) (18)
The breakpoint in 22q11 in a case of Ph-positive acute lymphocytic leukemia interrupts the immunoglobulin light chain gene cluster. (1985) (18)
miR-125a and miR-34a expression predicts Richter syndrome in chronic lymphocytic leukemia patients. (2018) (18)
Suppression of replication of SV40 and polyoma virus in mouse-human hybrids (1977) (18)
Chromosomal approaches to oncogenes and oncogenesis 1 (1988) (18)
Role of TCL1 and ALL1 in human leukemias and development. (1999) (18)
Regulation of microRNA expression by HMGA1 proteins (2016) (18)
Tissue-type plasminogen activator gene is on chromosome 8. (1986) (17)
Ultrastructure of Rabbit Spermatozoa After Treatment with Lysolecithin and in the Presence of Hamster Somatic Cells 1 (1973) (17)
Kidney and pancreas transplants in Jehovah's witnesses: ethical and practical implications. (2004) (17)
Inhibition of SV40-induced cellular DNA synthesis by microinjection of monoclonal antibodies. (1983) (17)
MicroRNAs in mouse models of lymphoid malignancies. (2010) (17)
Prevention of urinary bladder cancer in the FHIT knock-out mouse with Rofecoxib, a Cox-2 inhibitor. (2010) (17)
Fhit Delocalizes Annexin A4 from Plasma Membrane to Cytosol and Sensitizes Lung Cancer Cells to Paclitaxel (2013) (17)
Molecular and cytogenetical alterations induced by environmental cigarette smoke in mice heterozygous for Fhit. (2007) (17)
The gene encoding vasoactive intestinal peptide is located on human chromosome 6p21→6qter (1987) (17)
"ApoptomiRs" in vascular cells: their role in physiological and pathological angiogenesis. (2011) (17)
MicroRNAs and lymphomas. (2008) (17)
Chromosomal translocations in leukaemia. (1993) (17)
Novel insights in molecular mechanisms of CLL. (2012) (17)
Regulation of translocated c-myc genes transfected into plasmacytoma cells. (1986) (17)
Genetics: Are circRNAs involved in cancer pathogenesis? (2016) (16)
Central pancreatectomy with inframesocolic pancreatojejunostomy (2012) (16)
Molecular cloning of cDNAs for the human granulocyte colony-stimulating factor receptor from HL-60 and mapping of the gene to chromosome region 1p32-34. (1992) (16)
MicroRNAs (2008) (16)
microRNA‐Mediated Survivin Control of Pluripotency (2015) (16)
Molecular Cloning and Characterization of an Antigen Associated with Early Stages of Melanoma Tumor Progression 1 (2006) (16)
Fusion Partners for Production of Human Monoclonal Antibodies (1985) (16)
Phosphorylation of the human Fhit tumor suppressor on tyrosine 114 in Escherichia coli and unexpected steady state kinetics of the phosphorylated forms. (2005) (16)
The human transaldolase gene (TALDO1) is located on chromosome 11 at p15.4-p15.5. (1997) (16)
Linkage relationship between the genes for thymidine kinase and galactokinase in different primates (1976) (16)
Correction: Estrogen Mediated-Activation of miR-191/425 Cluster Modulates Tumorigenicity of Breast Cancer Cells Depending on Estrogen Receptor Status (2013) (16)
Molecular genetics of human B- and T-cell neoplasia. (1986) (16)
Assignment of the gene for lactic dehydrogenase A to mouse chromosome 7 using mouse-human hybrids. (1978) (16)
The eighth fibronectin type III domain of protein tyrosine phosphatase receptor J influences the formation of protein complexes and cell localization. (2009) (16)
MDM2 derived from dedifferentiated liposarcoma extracellular vesicles induces MMP2 production from preadipocytes. (2019) (16)
Genome Wide Identification of Recessive Cancer Genes by Combinatorial Mutation Analysis (2008) (15)
Preclinical Assessment of FHIT Gene Replacement Therapy in Human Leukemia Using a Chimeric Adenovirus, Ad5/F35 (2006) (15)
Assignment of the human gene for hexosaminidase B to chromosome 5. (1975) (15)
Cancer prevention and therapy in a preclinical mouse model: impact of FHIT viruses. (2004) (15)
Confirmation of the synteny of the human genes for mannose phosphate isomerase and pyruvate kinase and of their assignment to chromosome 15. (1975) (15)
Human HMGA2 protein overexpressed in mice induces precursor T-cell lymphoblastic leukemia (2014) (15)
Cloning and partial nucleotide sequence of human immunoglobulin mu chain cDNA from B cells and mouse-human hybridomas. (1980) (15)
A mouse model of the fragile gene FHIT: From carcinogenesis to gene therapy and cancer prevention. (2005) (15)
A preliminary study of micro-RNAs as minimally invasive biomarkers for the diagnosis of prostate cancer patients (2021) (15)
UKCCCR guidelines for the use of cell lines in cancer research (1999) (15)
ALL-1 interacts with unr, a protein containing multiple cold shock domains. (1996) (15)
Abrogation of esophageal carcinoma development in miR-31 knockout rats (2020) (15)
Chromosomal locations of members of a family of novel endogenous human retroviral genomes (1986) (15)
Expression and function of gamma delta- and alpha beta-T cell receptor heterodimers on human somatic T cell hybrids. (1990) (15)
Molecular analysis of the BCL-3 locus at chromosome 17q22 in B-cell neoplasms. (1993) (14)
High-mobility-group A1 (HMGA1) proteins down-regulate the expression of the recombination activating gene 2 (RAG2). (2005) (14)
Expression of the teratocarcinoma phenotype in hybrids between totipotent mouse teratocarcinoma and myeloma cells (1980) (14)
BRCA1 5083del19 Mutant Allele Selectively Up-Regulates Periostin Expression In vitro and In vivo (2008) (14)
Characterization of the 13 q 14 Tumor Suppressor Locus in CLL : Identification of ALT 1 , an Alternative Splice Variant of the LEU 2 Gene 1 (2001) (14)
Characterization of defective SV40 isolated from SV40-transformed cells. (1975) (14)
Tcl1 as a model for lymphomagenesis. (2004) (14)
POZ-, AT-hook-, and Zinc Finger-containing Protein (PATZ) Interacts with Human Oncogene B Cell Lymphoma 6 (BCL6) and Is Required for Its Negative Autoregulation* (2012) (14)
The Role of microRNAs in Cancer (2015) (14)
Total Duodenectomy with Enteric Duct Drainage: A Rescue Operation for Duodenal Complications Occurring after Pancreas Transplantation (2010) (14)
Surface Expression of Bcl-2 in Chronic Lymphocytic Leukemia and Other B-Cell Leukemias and Lymphomas Without a Breakpoint t(14;18) (2008) (14)
Pancreas preservation with University of Wisconsin and Celsior solutions. (2004) (14)
The Biology of Tumors (1998) (14)
MicroRNA analysis: is it ready for prime time? (2013) (14)
Molecular genetics of lymphoid tumorigenesis. (1989) (14)
Recent progress on the human bcl-2 gene involved in follicular lymphoma: characterization of the protein products. (1988) (13)
Characterization of heteropolymeric hexosaminidase A in human X mouse hybrid cells. (1976) (13)
Is GH therapy useful to preserve bone mass in transition-phase patients with GH deficiency? (2005) (13)
Discovery and characterization of the feline miRNAome (2017) (13)
A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells (2016) (13)
Melanoma and immunotherapy bridge 2015 (2016) (13)
Discovery and functional implications of a miR-29b-1/miR-29a cluster polymorphism in acute myeloid leukemia (2017) (13)
NCCN task force report: molecular markers in leukemias and lymphomas. (2009) (13)
Human-like hyperplastic prostate with low ZIP1 induced solely by Zn deficiency in rats (2018) (13)
Seven megabase yeast artificial chromosome contig at region 11p15: identification of a yeast artificial chromosome spanning the breakpoint of a chromosomal translocation found in a case of Beckwith-Wiedemann syndrome. (1995) (13)
RANBP9 affects cancer cells response to genotoxic stress and its overexpression is associated with worse response to platinum in NSCLC patients (2018) (13)
Chromosome locations of the MYB related genes, AMYB and BMYB. (1991) (13)
Mechanisms of oncogene activation (2003) (12)
A murine teratocarcinoma stem cell line carries suppressed oncogenic virus genomes (1979) (12)
GHRH and GH secretagogues: clinical perspectives and safety. (2004) (12)
Controversial Role of Adjuvant Therapy in Node-Negative Invasive Intraductal Papillary Mucinous Neoplasm (2020) (12)
Contact inhibition modulates intracellular levels of miR-223 in a p27kip1-dependent manner (2014) (12)
MicroRNA profiling in ovarian cancer. (2013) (12)
Transcriptional control of the expression of mouse globin genes in myeloma × erythroleukemia cell hybrids (1982) (12)
Suppression of the normal mouse c-myc oncogene in human lymphoma cells (1985) (12)
Somatic cell hybrids between mouse peritoneal macrophages and SV40-transformed human cells. III. Identification of surface antigens coded for by human chromosomes 7 and 17. (1977) (12)
Role of bcl-2 in growth factor triggered signal transduction. (1990) (12)
a-Chain locus of the T-cell antigen receptor is involved in the t ( 10 ; 14 ) chromosome translocation of T-cell acute lymphocytic leukemia (12)
Restoration of the conversion of desmosterol to cholesterol in L-cells after hybridization with human fibroblasts. (1974) (11)
isoTar: Consensus Target Prediction with Enrichment Analysis for MicroRNAs Harboring Editing Sites and Other Variations. (2019) (11)
MicroRNA dysregulation in cancer: opportunities for the development of microRNA-based drugs. (2010) (11)
Germ-line chromosomal localization of humanc-erb-A oncogene (1985) (11)
Detecting and Characterizing A-To-I microRNA Editing in Cancer (2021) (11)
A LIF/Nanog axis is revealed in T lymphocytes that lack MARCH-7, a RINGv E3 ligase that regulates the LIF-receptor (2010) (11)
MicroRNAs in Skeletal Muscle and Hints on Their Potential Role in Muscle Wasting During Cancer Cachexia (2020) (11)
Comparative phenotypic analysis of available human hybridoma fusion partners. (1986) (11)
miR-224 Is Significantly Upregulated and Targets Caspase-3 and Caspase-7 During Colorectal Carcinogenesis12 (2018) (11)
MYC-related microRNAs signatures in non-Hodgkin B-cell lymphomas and their relationships with core cellular pathways (2018) (11)
Isolation of a cDNA clone encoding a novel form of granzyme B from human NK cells and mapping to chromosome 14 (1990) (11)
Genetics of human immunoglobulins: assignment of the genes for mu, alpha, and gamma immunoglobulin chains to human chromosome 14. (1980) (11)
Identification of microRNAs implicated in the late differentiation stages of normal B cells suggests a central role for miRNA targets ZEB1 and TP53 (2017) (11)
Vascular complications of pancreatectomy. (2007) (11)
Modified intranuclear organization of regulatory factors in human acute leukemias: Reversal after treatment (2000) (11)
Chromosome assignment of the T-antigen gene of simian virus 40 in African green monkey cells transformed by adeno 7-SV40 hybrid. (1974) (11)
Integration of oncogenic viruses in mammalian cells. (1981) (11)
Deoxyribonuclease I sensitivity of plasmid genomes in teratocarcinoma-derived stem and differentiated cells. (1981) (11)
Determination of absolute expression profiles using multiplexed miRNA analysis (2017) (11)
The locus for the serum prealbumin is proximal to the heavy chain locus on mouse chromosome 12q+. (1986) (11)
Will detection of microRNA biomarkers in blood improve the diagnosis and survival of patients with pancreatic cancer? (2014) (11)
UICC study group on basic and clinical cancer research: Cancer‐suppressing genes (1990) (11)
Clinical significance of fragile histidine triad gene expression in adult acute lymphoblastic leukemia. (2001) (11)
CXCR 4 downregulation of let-7 a drives chemoresistance in acute myeloid leukemia (2013) (11)
The Absence of a Human-Specific Ribosomal DNA Transcription Factor Leads to Nucleolar Dominance in Mouse>Human Hybrid Cells (11)
LINCing chromatin remodeling to metastasis (2010) (10)
Interplay Between Serum Osteocalcin and Insulin Sensitivity in Primary Hyperparathyroidism (2011) (10)
The human VpreB gene is located on chromosome 22 near a cluster of $${\text{V}}_{\lambda _1 } $$ gene segments (2004) (10)
MicroRNA signatures and Foxp3+ cell count correlate with relapse occurrence in follicular lymphoma (2018) (10)
Selective induction of murine oncornavirus gene expression in somatic cell hybrids between mouse peritoneal macrophages and SV-40-transformed human cells. (1976) (10)
Correction: Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. (2019) (10)
Translocation t(2;11) in CLL cells results in CXCR4/MAML2 fusion oncogene. (2014) (10)
Mch 3 , a Novel Human Apoptotic Cysteine Protease Highly Related to CPP 321 (2006) (10)
Effect of environmental pH on rescue of Simian virus 40. (1973) (10)
Transcription of the simian virus 40 genome in DNA-transformed murine teratocarcinoma stem cells. (1981) (10)
Confirmation of the assignment of the gene for galactose-1-phosphate uridylyltransferase (E.C. 2.7.7.12) to human chromosome 9. (1979) (10)
University of Wisconsin solution versus Celsior solution in clinical pancreas transplantation. (2005) (10)
37 Causes and Consequences of microRNA Dysregulation in Cancer (2012) (10)
Message from the New Editor-in-Chief (1990) (10)
p380-8A 1.8 SaSs, a single copy clone 5' of c-myc at 8q24 which recognizes an SstI polymorphism. (1987) (10)
Significance of FHIT expression in chronic myelogenous leukemia. (1999) (10)
Assignment of the gene for cytoplasmic glutamic-oxaloacetic transaminase to the region q24-qter of human chromosome 10 (1976) (10)
Isolation of defective viruses from SV40-transformed human and hamster cells. (1974) (10)
Assignment of a gene for uridine diphosphate galactose-4-epimerase to human chromosome 1 by somatic cell hybridization, with evidence for a regional assignment to 1pter yields 1p21. (1979) (10)
Chromosome sublocalization of a cDNA for human DNA polymerase-β to 8p11→p12 (1988) (10)
Hsa-miR-155-5p drives aneuploidy at early stages of cellular transformation (2018) (10)
The long journey of TCL1 transgenic mice: lessons learned in the last 15 years. (2015) (10)
Src homology 2 domain–containing inositol-5-phosphatase and CCAAT enhancer-binding protein are targeted by miR-155 in B cells of E -MiR-155 transgenic mice (2009) (10)
MicroRNA Profiling of Salivary Duct Carcinoma Versus Her2/Neu Overexpressing Breast Carcinoma Identify miR-10a as a Putative Breast Related Oncogene (2018) (10)
Abstract 3: OncomiR-155 targets oncogenes HDAC4 and BCL6 in a murine B cell leukemia model: A paradigm shift in the oncogenic mechanisms of microRNAs (2010) (9)
MiREDiBase: a manually curated database of editing events in microRNAs (2020) (9)
Using miRNA expression data for the study of human cancer (2008) (9)
Regional procurement team for abdominal organs. (2004) (9)
Fragile histidine triad gene and skin cancer. (2001) (9)
Zinc intake, microRNA dysregulation, and esophageal cancer (2016) (9)
The synthesis and actions of mouse and human interferons in mouse-human hybrid cells. (1978) (9)
The human gene encoding phosphatidylinositol-3 kinase associated p85 alpha is at chromosome region 5q12-13. (1991) (9)
Advances in Brief (1990) (9)
Levels of miR-126 and miR-218 are elevated in ductal carcinoma in situ (DCIS) and inhibit malignant potential of DCIS derived cells (2018) (9)
MicroRNA molecular profiling identifies potential signaling pathways conferring resistance to chemoradiation in locally-advanced rectal adenocarcinoma (2018) (9)
Chromosomal localization of human genes required for G1 progression in mammalian cells. (1989) (9)
Integration of metabolomics, transcriptomics, and microRNA expression profiling reveals a miR-143-HK2-glucose network underlying zinc-deficiency-associated esophageal neoplasia. (2017) (9)
Cellular localization of the bcl-2 protein and response to glucocorticoid stress. (1994) (9)
Primary intrathyroidal paraganglioma: histopathology and novel molecular alterations. (2012) (9)
c-FLIPL enhances anti-apoptotic Akt functions by modulation of Gsk3β activity (2010) (9)
Assignment of the human gene for enolase 1 to region pter→p36 of chromosome 1 (1977) (9)
Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53. (2016) (9)
miR-302 b enhances breast cancer cell sensitivity to cisplatin by regulating E 2 F 1 and the cellular DNA damage response (2016) (9)
Single-center, open, prospective, randomized pilot study comparing cyclosporine versus tacrolimus in simultaneous pancreas-kidney transplantation. (2004) (8)
Crystal Structures of Tcl1 Family Oncoproteins and Their Conserved Surface Features (2002) (8)
Fusion of somatic and gametic cells with lysoleithin. (1973) (8)
Differentially expressed genes execute zinc-induced apoptosis in precancerous esophageal epithelium of zinc-deficient rats (2004) (8)
Chromosomal orientation of the lambda light chain locus: V lambda is proximal to C lambda in 22q11. (1985) (8)
Genetics of pancreatic cancer: where are we now? Where are we going? (2005) (8)
Duplicated regions of AF-4 intron 4 at t(4;11) translocation breakpoints. (1999) (8)
Promoter Hypermethylation of RASSF 1 A in Esophageal Squamous Cell Carcinoma 1 (2003) (8)
Molecular genetics of human B cell neoplasia. (1986) (8)
Presence of two active X chromosomes in hybrids between normal human and SV40-transformed fibroblasts from patients with the Lesch-Nyhan syndrome. (1974) (8)
Cloning and characterization of cDNAs expressed during chick development and encoding different isoforms of a putative zinc finger transcriptional regulator. (2005) (8)
Progress Report to the Readers of Cancer Research (1991) (8)
Studies on the association of the Epstein‐Barr virus genome and human chromosomes (1978) (8)
Announcing Signal Transduction and Targeted Therapy (2016) (8)
Comparative expression profiling of testis-enriched genes regulated during the development of spermatogonial cells (2017) (8)
Linkage of the genes for thymidine kinase and galactokinase in the African green monkey and the chimpanzee. (1976) (8)
Mutation of TGFβ-RII eliminates NSAID cancer chemoprevention (2017) (8)
How can we prevent cancer? (2001) (8)
Influence of interferon-alpha on the expression of cellular oncogenes in primary chronic lymphocytic leukemia cells. (1988) (8)
The Tcl1 oncogene defines secondary hair germ cells differentiation at catagen–telogen transition and affects stem-cell marker CD34 expression (2009) (8)
Chromosomal translocations, immunoglobulin genes, and oncogenes in human B-cell tumors. (1985) (8)
The human homologue of the retroviral oncogene qin maps to chromosome 14q13. (1994) (8)
MiREDiBase, a manually curated database of validated and putative editing events in microRNAs (2021) (8)
HNRNPL Restrains miR-155 Targeting of BUB1 to Stabilize Aberrant Karyotypes of Transformed Cells in Chronic Lymphocytic Leukemia (2019) (8)
Correction: MiR-34a/c-Dependent PDGFR-α/β Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer (2015) (7)
Hmga1 null mice are less susceptible to chemically induced skin carcinogenesis. (2008) (7)
Structure of murine Tcl1 at 2.5 A resolution and implications for the TCL oncogene family. (2001) (7)
Supplemental Data Article NF-κB-YY1-miR-29 Regulatory Circuitry in Skeletal Myogenesis and Rhabdomyosarcoma (2007) (7)
Characterization of human bone marrow‐derived closed circular DNA clones (1993) (7)
The role of p19 and p21 H-Ras proteins and mutants in miRNA expression in cancer and a Costello syndrome cell model (2015) (7)
Immunological effect of cocaine and host resistance in mice (1992) (7)
MicroRNAs in leukemia. (2006) (7)
MIR21-induced loss of junctional adhesion molecule A promotes activation of oncogenic pathways, progression and metastasis in colorectal cancer (2021) (7)
Lactic dehydrogenase virus replicates in somatic cell hybrids of mouse peritoneal macrophages and SV40-transformed human fibroblasts. (1976) (7)
Preclinical Development of LNA Antimir-155 (MRG-106) in Acute Myeloid Leukemia (2015) (7)
Molecular Biology of Leukemias and Lymphomas (1991) (7)
Purification and characterization of recombinant forms of TCL-1 and MTCP-1 proteins. (1998) (7)
Association of Wwox with ErbB 4 in Breast Cancer (2007) (7)
Chromosomal approaches to the molecular basis of neoplasia. (1986) (7)
NCL Inhibition Exerts Antineoplastic Effects against Prostate Cancer Cells by Modulating Oncogenic MicroRNAs (2020) (7)
Chromosome rearrangements in oncogenesis. (1984) (6)
The human VAV proto-oncogene maps to chromosome region 19p12→19p13.2 (1990) (6)
Discovery and identification of oncogenes (2003) (6)
Localization of the structural locus for cytoplasmic glutamic-oxaloacetic transaminase to region q24 leads to qter of human chromosome 10. (1976) (6)
Genetic variants in thyroid cancer distant metastases. (2016) (6)
MiR-181 b : new perspective to evaluate disease progression in chronic lymphocytic leukemia (2012) (6)
Association Between the Proficiency of B-Cell Receptor Signaling and the Relative Expression Levels of ZAP-70, SHIP-1, and Mir-155 in Chronic Lymphocytic Leukemia (2008) (6)
A negative feedback regulatory loop between miR-138 and TP53 is mediated by USP10 (2019) (6)
Cytogenetics of Neoplasia (1987) (6)
POZ-, AT-hook-, and zinc finger-containing protein (PATZ) interacts with human oncogene B cell lymphoma 6 (BCL6) and is required for its negative autoregulation. (2014) (6)
Cloning, Expression of the Human Substance K Receptor, and Analysis of Its Role in Mitogenesis (1991) (6)
Commentary on microRNA Fingerprint in Human Epithelial Ovarian Cancer. (2016) (6)
The chromosome 11 region flanking the t(11;14) breakpoint in human T-ALL is deleted in Wilms' tumor hybrids. (1989) (6)
Expression of fhit protein during mouse development (2000) (6)
Molecular biology of lymphoid malignancies. (1991) (6)
Imperfect complementation in human-hamster somatic cell hybrids (1976) (6)
Expression of a truncated Hmga1b gene induces gigantism, lipomatosis and B-cell lymphomas in mice. (2011) (6)
Chromosomal mapping of cell death proteases CPP32, MCH2, and MCH3. (1996) (6)
Assignment of the genes for human beta-glucuronidase and mitochondrial malate dehydrogenase to the region pter leads to q22 of chromosome 7. (1977) (6)
Experimental Validation of MicroRNA Targets: Analysis of MicroRNA Targets Through Western Blotting. (2019) (6)
Assignment of the gene for glyoxalase I to region p21→pter of human chromosome 6 (1977) (6)
Tissue preference and differentiation of malignant rat x mouse hybrid cells in chimaeric mouse fetuses. (1982) (6)
IGFs and IGFBPs in adult growth hormone deficiency. (2005) (6)
Molecular analysis of an AIDS-associated Burkitt's lymphoma: near-identity with endemic cases. (1988) (6)
Tal1 transgenic expression reveals absence of B lymphocytes. (2006) (6)
Deregulation of microRNA expression in human thyroid carcinomas (2010) (5)
Secretion of human immunoglobulins by mouse myeloma × Daudi somatic cell hybrids (1982) (5)
Newly-Discovered Neural Features Expand the Pathobiological Knowledge of Blastic Plasmacytoid Dendritic Cell Neoplasm (2021) (5)
Experimental Validation of MicroRNA Targets: Luciferase Reporter Assay. (2019) (5)
Correction: In vivo NCL targeting affects breast cancer aggressiveness through miRNA regulation (2017) (5)
Endogenous and artificial miRNAs explore a rich variety of conformations: a potential relationship between secondary structure and biological functionality (2020) (5)
MiR-124a Regulates Extracellular Vesicle Release by Targeting GTPase Rabs in Lung Cancer (2020) (5)
Loss of expression of both miR-15/16 loci in CML transition to blast crisis (2021) (5)
Up-regulation of miR-146b and down-regulation of miR-200b contribute to the cytotoxic effect of histone deacetylase inhibitors on ras-transformed thyroid cells. (2013) (5)
Production of B-tropic murine leukemia virus by somatic cell hybrids between mouse peritoneal macrophages and simian virus 40-transformed human cells (1976) (5)
The combination of TPL2 knockdown and TNFα causes synthetic lethality via caspase-8 activation in human carcinoma cell lines (2019) (5)
Synergistic anti-leukemic activity of imatinib in combination with a small molecule Grb2 SH2 domain binding antagonist (2013) (5)
Advances in cancer cytogenetics (1999) (5)
In situ hybridization and translocation breakpoint mapping. I. Nonidentical 22q11 breakpoints for the t(9;22) of CML and the t(8;22) of Burkitt lymphoma. (1984) (5)
Robotic Pancreas and Pancreas-Kidney Transplantation: First World Cases (2011) (5)
Portal enteric-drained solitary pancreas transplantation without surveillance biopsy: is it safe? (2004) (5)
Molecular cloning of a human immunoglobulin lambda chain variable sequence. (1984) (5)
Antiplatelet effects of a new de-N-acetyl-lyso-glycosphingolipid. (1993) (5)
Assignment of the gene for enolase to mouse chromosome 4 using somatic cell hybrids. (1977) (5)
Expression of mouse and human fibronectin in mouse--human somatic cell hybrids. (1979) (5)
Lysolecithin-induced Fusion of Rabbit Spermatozoa with Hamster Somatic Cells (1972) (5)
Antibody response to simian virus 40 tumor antigen in nude mice reconstituted with T cells. (1977) (5)
Localization of the human HF.10 finger gene on a chromosome region (3p21–22) frequently deleted in human cancers (1990) (5)
Expression of members of immunoglobulin gene family in somatic cell hybrids between human B and T cells. (1987) (5)
The translocated c-myc oncogene of Burkitt lymphoma is differentially regulated in lymphoblastoid vs plasma cells. (1984) (4)
Tcl 1 interacts with Atm and enhances NF-kB activation in hematological malignancies (2011) (4)
Molecular mechanisms involved in human B and T cell neoplasia. (1986) (4)
Chromosomal localization of four human zinc finger cDNAs (1993) (4)
Purification and characterization of recombinant forms of murine Tcl1 proteins. (2000) (4)
Role of color Doppler sonography in post-transplant surveillance of vascular complications involving pancreatic allografts(). (2008) (4)
Molecular Mechanisms of Chromosome Translocation in Human B‐ and T‐cell Neoplasia a (1987) (4)
The Fhit protein: an opportunity to overcome chemoresistance (2016) (4)
Effect of a new De-N-acetyl-lysoglycosphingolipid on chemically-induced inflammatory bowel disease: possible mechanism of action (1993) (4)
Deficiency Accelerates Induction and Progression of Esophageal and Forestomach Tumors in Zinc-deficient Mice 1 (2002) (4)
Melanoma and immunotherapy bridge (2016) (4)
Experimental Validation of MicroRNA Targets: Mutagenesis of Binding Regions. (2019) (4)
27 Causes and consequences of microRNA dysregulation in cancer (2010) (4)
Mir-155 Contributed to Chronic Lymphocytic Leukemia Survival by Modulation of BCR-Signalling (2011) (4)
Human mutant cell lines with altered RNA polymerase II (1982) (4)
Control of expression of histocompatibility antigens ( H-2 ) and ( 32-microglobulin in F 9 teratocarcinoma stem cells ( surface antigens / gene transcription / DNase I / cell differentiation ) (4)
The High Mobility Group A 2 Gene Is Amplified and Overexpressed in Human Prolactinomas 1 (2002) (4)
Protein synthesis in hybrid cells derived from fetal rat x mouse chimeric organs. (1982) (4)
Purification and biochemical properties of the Drosophila TAC1 complex. (2004) (4)
MicroRNAs Act as Decoy Molecules To Restore Granulocytic Maturation of Differentiation-Arrested BCR/ABL+ Myeloid Precursors. (2007) (4)
TCL1A interacts with TP63 and enhances the survival of Raji Burkitt lymphoma cell line (2018) (4)
Approaches to the identification and molecular cloning of chromosome breakpoints. (1995) (4)
Integration of metabolomics, transcriptomics, and microRNA expression profiling reveals a miR-143-HK2-glucose network underlying zinc-deficiency-associated esophageal neoplasia (2017) (4)
Retraction: Are circRNAs involved in cancer pathogenesis? (2016) (4)
MicroRNA Expression Profiling in Sorted AML Subpopulations: A Possible Role for miR-155/BIC in Stem Cell Maintenance and Leukemogenesis. (2005) (4)
Take Your "M" Time (2007) (4)
Genetic Manipulation of Homologous Recombination In Vivo Attenuates Intestinal Tumorigenesis (2015) (4)
In situ hybridization to detect DNA amplification in extracellular vesicles (2022) (3)
Chromosomal proteins of mouse teratocarcinoma cells (1982) (3)
Editorial: Epitranscriptomics: The Novel RNA Frontier (2018) (3)
Expression of HLA‐A, but not of HLA‐B, in mouse‐human somatic cell hybrids carrying the region p21→pter of human chromosome 6 (1978) (3)
Immunotherapy Bridge 2016 and Melanoma Bridge 2016: meeting abstracts (2017) (3)
Targeting Mature T Cell Leukemia (2003) (3)
A Passion for Discovery (2003) (3)
Down-regulated in Human Hepatocellular Carcinoma Cyclin G 1 Is a Target of miR-122 a , a MicroRNA Frequently (2007) (3)
Expression of the malignant phenotype in hybrids between mouse peritoneal macrophages and SV40-transformed human cells containing only human chromosome 7. (1976) (3)
Role of Ts-RNAs in CLL (2016) (3)
MiRNA-29b Targets MCL-1 and Is Down-Regulated in Chemotherapy-Resistant Acute Myeloid Leukemia (AML). (2007) (3)
Assignment of the human gene for enolase 1 to region pter in equilibrium p36 of chromosome 1. (1977) (3)
Molecular diagnosis of lymphoma. (1996) (3)
The TCL-1 Transgenic Mouse Is an Effective Tool for Pre-Clinical Drug Development in Chronic Lymphocytic Leukemia. (2005) (3)
Functional Interaction of Mir-155, a Pro-Inflammatory microRNA, and Quaking in the Innate Immune Response (2015) (3)
Localization of the structural locus for cytoplasmic glutamic-oxaloacetic transaminase to region q24 leads to qter of human chromosome 10. (1976) (3)
MicroRNA Dysregulation to Identify Novel Therapeutic Targets. (2017) (3)
Chromosome translocations in B and T cell neoplasias. (1986) (3)
Inhibition of tumor growth and induction of apoptosis by adeno associated virus mediated fragile histidine triade (FHIT) gene overexpression in pancreatic cancer cell lines (2000) (3)
Assignment of the integrated SV40 DNA to human chromosome 7 in a SV40-transformed human cell line. (1976) (3)
Human T cell hybridomas with tetanus-toxoid-specific helper activity. (1982) (3)
A novel t(9;11)(p22;q23) with ALL-1 gene rearrangement associated with progression of a myeloproliferative disorder to acute myeloid leukemia. (1995) (3)
Chromosomal translocations, oncogenes, and B-cell tumors. (1985) (3)
Proteomic, Gene Expression, and Micro-RNA Analysis Of Bone Marrow Mesenchymal Stromal Cells In Acute Myeloid Leukemia Identifies Pro-Inflammatory, Pro-Survival Signatures In Vitro and In Vivo (2013) (3)
Expression of MicroRNA (miR) miR-15a/miR-16-1 Downregulates Expression of BCL-2 Protein in Chronic Lymphocytic Leukemia. (2006) (3)
hMSH 5 : A Human MutS Homologue That Forms a Novel Heterodimer with hMSH 4 and Is Expressed during Spermatogenesis 1 (1999) (3)
Oncogenes and signal transduction. (1993) (3)
Small Non-Coding RNAs in Leukemia (2022) (3)
Lineage-Specific Expression and Functional Relevance of MicroRNA Genes in Normal Hematopoiesis. (2005) (3)
Lung adenocarcinoma microRNA-31 expression levels to predict lymph node metastasis and patient survival. (2013) (3)
Erratum: miR-29 acts as a decoy in sarcomas to protect the tumor suppressor A20 mRNA from degradation by HuR (Science Signaling (2013) 6 (er6)) (2013) (3)
Ectopic expression of PLC‐β2 in non‐invasive breast tumor cells plays a protective role against malignant progression and is correlated with the deregulation of miR‐146a (2019) (3)
Ninth annual Pezcoller Symposium: The biology of tumors. (1999) (3)
Predicting ROR1/BCL2 combination targeted therapy of small cell carcinoma of the lung (2021) (3)
Pancreas transplantation in selected type 2 diabetes mellitus recipients (2009) (3)
High-mobility-group A 1 ( HMGA 1 ) proteins downregulate the expression of the recombination activating gene 2 ( RAG 2 ) (2005) (3)
Constitutive Baff Signalling Plays a Key Role in CLL Development by Promoting Tumor Cell Survival (2008) (3)
ROBOTIC PANCREATECTOMIES : SHORT TERM RESULTS (2010) (3)
microRNA-135b promotes cancer progression acting as a downstream effector of oncogenic pathways in colon cancer (2013) (3)
Cytotoxic Activity of Histone Deacetylase Inhibitor ITF2357 on Burkitt’s Lymphoma Cell Lines Is Associated to Micro-RNA Modulation and Transglutaminase 2 Restoration. (2008) (3)
Oncogene Activation by Chromosome Translocation (1986) (3)
370: Micro-RNAS Profiling in Kidney and Bladder Cancers (2005) (3)
Associated with Early Stages of Melanoma Tumor Progression Molecular Cloning and Characterization of an Antigen Updated (2006) (3)
Bcl-2α Encodes a Novel Small Molecular Weight GTP Binding Protein (1990) (3)
Significance of MicroRNA control of bone formation and homeostasis (2010) (3)
Targeted ablation of the Wwox tumor suppressor leads to impaired steroidogenesis (2008) (2)
RISK FACTORS FOR CHRONIC PANCREAS REJECTION (2007) (2)
Effect of zinc supplementation on N -nitrosomethylbenzylamine-induced forestomach tumor development and progression in tumor suppressor-deﬁcient mouse strains (2011) (2)
ALL-I partial duplication in acute leukemia Oeukemogenesls/direct tandem dupcaon/trisomy) (2)
Oncogenes in normal and neoplastic lymphocytes (1987) (2)
Treated Cerebellar Neural Precursors − in Sonic Hedgehog Driven Medulloblastomas and Induced by N-myc − Hedgehog The miR-17 / 92 Polycistron Is Up-regulated in Sonic (2009) (2)
Prognostic and Biologic Significance of Transfer RNA-Derived Small RNAs (tsRNAs) Expression in Younger Adult Patients (Pts) with Cytogenetically Normal Acute Myeloid Leukemia (CN-AML) (2018) (2)
Kidney Transplantation: Challenging the Future (2018) (2)
Gene regulation in the expression of malignancy. (1985) (2)
Correction: CpG island hypermethylation-associated silencing of non-coding RNAs transcribed from ultraconserved regions in human cancer (2018) (2)
MicroRNA Signatures Associated with Cytogenetics and Outcome in Acute Myeloid Leukemia. (2006) (2)
Oncogenes in the initiation and progression of neoplasia (2003) (2)
The BCRs Expressed by Leukemia Cells from TCL1 Transgenic Mice Resemble Those of Unmutated B-CLL. (2005) (2)
Species-specific suppression of histone HI and H 2 B production in human / mouse hybrids ( cell regulation / histone genes / chromosome segregation / human fibrosarcoma ) (2)
Correction: MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer (2021) (2)
Dysregulated in Multiple Sclerosis Feedback Loop Controlling Th1 Bias That Is miR-29ab1 Deficiency Identifies a Negative (2012) (2)
Environmental, Genetic, and Viral Causes of Cancer (2008) (2)
P.123 MICRORNAS ARE DEREGULATED IN BARRETT'S CARCINOGENESIS (2010) (2)
Abstract 3050: MicroRNA expression profiling of human Barrett's carcinogenesis (2010) (2)
ZERO THROMBOSIS AFTER PANCREAS TRANSPLANTATION WITH COLD ISCHEMIA TIME BELOW 10 HOURS (2008) (2)
PANCREAS TRANSPLANTATION IN ELDERLY RECIPIENTS (2009) (2)
Abstract 3003: Immune cell-related microRNA-155 is associated with human liver cirrhosis and hepatocellular carcinoma (2010) (2)
MicroRNAs 17-5p/20a/106a Function as a Master Gene Complex Controlling Monocytopoiesis through AML1 Targeting. (2006) (2)
Anti-miR-135b in colon cancer treatment: Results from a preclinical study. (2012) (2)
Suppressive effects of phencyclidine on murine immune surveillance (1990) (2)
187 MicroRNA Expression Profiling of Human Barrett's Carcinogenesis (2010) (2)
RNA as a Therapeutic Molecule (2008) (2)
Hilary Koprowski (1916–2013): Vaccine pioneer, art lover, and scientific leader (2013) (2)
LYMPHOID NEOPLASIA Trisomy 12 chronic lymphocytic leukemia cells exhibit upregulation of integrin signaling that is modulated by NOTCH 1 mutations (2014) (2)
Aberrant PD-L1 Expression in CLL As a Result of Adaptive Immune Resistance Mediated By Tumor-Secreted Circulating miRNA Binding to Toll-like Receptor 7 (2014) (2)
A novel surface marker (B203.13) of human haemopoietic progenitors, preferentially expressed along the B and myeloid lineages (1998) (2)
CELL BIOLOGY AND SIGNALING (2010) (2)
Synergistic apoptotic effect of miR-183-5p and Polo-Like kinase 1 inhibitor NMS-P937 in breast cancer cells (2021) (2)
Chromosome alterations in oncogenesis. (1985) (2)
BAFF Accelerates Development of Chronic Lymphocytic Leukemia in TCL1 Transgenic Mice. (2007) (2)
MiR-146a up-Regulation Is Associated with Anti-Tumor Activity of Pan-Histone Deacetylase Inhibitor ITF2357 (Givinostat®) in Human Burkitt's Lymphoma (2011) (2)
Translocation 11;14 in newly diagnosed chronic myelogenous leukemia. (1995) (2)
FIVE YEAR ACTUAL SURVIVAL FOLLOWING EXTENDED OR STANDARD LYMPHATIC CLEARANCE IN CANCER OF THE HEAD OF THE PANCREAS (2004) (1)
An Integrated Approach Identi ﬁ es Mediators of Local Recurrence in Head and Neck Squamous Carcinoma (2017) (1)
Retraction Note: EGFR and MET receptor tyrosine kinase–altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers (2022) (1)
BRCA 15083 del 19 Mutant Allele Selectively UpRegulates Periostin Expression In vitro and In vivo (2008) (1)
Microrna-150 Regulates STAT5b Levels in Juvenile Myelomonocytic Leukemia (JMML) (2015) (1)
Chromosome Translocations and Human Cancer1 (2006) (1)
A large fraction of trisomy 12, 17p−, and 11q− CLL cases carry unidentified microdeletions of miR-15a/16-1 (2022) (1)
Micro-RNAs as minimally invasive biomarkers for diagnosis, staging and outcome prediction in prostate cancer patients (2020) (1)
MicroRNA-199 modulates hyperalgesia via TRPV1 dependent pathways (2012) (1)
Ultraconserved Genomic Regions (UCRs) Expression in Hematopoiesis (2008) (1)
Retraction notice to “Expression of a truncated Hmga1b gene induces gigantism, lipomatosis and B-cell lymphomas in mice” [Eur J Cancer 47 (2011) 470–478]. (2015) (1)
The Nature of the Antigen Determines Leukemia Development and Behavior in the Eμ-TCL1 Transgenic Mouse Model of CLL (2012) (1)
Endogenous and artificial miRNAs explore a rich variety of conformations: a potential relationship between secondary structure and biological functionality (2020) (1)
Corrigendum: EGFR and MET receptor tyrosine kinase–altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers (Nature Medicine, (2012), 18, 1, (74-82), 10.1038/nm.2577) (2014) (1)
Abstract C23: MicroRNA-106b targets caspase-7 and is associated with recurrence in human prostate cancer (2012) (1)
Region at 11 q 23 . 3 of Heterozygosity in Breast Cancer : Identification of a New Definition and Refinement of Chromosome 11 Regions of Loss Updated (2006) (1)
Abstract LB-106: A novel TCL1-Tg:p53−/− mouse model of human CLL (2012) (1)
MicroRNAs in T cell acute lymphoblastic leukemia (2007) (1)
Myelodysplastic Syndromes (MDS) Display a Risk and Senescence-Dependent MicroRNA (miRNA) Signature. (2006) (1)
Abstract 401: CD5+CD23+ leukemic cell populations in Tcl1 transgenic mice show significantly increased proliferation and Akt phosphorylation (2010) (1)
Crystal Structure of Murine Tcl1 Oncoprotein and Conserved Surface Features of the Molecules of the Tcl1 Family (2002) (1)
Abstract 3514: RANBP9 presence affects levels of Tip60 and activated p53 in lung cancer cells in response to DNA damage (2019) (1)
The molecular genetics of human T cell leukemias and lymphomas. (1986) (1)
A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis (2021) (1)
Abstract 1070: miR-579-3p is a novel master regulator of melanoma progression and drug resistance in metastatic melanoma (2016) (1)
Abstract 1950: Suppression of RISC-independent decoy and RISC-mediated RNA-pairing activities of microRNA-328 is required for maturation-arrest and enhanced survival of blast crisis CML progenitors (2010) (1)
Abstract 473: miR-135b mediates gemcitabine sensitivity in breast cancer cells by modulating epithelial-to-mesenchymal transition and mTOR-signaling (2018) (1)
Oncogenes and Mammary Carcinogenesis (1999) (1)
BCL-2 alpha encodes a novel small molecular weight GTP binding protein. (1990) (1)
MicroRNA regulation of tumorigenesis, cancer progression and interpatient heterogeneity: towards clinical use (2014) (1)
B-Cell Lymphoma In Eu-Mir-17~92 Transgenic Mice (2010) (1)
Abstract IA05: Novel function of microRNAs. (2015) (1)
Abstract 3021: MicroRNA expression profile of CT screening detected lung cancer (2010) (1)
Correction: MiR-34a/c-Dependent PDGFR-α/β Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer (2022) (1)
PD-022FOLFOXIRI as primary treatment for locally advanced unresectable pancreatic cancer (LAPC): a prospective study (2016) (1)
The controversial role of adjuvant therapy in node negative invasive IPMN (2020) (1)
CHRONIC REJECTION IN PANCREAS TRANSPLANTATION: ANALYSIS OF RISK FACTORS. (2008) (1)
Influence of a nonfragile FHIT transgene on murine tumor susceptibility (2007) (1)
[Living donor kidney transplant: the crossover modality]. (2009) (1)
Editorial: Bioinformatics of Non-Coding RNAs with Applications to Biomedicine: Recent Advances and Open Challenges (2015) (1)
PATIENTS AGED 50 YEARS OR MORE AS RECIPIENTS FOR PANCREAS TRANSPLANTATION (2009) (1)
PANCREAS TRANSPLANTATION IN RECIPIENTS AGED 50 YEARS OR MORE. (2009) (1)
PANCREATIC METASTASES FROM RENAL CARCINOMA (2005) (1)
Abstract 476: A human scFv as a tool to understand the biogenesis of a subset of oncogenic microRNAs (2018) (1)
TRANSLATIONAL — BILIARY MIR 21 Drives Resistance to Heat Shock Protein 90 Inhibition in Cholangiocarcinoma (2018) (1)
CENTRAL PANCREATECTOMY WITH INFRAMESOCOLIC INTRAPERITONEAL PANCREATOJEJUNOSTOMY (2010) (1)
leukemia Minimal region of loss at 13 q 14 in B-cell chronic lymphocytic (2002) (1)
LZTS1 (leucine zipper, putative tumor suppressor 1) (2012) (1)
Non-isotopic single strand conformation polymorphism analysis (SSCP) to detect mutations in the RB gene (1992) (1)
Transcriptome Analysis of Human Endogenous Retroviruses at Locus-Specific Resolution in Non-Small Cell Lung Cancer (2022) (1)
Chapter 57 – RNA as a Therapeutic Molecule (2008) (1)
Germ line configuration of the BCL-2 major breakpoint region in hyperplastic lymph nodes. (1991) (1)
Abstract 1178: Involvement of MEG3, a long non-coding RNA, in hepatocellular cancer (HCC) (2011) (1)
Molecular genetics of B- and T-cell neoplasia. (1986) (1)
Restored expression of Fhit protein in Fhit-minus breast cancer cells (2001) (1)
Phyllis Jean McAlpine, Ph.D, FCCMG (1999) (1)
Micrornas in human cancers (2017) (1)
Alfred G. Knudson (1922–2016) (2016) (1)
MicroRNA expression profiling of human metastatic cancers (2008) (1)
PDCD1 (PD-1) is a direct target of miR-15a-5p and miR-16-5p (2022) (1)
Influence of cortisone and cyclophosphamide on xanthine oxidase bacterial activation. (1977) (1)
In vitro andin vivo impact of a new glycosphingolipid on neutrophils (1994) (1)
Cloning and Characterization of CLLD 6 , CLLD 7 , and CLLD 8 , Novel Candidate Genes for Leukemogenesis at Chromosome 13 q 14 , a Region Commonly Deleted in B-Cell Chronic Lymphocytic Leukemia 1 (2001) (1)
Consensus report of the 8 and 9th Weinman Symposia on Gene x Environment Interaction in carcinogenesis: novel opportunities for precision medicine (2018) (1)
Studies on the association of the Epstein-Barr virus genome with chromosomes in human (Burkitt)/mouse hybrid cells. (1978) (1)
Abstract 140: Tumor suppressor role of microRNA-1 in prostate cancer (2011) (1)
A concurrent canonical and modified miRNAome pan-cancer study on TCGA and TARGET cohorts leads to an enhanced resolution in cancer (2021) (1)
Abstract LB-289: Interaction between miR-155 and Quaking in the innate immune response and leukemia (2015) (1)
miRNA profile and advanced stage endometrial cancer (2008) (1)
Chapter 10 Enucleation of Somatic Cells with Cytochalasin B (1974) (1)
Advances in Brief Fez 1 / Lzts 1 Alterations in Gastric Carcinoma 1 (2001) (1)
Expression of the malignant phenotype in hybrids between mouse peritoneal macrophages and SV40-transformed human cells containing only human chromosome 7. (1976) (1)
MicroRNA profiling of blastic plasmacytoid dendritic cell neoplasm and myeloid sarcoma (2020) (1)
More clues to gene rearrangements (1987) (1)
Segregation of rat chromosomes in somatic cell hybrids between rat cells and HT 1080 human fibrosarcoma cells (2004) (1)
Corrigendum to “The high mobility group A proteins contribute to thyroid cell transformation by regulating miR‐603 and miR‐10b expression” [Mol. Oncol. 7 (3) (Jan. 2013) 531–542] (2014) (1)
EBV Induced miR-155 Attenuates NF- B Signaling And Stabilizes Latent Virus Persistence (2008) (1)
Assignment of the genes for mitochondrial malate dehydrogenase and for SV40 T-antigen to human chromosome 7. (1976) (1)
Exosomes Mediate Communication Between the Microenvironment and Leukemic Cells in Acute Myeloid Leukemia (2012) (1)
Editorial: Novel Drugs Targeting the Microenvironment and the Epigenetic Changes in Hematopoietic Malignancies (2020) (1)
Production of Interspecies Hybridomas Between CSF or Blood Lymphocytes from Patients with Neurological Diseases and Mouse Myeloma Cells (1980) (1)
Role of the miR-301a/Fra-2/GLIPR1 axis in lung cancer cisplatin resistance (2023) (1)
Chromosome sublocalization of a cDNA for human DNA polymerase-beta to 8p11----p12. (1988) (1)
Keynote Lecture MiRNAs and Cancer (2009) (1)
Micro-RNA-21 and micro-RNA-155 as predictors of a malignant phenotype in melanocytic lesions (2008) (1)
Selective enrichment in human megakaryocyte progenitors by the B203.13 surface differentiation antigen (1997) (1)
Assignment of the integrated SV40 DNA to human chromosome 7 in a SV40-transformed human cell line. (1976) (1)
Genes and Viruses Able to Transform Hematopoietic Cells Group Report (1985) (1)
CRYSTAL STRUCTURE OF MTCP-1 INVOLVED IN T CELL MALIGNANCIES (1998) (1)
Enucleation of somatic cells with cytochalasin B. (1974) (1)
Molecular genetics of human leukemias and lymphomas. (1987) (1)
Abstract 3126: Survival in glioblastoma cancer patients is predicted by miR-340, that regulates key cancer hallmarks by inhibiting NRAS (2015) (1)
MicroRNA (miRNA)-29b Targets DNMT3A and B and Induces Re-Expression of the Hypermethylated ESR1 and p15 Genes in Acute Myeloid Leukemia (AML). (2007) (1)
Abstract LB-244: MiR-34a/c-dependent PDGFR-α/β reduction inhibits tumorigenesis and sensitizes TRAIL-induced apoptosis in lung cancer. (2013) (0)
Control of apoptosis by using small molecule regulators of Bcl-2 family proteins (2002) (0)
Abstract 3974: A preclinical study for miR181b as therapeutic in Eu-TCL1FL-tg mouse model for CLL (2015) (0)
Abstract 2543: Concurrent profiling of canonical and modified miRNAomes from TCGA and TARGET cohorts leads to enhanced resolution in cancer (2020) (0)
Ultraconserved non-coding RNA expression profiles in human prostate cancer (2008) (0)
Tissue and exosomal miRNA editing in Non-Small Cell Lung Cancer (2018) (0)
microRNA-based methods for diagnosis of pancreatic cancer (2007) (0)
Oncogene expression in Burkitt's lymphoma. (1984) (0)
MIR-103-2 for the diagnosis of colon adenocarcinoma with poor survival prognosis (2007) (0)
Characterization of a Fhit protein complex suggests a novel pathway to apoptosis of cancer cells (2007) (0)
Effect of the ultraconserved noncoding RNA uc.338 on cellular growth of hepatocarcinoma. (2011) (0)
Common fragile sites and genomic instability (2013) (0)
P47.10 Predicting ROR1/BCL2 Combination Targeted Therapy of Small Cell Carcinoma of the Lung (2021) (0)
Tumour predisposition and cancer syndromes as models to study gene–environment interactions (2020) (0)
Epitranscriptomics: The Novel RNA Frontier (2019) (0)
CRYSTAL STRUCTURE OF THE C. ELEGANS NITFHIT PROTEIN (2000) (0)
Src homology 2 domain–containing inositol-5-phosphatase and CCAAT enhancer-binding protein (cid:2) are targeted by miR-155 in B cells of E (cid:3) - MiR-155 transgenic mice accumulation of large pre-B and (2016) (0)
Transcriptional activation of the translocated c-mnc oncogene in Burkitt lymphoma ( chromosome translocations / oncogene activation / human B cell neoplasia ) (0)
Abstract 1162: MicroRNA expression profiles of tumors, normal lung tissues and plasma samples from spiral-computed tomography (CT) trial for early lung cancer detection (2011) (0)
Retraction Notice to: Downregulation of p53-inducible microRNAs 192, 194, and 215 Impairs the p53/MDM2 Autoregulatory Loop in Multiple Myeloma Development. (2022) (0)
Abstract 3083: Global gene expression profiling of mice tumor-derived organoids identifies key microRNAs and metabolic genes involved in CRC progression (2015) (0)
A large scale expression study associates uc.283-plus lncRNA with pluripotent stem cells and human glioma (2014) (0)
microRNA-based diagnostic of prostate cancer or stomach cancers methods (2007) (0)
microRNA-based methods for diagnosis of stomach cancers (2007) (0)
LYMPHOID NEOPLASIA MicroRNA-155 in ﬂ uences B-cell receptor signaling and associates with aggressive disease in chronic lymphocytic leukemia (2014) (0)
The hsa-let-7a miRNA Enhances Ara-C Induced Apoptosis in Human Acute Myeloid Leukemia Cells (2012) (0)
Prostate specific antigen gene expression in ovarian cancer post-liver transplantation (1995) (0)
Linkage of the genes for thymidine kinase and galactokinase in the Africian green monkey and the chimpanzee. (1976) (0)
P2.02-065 RanBP9 is a Novel Prognostic and Predictive Biomarker for NSCLC and Affects Cellular Response to Cisplatin and PARP Inhibitors (2017) (0)
EXTH-31. RNA NANOPARTICLE-BASED TARGETED GENE THERAPY FOR GLIOBLASTOMA (2017) (0)
MIR-29A for the diagnosis of colon adenocarcinoma with poor prognosis for survival (2007) (0)
Using the miR-26 family as a predictive marker of hepatocellular carcinoma and sensitivity to therapy (2009) (0)
Renato Baserga, MD: In Memoriam (1925–2023) (2023) (0)
Immunoglobulin genes, oncogenes, and human B-cell tumors (1985) (0)
MicroRNA Expression Profiling of CLL B Cells From Relapsed/Refractory CLL Patients Reveals a Signature Group of Genes That Are Associated with Clinical Responses: Results of An ECOG Trial E2903. (2009) (0)
Abstract LB-241: Silencing of microRNA-31 prevents esophageal neoplasia in zinc deficient rats. (2013) (0)
Abstract 276: Role of AP1 elements and TCL1 protein in regulation of the gene encoding PTPROt (protein tyrosine phosphatase receptor-type O) in chronic lymphocytic leukemia (2011) (0)
development tool for human chronic lymphocytic leukemia Characterization of the TCL-1 transgenic mouse as a preclinical drug (2013) (0)
Correction to: Fhit modulation of the Akt-survivin pathway in lung cancer cells: Fhit-tyrosine 114 (Y114) is essential (2022) (0)
Allograft Rejection in Pancreas Transplantation: Evaluation of Color Doppler Ultrasound’s Diagnostic Role Based on 41 Graft Biopsies (2008) (0)
OUTCOME OF PANCREAS TRANSPLANTS WITH A MINIMUM FOLLOW-UP OF 5 YEARS (2008) (0)
Purification and characterization of a protein inducible by mitogens and immunologically related to the c-myc gene product (1986) (0)
[Evaluation of the chorionic gonadotropin level, determined by the immunological method, in the prognosis of threatened abortion]. (1976) (0)
A SINGLE INSTITUTION EXPERIENCE WITH PANCREATECTOMIES ASSOCIATED TO VASCULAR RESECTION. (2004) (0)
"Human myeloma cell line and process for manufacturing a hybrid cell-line" (1981) (0)
ABSENCE OF THROMBOSIS FOLLOWING PANCREAS TRANSPLANTATION: IT CAN BE POSSIBLE:81 (2008) (0)
PANCREAS TRANSPLANTATION ALONE IN TYPE 1 DIABETIC RECIPIENTS: SAFETY AND LONG-TERM EFFICACY (2010) (0)
SURGICAL COMPLICATIONS IN PANCREAS TRANSPLANTATION EFFECTS ON SURVIVAL OF PORTAL vs SYSTEMIC DRAINAGE (2005) (0)
[Current criteria for classification on a histogenetic basis of tumors of the ovary]. (1974) (0)
[Modern views on the physiopathology of the foetal thyroid]. (1972) (0)
PANCREAS TRANSPLANTATION FROM DONORS AGED 45 YEARS OR MORE (2004) (0)
A Retrospective Analysis of 248 Consecutive Distal Pancreatectomies (2007) (0)
A Transgenic Mouse Model of Aggressive B-Cell Malignancy for Evaluating Anti-Human CD37 Therapeutics (2012) (0)
[Notes on the aetiopathogenesis, clinical picture and treatment of rupture of the uterus during labour. Apropos of a case]. (1972) (0)
HIGH C-PEPTIDE LEVELS IN CANDIDATES TO PANCREAS TRANSPLANTATION (2009) (0)
ASO Author Reflections: Which Patients with Invasive Intraductal Papillary Mucinous Neoplasm Can Benefit from Adjuvant Therapy? (2020) (0)
Abstract C171: Human anti-Nucleolin recombinant immunoagents as new potential tools for melanoma treatment (2015) (0)
LIVE DONOR KIDNEY TRANSPLANTATION FOLLOWING EXTRACORPOREAL REPAIR OF RENAL ARTERY ANEURYMS (2008) (0)
Robotic Pancreatectomies: Early Experience in a High Volume Center (2008) (0)
Gene-expression profiling of collecting duct carcinoma of the kidney. (2016) (0)
Thoracic Trauma (2020) (0)
Surgical technique video description of retroperitoneal placement of pancreas graft with portal-enteric drainage (2009) (0)
Surgical Treatment of Neuroendocrine Tumors of the Pancreas: Results and Prognostic Factors (2008) (0)
Long-term (4 years) efficacy and safety of pancreas transplantation alone in type 1 diabetic patients (2010) (0)
VASCULAR RESECTION DURING PANCREATECTOMIES (2006) (0)
Role of miRNAs in the Pathogenesis of Chronic Lymphocytic Leukemia (2013) (0)
AVOIDING GRAFT THROMBOSIS FOLLOWING PANCREAS TRANSPLANTATION. (2009) (0)
SAFETY AND EFFICACY OF PANCREAS TRANSPLANTATION ALONE IN TYPE 1 DIABETIC PATIENTS: EFFECTS ON METABOLIC PARAMETERS AND LATE DIABETES COMPLICATIONS (2004) (0)
BIOINFORMATICS Identiﬁcation of microRNA activity by Targets’ Reverse EXpression (2009) (0)
PANCREATIC STUMP MANAGEMENT AFTER PANCREATICODUODENECTOMY (2004) (0)
PANCREAS TRANSPLANTATION IN PATIENTS WITH HIGH C-PEPTIDE LEVELS (2009) (0)
KIDNEY TRANSPLANTATION FROM DONORS OLDER THAN 65 YEARS (2003) (0)
Fhit–Fdxr interaction in the mitochondria: modulation of reactive oxygen species generation and apoptosis in cancer cells (2019) (0)
PORTAL ENTERIC DRAINED SOLITARY PANCREAS TRANSPLANTATION WITHOUT SURVEILLANCE BIOPSY: 1S IT SAFE?: 032 (2003) (0)
malignancies B activation in hematologic κ Tcl1 interacts with Atm and enhances NF (2012) (0)
LOW SURGICAL RISK OF PANCREAS TRANSPLANTATION (2001) (0)
Abstract 1351: Analysis of the in vivo tumor suppressive potential of PTPROt (truncated protein tyrosine phosphatase receptor-type O) in CLL using a transgenic mouse model (2012) (0)
PANCREATIC STUMP MANAGEMENT DURING PANCREATICODUODENECTOMY (2006) (0)
A validated ultrasensitive hybridization-ELISA assay for synthetic microRNAs in mouse plasma and human leukemia cells and its mouse pharmacokinetics (2008) (0)
PORTAL-ENTERIC OR SYSTEMIC-ENTERIC DRAINAGE FOR RETROPERITONEAL PANCREAS TRANSPLANTATION (2009) (0)
SINGLE CENTER, OPEN, PROSPECTIVE, RAN˜OMIZE˜, PILOT STUbY COMPARING CYCLOSPORINE VERSUS TACROLIMUS IN SIMULTANEOUS PANCREAS‐KIbNEY TRANSPLANTATION: 055 (2003) (0)
FOXP 1 to Enhance Glioblastoma Tumorigenicity Suppression of MicroRNA-9 by Mutant EGFR Signaling Upregulates (2014) (0)
A THIRTEEN YEAR EXPERIENCE WITH PANCREATECTOMY ASSOCIATED TO VASCULAR RESECTION (2000) (0)
IMPLICATION OF VENOUS DRAINAGE IN SIMULTANEOUS PANCREAS-KIDNEY TRANSPLANTATION (2006) (0)
Surgical Techniques of Living Donor Nephrectomy (2012) (0)
THE IMPACT OF AGE ON THE OUTCOME OF PANCREATECTOMIES (2004) (0)
PORTAL THROMBOSIS:WHERE IS THE POINT OF NO RETURN? (2007) (0)
48 Inflammation-Induced microRNAs in B-cell lymphoma (2008) (0)
PANCREATECTOMIES ASSOCIATED TO VASCULAR RESECTION FOR DUCTAL ADENOCARCINOMA OF THE PANCREAS: A SINGLE INSTITUTION EXPERIENCE (2009) (0)
Advances in Brief Expression of the Prostate-specific Antigen Gene by a Primary Ovarian Carcinoma 1 (2006) (0)
Mesenchymal Stromal Cells From AML Bone Marrow Are Abnormal by Gene Expression Profiling. (2010) (0)
Use of microRNA signature to predict patient sensitivity to dendritic cell vaccination in metastatic melanoma. (2011) (0)
Crystal Structure of Murine Tcl1 at 2.5 Resolution (2001) (0)
Abstract 975: MicroRNA-155 In chronic lymphocytic leukemia influences B-cell receptor signaling (2014) (0)
RIGETTO DEL PANCREAS TRAPIANTATO: ANALISI DEL RUOLO DIAGNOSTICO DELL’ECO-COLOR-DOPPLER BASATO SU 45 BIOPSIE DEL GRAFT (2008) (0)
The Expression of the GTPase-Deficient, Hematopoietic-Specific RhoH GTPase Is Implicated in Development of Chronic Lymphocytic Leukemia (CLL). (2007) (0)
Association between serum osteocalcin and insulin sensitivity in primary hyperparathyroidism (2010) (0)
13 INVITED Causes and Consequences of microRNA Dysregulation (2011) (0)
Adjuvant gemcitabine and concurrent radiotherapy in operable patients with advanced pancreatic adenocarcinoma: a phase II study (2005) (0)
A MicroRNA Signature of Hypoxia† (cid:1) (2007) (0)
Retinoblastoma protein interacts with and modulates the transcriptional activity of the tal-l/E2A/Lmo2 complex in differentiating erythroid precursors (1997) (0)
ROLE OF PANCREAS GRAFT BIOPSIES FOLLOWING PANCREAS TRANSPLANTATION (2009) (0)
EXTH-33. OS2966 DRAMATICALLY ENHANCES PRECLINICAL EFFICACY OF ONCOLYTIC VIRUS THERAPY (2016) (0)
ALLOGRAFT REJECTION IN PANCREAS TRANSPLANTATION: ANALYSIS OF DIAGNOSTCI ROLE OF COLOR DOPPLER ULTRASOUND BASED ON 57 GRAFT BIOPSIES (2010) (0)
RETROPERITONEAL PLACEMENT OF PANCREAS GRAFT WITH PORTAL-ENTERIC DRAINAGE: 667 (2008) (0)
LONG TERM RESULTS OF PANCREAS TRNSPLANTATION. (2008) (0)
Abstract SY32-01: The new genetics and treatment of CLL (2017) (0)
127 Localization of the human P10 finger gene on a chromosomal region (3p21) deleted in human lung cancers (1989) (0)
RETROPERITONEAL PANCREAS TRANSPLANTATION WITH PORTAL-ENTERIC OR SYSTEMIC-ENTERIC DRAINAGE (2009) (0)
INTERACTION BETWEEN THE INSULIN-LIKE GROWTH FACTOR 1 RECEPTOR AND PDK 1 AS POTENTIAL THERAPEUTIC TARGET IN NEOPLASTIC CELLS ” (2007) (0)
Wait and See: the Actual Clinical Approach to Branch Duct IPMN (2008) (0)
138 PANCREATECTOMIES ASSOCIATED WITH VASCULAR RESECTION (2006) (0)
[A personal case of intracavitary fibroleiomyoma]. (1976) (0)
Surgically Treated IPMN of the Pancreas: A Single Institution Experience (2008) (0)
3 – CELL FUSION IN GENETIC ANALYSIS (1977) (0)
PANCREAS TRANSPLANTATION FROM DONORS PLANNED FOR CONCURRENT PROCUREMENT OF FIVE ABDOMINAL GRAFTS TO BE TRANSPLANTED TO DIFFERENT RECIPIENTS (2004) (0)
CALCINEURIN INHIBITOR FREE IMMUNOSUPPRESSION IN KIDNEY TRANSPLANTATION FROM VERY ELDERLY DONORS. (2006) (0)
Predictors of bone mineral density in men with primary hyperparathyroidism (2007) (0)
UNIVERSITY OF WISCONSIN VS CELSIOR SOLUTION IN CLINICAL PANCREAS TRANSPLANTATION (2004) (0)
Pancreatectomies Associated to Vascular Resections: Report of 181 Cases (2008) (0)
PANCREAS TRANSPLANT ALONE IN TYPE 1 DIABETIC RECIPIENTS WITH OVERT DIABETIC NEPHROPATHY: RENAL FUNCTION OUTCOME: 2378 (2010) (0)
INTERVENTIONAL ULTRASOUNDS IN PANCREAS TRANSPLANTATION: SINGLE CENTER EXPERIENCE (2008) (0)
Genetics of B-cell neoplasia (1985) (0)
Treatment of Chronic Lymphocytic Leukemia Patients with Lenalidomide Induces Down-Regulation of miR342-3p Associated with Over-Expression of Tumor Suppressor RASSF4, (2011) (0)
TGAAATGCAGTGGTCGTTACGC TCCACC AAGAAAGCAGGAACC TGTGGTATGAA CAAATCAA CTTATGTGT TGACC TTTAGAGAGTTGC TTACGTGGCC TGTTCAACACAGACCCACCC AGAGCCC TCC TGCCC TCC TTCCGCGGGGGC T TTC TC AGGC TGTCC TTC AGGGTC TTCCTGAAATGC AGTGG TCGTT CGC ACCAAGAAAGCAGGAAC TGGTATGAA CGAATCAACTTATGTGTTGAC TTAGAGAG TGCTTAC TGGCCTGTT (0)
GABEXATE MESILATE INFUSION PREVENTS PANCREATIC GRAFT DAMAGE AFTER PANCREAS TRANSPLANTATION. (2010) (0)
Phosphorylation Of GSK3β Is Associated With Inferior Survival In Acute Myeloid Leukemia and Is An Indicator Of AKT Activation In AML Blasts and Bone Marrow Mesenchymal Stem Cells (2013) (0)
Data on cytogenetic registers (1976) (0)
Abstract 2087: miR-483-3p is an oncogene involved in nephroblastoma and in adult tumors with activated β-catenin (2010) (0)
A SINGLE CENTER, OPEN, PROSPECTIVE, RANDOMIZED COMPARISON OF CYCLOSPORINE VERSUS TACROLIMUS IN SIMULTANEOUS PANCREAS-KIDNEY TRANSPLANTATION (2003) (0)
LE DUODENOCEFALOPANCREASECTOMIE PALLIATIVE (2001) (0)
Gene Involved in Acute Leukemia ALL-1 Sequence Analysis of the Breakpoint Cluster Region in the Updated Version (2006) (0)
NON-RELATED LIVING DONOR HORSESHOE KIDNEY TRANSPLANTATION: 671 (2008) (0)
Abstract B62: Zinc supplementation reduces forestomach tumor burden in N-nitrosomethylbenzylamine-treated mice (2010) (0)
A NEW TECHNIQUE FOR PANCREAS TRANSPLANTATION WITH PORTAL-ENTERIC DRAINAGE (2004) (0)
Chromosome Translocations and Oncogene Activation in Burkitt Lymphoma (1984) (0)
ROLE OF VENOUS DRAINAGE IN PANCREAS TRANSPLANTATION ALONE (2006) (0)
INTERVENTIONAL ULTRASOUND-GUIDED PROCEDURES IN PANCREAS TRANSPLANTATION: SINGLE CENTER EXPERIENCE (2010) (0)
MINIMIZING WARM ISCHEMIA TIME IN LAPAROSCOPIC LIVING DONOR NEPHRECTOMY (2002) (0)
Surgical complications following retroperitoneal pancres transplantation with portal venous drainage. (2005) (0)
Gene Expression Profiling Identifies Similar CD4+ and CD8+ T Cell Defects in TCL1 Transgenic Mice after Development of CLL to Those Observed in Patients with CLL. (2004) (0)
A CRITICAL APPRAISAL OF PANCREATECTOMY ASSOCIATED TO VASCULAR RESECTION (2001) (0)
113 PANCREATECTOMIES ASSOCIATED TO VASCULAR RESECTION (2003) (0)
PROCUREMENT OF PANCREAS, SMALL BOWEL AND LIVER FROM THE SAME CADAVERIC DONOR (2001) (0)
ROBOTIC CYST-JEJUNOSTOMY (AND CHOLECYSTECTOMY) FOR THE TREATMENT OF PANCREATIC PSEUDOCYSTS: A CASE REPORT (2009) (0)
[Psychological aspects of sexual behaviour in the female]. (1973) (0)
REDUCTION OF SURGICAL COMPLICATIONS RATE IN PANCREAS TRANSPLANTATION (2006) (0)
[Modern views concerning the part played by herpes simplex type 2 virus in the pathogenesis of cancer of the cervix]. (1973) (0)
[Behavior of the blood vessels of the vocal cords after resection of the laryngeal nerves]. (1962) (0)
Zero thrombosis following pancreas transplantation with cold ischemia time below 10 hours (2008) (0)
Tcl-1 Inhibits Nuclear Export of TR3 and Is Highly Expressed in ZAP70-Positive CLL B-Cells. (2004) (0)
Ectopic Spleens in the Tail of the Pancreas Mimicking Multifocal Neuroendocrine Tumors in a Patient with History of Endocrine Neoplasia. A Case Report (2007) (0)
SOLITARY PANCREAS TRANSPLANTATION (2003) (0)
ROLE OF VENOUS DRAINAGE IN SIMULTANEOUS PANCREAS-KIDNEY TRANSPLANTATION (2006) (0)
The use of VNTRs to analyze polymorphisms in families with retino-blastoma (1992) (0)
PANCREATECTOMIES ASSOCIATED TO VASCULAR RESECTION (PVR): A SINGLE INSTITUTION EXPERIENCE (2011) (0)
SINGLE PORT SIMULTANEOUS LAPAROSCOPIC CHOLECISTECTOMY AND LEFT ADRENALECTOMY (2009) (0)
LONG-TERM EFFICACY AND SAFETY OF PANCREAS TRANSPLANTATION ALONE IN TYPE ONE DIABETIC RECIPIENTS (2009) (0)
Natural history of invasive intraductal papillary mucinous neoplasms (IPMNs) of the pancreas compared with sporadic pancreatic adenocarcinoma (PDAC) (2010) (0)
Retraction: The role of microRNAs in the tumorigenesis of ovarian cancer (2020) (0)
UNIVERSITY OF WISCONSIN vs. CELSIOR SOLUTION IN PANCREAS PRESERVATION: A PROSPECTIVE RANDOMIZED STUDY (2003) (0)
543 Analysis of FHIT gene alterations in primary tumours, bronchial mucosa biopsies and sputum specimens from lung cancer patients (1997) (0)
(myeloid leukemia/chromosome translocation/p53/in situ hybridization) (2016) (0)
INTESTINAL COMPLICATIONS OF PANCREAS TRANSPLANTATION: 728 (2010) (0)
PANCREAS TRANSPLANTATION WITH A MINIMUM FOLLOW-UP OF 5 YEARS (2007) (0)
Molecular genetics of human B cell neoplasia. (1986) (0)
Abstract 4719: The HDAC inhibitor ITF2357 blocks c-Myc expression via microRNA modulation and cap-dependent translation inhibition in human Burkitt's lymphoma (2012) (0)
Expression of human translocated c-myc genes into plasmacytoma cells (1986) (0)
Portal or systemic venous drainage in retroperitoneal pancreas transplantation with enteric exocrine excretion (2009) (0)
PANCREAS GRAFT BIOPSY FOLLOWING PANCREAS TRANSPLANTATION (2009) (0)
SOLITARY PANCREAS TRANSPLANTATION WITH PORTAL-ENTERIC DRAINAGE AND WITHOUT SURVEILLANCE BIOPSY (2003) (0)
Implications of venous drainage and immunosuppression induction on Pancreas Transplantation Alone (PTA). (2009) (0)
A TWENTY-TWO YEAR EXPERIENCE WITH PYLORUS PRESERVING PANCREATICODUODENECTOMY IN THE TREATMENT OF PANCREATIC AND PERIAMPULLARY TUMORS (2004) (0)
Intestinal Autotransplantation for Locally Advanced Pancreatic Cancer (2007) (0)
Outcome of Pancreas Transplant with a Minimum Follow-up of 5 Years (2008) (0)
BIOPSY IN PANCREAS TRANSPLANTATION: INDICATIONS, SAFETY PROFILE AND SUCCESS RATE (2009) (0)
NEORAL ® versus PROGRAF ® in simultaneous kidney-pancreas transplantation with portal-enteric drainage: 5-Year results of a single center, open, prospective, randomized, parallel groups, pilot study (2007) (0)
Adjuvant gemcitabine-based chemoradiation compared to gemcitabine alone following radical surgical resection for pancreatic ductal adenocarcinoma (PDAC): a retrospective analysis (2010) (0)
OUTCOME OF PANCREAS TRANSPLANTATION WITH 5 YEARS FOLLOW-UP OR MORE: 2312 (2010) (0)
RISK FACTORS AND RESCUE OF PORTAL THROMBOSIS IN PANCREAS TRANSPLANTATION (2008) (0)
Abstract #LB-289: Dietary zinc deficiency induces a proinflammatory gene signature in forestomach mucosa and predisposes COX-2 null mice to carcinogenesis (2009) (0)
THREE-YEAR PATIENT AND GRAFT SURVIVAL FOLLOWING PANCREAS TRANSPLANTATION ALONE WITH PORTAL-ENTERIC DRAINAGE (2005) (0)
Abstract 4174: Cxcl5 and Cxcl2 overexpression in esophageal carcinogenesis is associated with rapid tumor formation in zinc-deficient rats (2010) (0)
microRNAs in Cell Biology and Diseases (2008) (0)
Hybridomas revisited. (1980) (0)
Abstract 4711: Silencing of miR-221 with anti-microRNA oligonucleotides is an effective therapeutic for hepatocellular carcinoma (2011) (0)
Subject Index Vol. 86, 1999 (1999) (0)
neoplasms Molecular analysis of the BCL-3 locus at chromosome 17 q 22 in B-cell (2003) (0)
Associates with the Retinoblastoma Gene Product Bdp , a New Member of a Family of DNA-binding Proteins , Updated (1999) (0)
Localization ofthehumanJUNprotooncogene tochromosome region lp31-32 (2011) (0)
Composition based on stable continuous human myelomatic cell line and method for producing the same (1981) (0)
TCL1 transenic mouse model as a tool for the study of therapeutic targets and microenvironment in B-CLL (2016) (0)
Imaging , Diagnosis , Prognosis MicroRNA-31 Predicts the Presence of Lymph Node Metastases and Survival in Patients with Lung Adenocarcinoma (2013) (0)
The human ALL-1/MLL/HRX antigen is resting and proliferating peripheral blood mononuclear cells. (1999) (0)
Advances in Brief Cloning of the ALL . 1 Fusion Partner , the AF-6 Gene , Involved in Acute Myeloid Leukemias with the t ( 6 ; ll ) Chromosome (2007) (0)
Methods and compositions based microRNAs for diagnosis, prognosis and treatment of lung cancer (2007) (0)
Abstract 156: MicroRNA expression profiling of human esophageal metaplastic changes (2011) (0)
Tc11 enhances Akt kinase nuclear translocation (2016) (0)
Amplified CA and c-abl genes are on the same marker chromosome in K562 leukemia cells (1999) (0)
Immunotherapy Bridge 2016 and Melanoma Bridge 2016: meeting abstracts (2017) (0)
Defect in Acute Myeloid Leukemia with Trisomy 11 as a Recurrent Molecular ALL 1 Partial Tandem Duplication of Updated (2006) (0)
544 Abnormal structure, transcription and expression of the FHIT gene in lung cancer cell lines (1997) (0)
Frequent Causes for MicroRNAs Deregulation in Colorectal Cancer (2009) (0)
Activation ofMultiple GenesbyProvirus Integration intheMlvi-4 LocusinT-Cell Lymphomas Induced byMoloney Murine Leukemia Virus (1990) (0)
Multifaceted assessment of genetic alterations in oralcancer (1997) (0)
Abstract #1391: MiR-221&222 enhance migration and invasiveness of NSCLC and hepatocarcinoma cells by targeting PTEN tumor suppressor (2009) (0)
Molecular cloning of amplified gene sequences contained in double minutes (1981) (0)
Abstract P6-05-07: The effects of microRNA modulation of polo-like kinase 1 in breast cancer cell lines (2019) (0)
Deletion of Micro RNA-15/16 Clusters Promotes Leukemic Initiation in AML Via the Deregulation of Hematopoietic Progenitors (2022) (0)
Transcriptional Regulation of BRCA1 (2000) (0)
Abstract 6213: Extracellular vesiclesMDM2-DNA derived from dedifferentiated liposarcoma induces MMP2 production from preadipocytes (2020) (0)
Role of microRNAs in the pathogenesis of human cance (2009) (0)
Loss of miR-204 expression is a key event in melanoma (2018) (0)
Contents Vol. 118, 2007 (2007) (0)
Abstract 3061: Micro-RNA signature differences in lung cancer patients withALKtranslocation,EGFRmutations andKRASmutations. (2013) (0)
Effect of Environmental pH on Rescue of (Sendai virus fusion/mouse-monkey hybrids/hamster-mc (2016) (0)
A preliminary study of micro-RNAs as minimally invasive biomarkers for the diagnosis of prostate cancer patients (2021) (0)
Epstein-Barr Virus-Induced miR-155 Attenuates NF- (cid:2) B Signaling and Stabilizes Latent Virus Persistence (cid:1) (2008) (0)
GOK: A Gene at llplS Involved in Rhabdomyosarcoma and Rhabdoid Tumor Development1 (2006) (0)
LYMPHOID NEOPLASIA Mechanisms of PD-L1/PD-1 – mediated CD8 T-cell dysfunction in the context of aging-related immune defects in the E m -TCL1 CLL mouse model (2015) (0)
Homozygous mutations in the Fhit gene results in resistance to ionizing radiation and inhibition of apoptosis (2001) (0)
Methodes de detection des micrometastases du cancer de la prostate (1993) (0)
p53-Inducible Micrornas 192 and 215 Regulate p53 Expression and IGF1 Axis in Multiple Myeloma. (2009) (0)
The Murine F hit Locus: Isolation, Characterization, and Expression in Normal and Tumor Cells1 (2006) (0)
Molcular doning of a human immunoglobulin X chain variable sequence (0)
miRNA-mediated TUSC3 deficiency enhances UPR and ERAD to promote metastatic potential of NSCLC (2018) (0)
PHARMACOLOGICAL UNMASKING OF ABERRANTLY HYPERMETHYLATED miRNAs IN HUMAN CANCER METASTASIS (0)
Molecular genetics of human B cell neoplasia. (1986) (0)
MicroRNA-29 controls Th1 bias of CD4+ T cells in multiple sclerosis (167.5) (2011) (0)
MiR-181b expression levels decrease during the progression of Chronic Lymphocytic Leukemia: a new potential prognostic tool (2010) (0)
Analysis of Fhit expression in stages of breast cancer progression (2000) (0)
Abstract #2544: miR191 reprogrames gene expression to control invasiveness of breast cancer (2009) (0)
Cloning ofALL-1, the Locus Involved in Leukemias with the t(4;ll)(q21;q23), t(9;ll)(p22;q23), and t(ll;19)(q23;pl3) Chromosome Translocations1 (2006) (0)
Abstract LB-164: Ran Binding Protein 9 (RanBP9) is a novel mediator of cellular DNA damage response in lung cancer cells (2015) (0)
A NOVEL THERAPY FOR CASTRATION‐RESISTANT PROSTATE CANCER THROUGH INHIBITION OF ONCOGENIC MICRORNAS: MP83‐15 (2017) (0)
Depressed T-cell proliferation and polymorphonuclear superoxide anion production in mice treated with cocaine (1991) (0)
Xanthine oxidase activation in animal liver during infectious processes. Short communication. (1976) (0)
Human Genetic Mutant Cell Repository Index Vol. 18, 1977 (1977) (0)
MiR-221 and MiR-222 Patterns Characterize Burkitt Lymphoma in Human and Mouse Model (2012) (0)
Influence of cocaine on murine immune surveillance (1990) (0)
806 TRANSLOCATION BREAKPOINT MAPPING OF 9;22 ALL AND 806 8;22 BURKITT'S LYMPHOMA REVEALS DIFFERING BREAK-POINTS WITHIN 22q11 (1985) (0)
MicroRNA-218 and Wnt signaling regulatory loop promote osteoblast differentiation (2012) (0)
Suppression of RISC-Independent Decoy and RISC-Mediated mRNA Base-Pairing Activities of MicroRNA-328 Is Required for Differentiation-Arrest and Enhanced Survival of Blast Crisis CML Progenitors. (2009) (0)
Cocaine vs morphine: Differential inhibitory effects of natural killer cell activity in mice (1990) (0)
Suppression of Mir-93 May Regulate Anti-Oxidant Metabolism in Mesenchymal Stromal Cells Derived From Acute Myeloid Leukemia Patients. (2012) (0)
Methadone-related phagocytic depression (1985) (0)
Transcribed ultraconserved regions are aberrantly expressed and can be modulated by interleukin 6 in cholangiocarcinoma (2013) (0)
MicroRNA Expression Profiling of Human Esophageal Metaplastic Changes (2011) (0)
Effect of the ganglioside GM1P on immune surveillance of 60Co-irradiated mice (1988) (0)
Abstract 2185: DLEU7 is a putative tumor suppressor in glioblastoma (2011) (0)
Deregulated microRNAs in breast ductal carcinoma in situ (DCIS) with invasive propensity (2016) (0)
MiR-125b Cooperates with BCR-ABL and Enhances Therapy Resistance in Childhood Ph+ ALL (2011) (0)
Diagnostic methods for the detection of lymphoma in humans. (1987) (0)
Mapping the SV40 Integration Sites in SV40-Transformed Human Cells (1977) (0)
The Epstein-Barr Virus-Hybridoma Technique for Production of Human Monoclonal Antibodies (1988) (0)
Abstract B14: Anti-miR-135b in colon cancer treatment (2012) (0)
MiRNA profile in stage 1, surgically staged endometrial cancer and predicted downstream targets (2008) (0)
Abstract B64: Zinc supplementation has antitumor effects in 4-nitroquinoline 1-oxide-induced rat oral carcinogenesis (2010) (0)
CHAPTER 2 – Genetic Approaches to Enzyme Induction in Mammalian Cells and Hybrids in Culture (1975) (0)
Synergistic apoptotic effect of miR-183-5p and Polo-Like kinase 1 inhibitor NMS-P937 in breast cancer cells (2021) (0)
Diagnostic methods for evidence of lymphoma in humans. (1987) (0)
Abstract #5684: Amplification and over-expression of the miR-17-92 polycistron in the Sonic Hedgehog-driven subgroup of medulloblastoma (2009) (0)
MicroRNA Expression and Regulation of Hematopoiesis in CD34+ Cells: A Bioinformatic Circuit Diagram of the Hematopoietic Differentiation Control. (2006) (0)
SUBSTRATE ANALOG (IB2) COMPLEX WITH THE HIS 96 ASN SUBSTITUTION OF THE FRAGILE HISTIDINE TRIAD PROTEIN, FHIT (1998) (0)
Activity of X-linked genes in stem and differentiated Mus musculus X Mus caroli hybrid cells. (1984) (0)
Abstract 1805: Integrative analysis of microRNAs in blastic plasmacytoid dendritic cell neoplasm (2019) (0)
Loss of Heterozygosity at Chromosome llq in Lung Adenocarcinoma : Identification of Three Independent Regions 1 (2006) (0)
Inactivation of Bcl-2 by phosphorylation ( apoptosis / programmed cell death / oncogene / human cancer / lipid peroxidation ) (2005) (0)
Reactivation of a silent mouse rrna gene by sv-40-human- -mouse hybrid cells. Abstr. (1979) (0)
Abstract 474: Extracellular vesicle - MDM2 as liquid biopsy biomarker for disease identification in retroperitoneal liposarcoma (2021) (0)
HEPATITIS C VIRUS PROTEINS CAN MODULATE MICRORNA EXPRESSION AND CHEMOTHERAPEUTIC RESPONSES IN HEPATOCELLULAR CARCINOMA (HCC) (2008) (0)
Methods to determine the subtype of hepatocellular carcinoma (2008) (0)
Meeting Report of the Fifth International Cancer Epigenetics Conference in Beijing, China, October 2016. (2017) (0)
microRNA-based diagnostics for cancers of the colon, pancreas and stomach methods (2007) (0)
Multivariate Analysis Reveals a miRNA Profile Correlated To Karyotype and Outcome In Pediatric B-Cell Precursor ALL (2013) (0)
Development of the Human Hybridoma Technology (1987) (0)
Evidence for the Role of the WW Domain-Containing Oxidoreductase in Lipoprotein Metabolism: Potential Implications for HDL Biogenesis (2010) (0)
Brief Report (2013) (0)
Abstract 1951: miRNA expression profile of Blastic plasmacytoid dendritic cell neoplasm. (2013) (0)
Regulation of the Expression of SV40 T Antigen in Stem Versus Differentiated Cells (1980) (0)
Discovery and Functional Implications of a Novel Mir-29b/Mir-29a Polymorphism in Acute Myeloid Leukemia. (2009) (0)
Atlas of Genetics and Cytogenetics in Oncology and Haematology Common fragile sites and genomic instability (2013) (0)
Molecular Genetics of Human B- and T-Cell Leukemia (1987) (0)
And methods based on micro-RNA compositions for prognosis and treatment of diseases related to colon (2007) (0)
Subject Index Vol. 16, 1976 (1976) (0)
Assignment of the gene for glyoxalase I to region p21 leads to pter of human chromosome 6. (1977) (0)
What's new in hybridoma technology? (1981) (0)
Testin knock-out mice reveal a tumor suppressor function in chemically-induced forestomach carcinogenesis (2005) (0)
Abstract 4823: The novel miR-15a/Fra-2/IGF1R axis drives response to starvation-induced cell stress in pancreatic ductal adenocarcinoma (2023) (0)
Reexpression oftheRatHypoxanthine Phosphoribosyltransferase GeneinRat-HumanHybrids (enzymeactivation/glucose-6-phosphate dehydrogenase/adenine phosphoribosyltransferase) (1973) (0)
Discovery and characterization of the feline miRNAome (2017) (0)
Involvement of the ALLI gene in a solid tumor ( chromosomal translocations / self-fusion ) (2005) (0)
Methods and compositions based microRNA for diagnosis and treatment of pancreatic cancer (2007) (0)
Title: a Microrna Signature of Hypoxia 1 Running Title: a Microrna Signature of Hypoxia 2 (2006) (0)
Significance of Aberrant Expression of MicroRNAs in Cancer Cells (2009) (0)
Abstract 1891: OncogenicMDM2-containing exosomes promote pre-metastatic niche establishment (2019) (0)
SY-2 Inflammation-induced micro-RNAs in B-cell lymphoma (2008) (0)
Cancer genomics : extended abstracts for the 28th International Symposium of the Princess Takamatsu Cancer Research Fund, Tokyo, 1997 (1998) (0)
Methods for detecting prostatacancermetastase (1993) (0)
Functional Implications of miRNAs in Acute Myeloid Leukemia (AML) by miRNA-mRNA Expression Profiling. (2009) (0)
MicroRNA e cancro (2006) (0)
Investigations on microRNAs in human chronic lymphocytic leukemia and control of cancer-associated molecular pathways (2008) (0)
Aberrant FHIT Transcripts in Merkel Cell Carcinoma1 (2006) (0)
Abstract LB-387: In vivo study on the pathological role of microRNA 155 in liver malignancy (2018) (0)
Melanoma and immunotherapy bridge 2015 (2016) (0)
12 – Involvement of the Immunoglobulin Loci in B-Cell Neoplasia (1989) (0)
Abstract A085: miR-222/221 in aggressive breast cancer (2013) (0)
Assignment of the genes for mitochondrial malate dehydrogenase and for SV40 T-antigen to human chromosome 7. (1976) (0)
Retraction Notice to: miR-221&222 Regulate TRAIL Resistance and Enhance Tumorigenicity through PTEN and TIMP3 Downregulation. (2022) (0)
Sv 40 rescue in hetero karyocytes respective roles of nonpermissive transformed cell and permissive cell (1973) (0)
In response [2] (2007) (0)
Correction to: Overexpression of the HMGA2 gene in transgenic mice leads to the onset of pituitary adenomas (2022) (0)
Expression of HLA-A, but not of HLA-B, in mouse-human somatic cell hybrids carrying the region p21 leads to pter of human chromosome 6. (1978) (0)
A process for the production of tumor antibodies (1978) (0)
Based methods and micro-RNA for the diagnosis and treatment of diseases related to colon compositions (2007) (0)
537 Potent in vitro and in vivo anti-tumor activity of ITF2357 by modulation of c-myc related miRNA signature in human Burkitt's lymphoma (2010) (0)
Dysregulation of microRNAs leads to target therapy (2017) (0)
miRNAs in Cancer Initiation and Progression (2013) (0)
A Mouse Model for Immunotherapeutic Reversal of Leukemia-Induced T Cell Dysfunction (2008) (0)
HUMAN IMMUNOGLOBULIN EXPRESSION IN HYBRID CELLS (1982) (0)
Abstract 1830: Cancer-associated variants at 8q24 are correlated with expression of adjacent long non-coding RNAs involved in cell cycle regulation. (2013) (0)
REARRANGEMENT OF THE ALL1 GENE IN ACUTE MYELOID LEUKEMIA WITHOUT CHROMOSOMAL TRANSLOCATIONS (1995) (0)
Abstract 4051: MiR-181b expression levels decreases during the progression of the Chronic Lymphocytic Leukemia: a new potential prognostic tool (2010) (0)
MicroRNA Function in Human Hematopoiesis: Identification of Lineage- and Stage-Specific Expression Profiles, Pivotal Targets and Regulatory Circuitries. (2006) (0)
Gene Transfer Investigations of Oncogenes Activated by Chromosomal Translocations in Human Lymphomas and Leukemias: BCL2 and C-MYC (1991) (0)
Sa1430 MicroRNA-29a Regulates Intestinal Permeability in Neutropenic Mice (2012) (0)
Abstract ED06-02: MicroRNAs and cancer progression (2012) (0)
Abstract 976: Junctional adhesion molecule-A (JAM-A) expression is downmodulated by miR-21 during colorectal cancer progression (2014) (0)
Viral-DNA Vectors in the Analysis of Mammalian Differentiation (1982) (0)
Hypozia Inducible Factor 1-A (HIF-1α) Upregulates MicroRNA-21 (miR-21) in Pancreatic Cancer (2010) (0)
Characterization of a cDNA clone encoding human filaggrin and localization of the gene to chromosome region 1 q 21 ( expression library / polyprotein repeat / polymorphism / in situ hybridization ) (0)
Abstract 1143: Deep sequencing of microRNAs in canine diffuse large B-cell lymphoma (2011) (0)
Transcription signatures encoded by ultraconserved genomic regions in human prostate cancer (2013) (0)
Abstract 2089: MiR-205 role in triple negative breast cancer (2010) (0)
Abstract 2947: B-cell lymphoma in eα-miR-17∼92 transgenic mice (2012) (0)
Tissue preference and differentiation of malignant hybrid cells during mouse development. Abstr. (1980) (0)
MicroRNA genes in cancer diagnosis, prevention, prognosis, and treatment (2008) (0)
Monoclonal antibodies and immobilized antibodies (1987) (0)
Erratum: MicroRNAs in Cancer (2019) (0)
MicroRNA Profiling in Patients with CLL B Cells Expressing the Unmutated IGHV1-69 Gene (2011) (0)
A unique microRNA signature associated with nucleophosmin mutations in normal karyotype acute myeloid leukemia (2007) (0)
Connect The Dots (2016) (0)
Gene expression profile analysis of pituitary adenomas developed by HMGA transgenic mice ” (2007) (0)
protein-coding genes Chronic lymphocytic leukemia: interplay between noncoding RNAs and (2013) (0)
Molecular and Cellular Pathobiology Suppression of MicroRNA-9 by Mutant EGFR Signaling Upregulates FOXP 1 toEnhanceGlioblastomaTumorigenicity (2014) (0)
The Use of Mouse-Human and Human-Human Hybridomas in Human Genetics and Immunology (1982) (0)
Correction: Fhit modulation of the Akt-survivin pathway in lung cancer cells: Fhit-tyrosine 114 (Y114) is essential (2019) (0)
Abstract 68: The WWOX Gene Modulates HDL Metabolism and Lipoprotein Gene Expression (2013) (0)
Elevated HIF-1α Levels in CLL B Cells May Explain Their Autocrine VEGF Secretion. (2006) (0)
Identification of Products Encoded by NK Cell-Derived cDNA Clones (1990) (0)
Reflections of the Editor-in-Chief (1999) (0)
MUTANT EGFR SUPPRESSION OF MICRORNA-9 INDUCES FOXP1 TO ENHANCE GLIOBLASTOMA TUMORIGENICITY (2014) (0)
and cell cycle (2007) (0)
Pan-Cancer Analysis of Canonical and Modified miRNAs Enhances the Resolution of the Functional miRNAome in Cancer (2022) (0)
Preclinical models of leukaemia therapy by miR-15A/16-1 and of solid tumours therapy by cluster miR-17-5P-92A inhibition (2009) (0)
Methods and compositions based microRNA for diagnosing breast cancers (2007) (0)
Contents, Vol. 18, 1977 (1977) (0)
Short Communication Loss of FHIT Expression in Transitional Cell Carcinoma of the Urinary Bladder (2000) (0)
Molecular genetics of human lymphomas and leukemias (1993) (0)
Influence of Mir-155 On B-Cell Receptor Signaling in Chronic Lymphocytic Leukemia. (2009) (0)
Identifi'cation of the TCLI gene involved in T-cell malignancies (2005) (0)
Abstract A112: RanBP9 protects cells from genotoxic stress and increased expression is predictive of worse response to platinum in NSCLC patients (2018) (0)
Expression of late viral functions in SV40-infected rat-monkey somatic cell hybrids (1979) (0)
-mutated AML NPM1 Implications of the miR-10 family in chemotherapy response of (2014) (0)
Selective expression of histone genes in mouse-human hybrid cells. (1985) (0)
LYMPHOID NEOPLASIA Heat shock protein 70 regulates Tcl 1 expression in leukemia and lymphomas (2013) (0)
Methods for detection of micro metastases in prostate cancer (1993) (0)
Ultraconserved regions encoding RNAnc (2008) (0)
Abstract B61: Insights into lung cancer survival in African Americans from a study of germline variation in the microRNA network (2011) (0)
Table of Contents (1982) (0)
Erratum: Cancer-specific chromosome alterations in the constitutive fragile region (Proceedings of the National Academy of Sciences of the United States of America (June 22, 1999) 96 (7456-7461)) (1999) (0)
lymphomas Heat shock protein 70 regulates Tcl1 expression in leukemia and (2013) (0)
antibody generation method for generating tumor (1978) (0)
Small Non-Coding RNAs in Soft-Tissue Sarcomas: State of the Art and Future Directions. (2023) (0)
miR-155 regulates IFN- (cid:1) production in natural killer cells (2012) (0)
S-15 : Cytokine-driven loss of plasmacytoid dendritic cell function in chronic lymphocytic leukemia (2014) (0)
Oncornavirus genetic expression: murine virus gene induction by human cell chromosomes. (1976) (0)
Microrna 29b Mediates Immune Evasion of Natural Killer Cells in Acute Myeloid Leukemia (2015) (0)
Advances in Brief Rarity of Somatic and Gennline Mutations of the Cydin-dependent Kinase 4 Inhibitor Gene , CDK 4 I , in Melanoma ' (0)
miRNA in Serum and Bone Marrow Plasma Cells From Multiple Myeloma Patients. (2012) (0)
Abstract 4120: Low expression of PP2A/B55α is associated with increased MiR-191 expression and relapse in acute myeloid leukemia. (2013) (0)
microRNA-based methods for diagnosing colon cancer (2007) (0)
Characterization of the TCLI Gene and Its Involvement in T-Cell Malignancies (1996) (0)
High throughput microRNAs profiling in cancers (2007) (0)
related microRNA-21 mismatch repair methods and in colorectal cancer (2011) (0)
Abstract 5326: MicroRNA profiles discriminate among colon cancer metastasis. (2013) (0)
BRCA1 IVS2-2delA: a deleterious mutation in a family of Asian descent. (2004) (0)
Methods to reverse the methylation directed selection of Dnmt3a and DNMT3B (2008) (0)
MicroRNAs 155, -221 and -222 Control Megakaryopoiesis at Progenitor and Precursor Level through Ets-1 Multitargeting. (2006) (0)
586 The role of FHIT gene in lung carcinogenesis (1997) (0)
Oncogene probes in the detection of human cancer. (1987) (0)
protein tyrosine phosphatase PTPROt in leukemia AP-1 elements and TCL1 protein regulate expression of the gene encoding (2012) (0)
Traces of microRNAs in human megacariocipoyesis (2007) (0)
Effect of miR-21 on resistance to 5-fluorouracil and regulation of MSH2. (2011) (0)
Loss of F HIT Expression in Gastric Carcinoma 1 (2006) (0)
Is mi R- 29 an oncogene or tum or suppressor in CLL? (2010) (0)
Retraction for Melillo et al., “Critical Role of the HMGI(Y) Proteins in Adipocytic Cell Growth and Differentiation” (2018) (0)
Abstract LB-352: B-CLL phenotype in Eµ-miR-29 transgenic mice (2010) (0)
Abstract 530: MicroRNA expression profiling in MMTV-neubreast cancer mouse model (2014) (0)
Aberrant Regulation of pVHL Levels by Microrna May Explain Autocrine Secretion of VEGF in CLL B Cells. (2008) (0)
SUBSTRATE ANALOG (IB2) COMPLEX WITH THE FRAGILE HISTIDINE TRIAD PROTEIN, FHIT (1998) (0)
Abstract 1316: Deficiency of the WW Domain-Containing Oxidoreductase (WWOX) Impairs the HDL Biogenesis Pathway (2009) (0)
Abstract #2331: Therapeutic effect of microRNA-15/16 cluster in a mouse model of chronic lymphocytic leukemia. (2009) (0)
Abstract 1151: microRNAs affect therapeutic sensitivity of human gliobastoma to temozolomide (2011) (0)
Progress Report on “Advances in Brief” (1992) (0)
Abstract 3053: Associations of microRNA-34a, −34b, and −34c expression with p53 status, diagnosis, and prognosis in colon and adenocarcinoma (2010) (0)
Allele-Specific Loss Of The Mir-15a/16-1 Cluster Correlates With ZAP70 Expression In CLL Patients With 13q Deletion (2013) (0)
LYMPHOID NEOPLASIA Translocation t ( 2 ; 11 ) in CLL cells results in CXCR 4 / MAML 2 fusion oncogene (2014) (0)
Introduction (0)
Micro-RNA signature differences in lung adenocarcinoma with specific driver alterations. (2013) (0)
Abstract LB-347: A microRNA signature harbors prognostic implications in clear cell renal carcinoma (ccRC) (2011) (0)
microRNA-based methods for diagnosing prostate cancer (2007) (0)
Abstract 1850: CDK inhibitor PHA-848125 preferentially inhibits proliferation of triple negative breast cancer and synergizes with cisplatin (2018) (0)
Advances in Brief Role of bcl-2 in Growth Factor Triggered Signal Transduction 1 (2006) (0)
Abstract 1943: miR-148a overexpression reduces TRAIL resistance and tumorigenesis in NSCLC. (2013) (0)
miRNome integrative analysis in ovarian cancer (2008) (0)
Altered Expression of FHIT in Esophageal Neoplasm (2002) (0)
SYNTHESIS AND ANTI-INFLAMMATORY EVALUATION OF SOME CONDENSED ( 4-( 3 , 4-DIMETHYPHENY 1 )-1 ( 2 H )-OXO-PHTHALZIN-2-Y 1 ) ACID HYDRAZIDE Research (2013) (0)
Abstract 4086: Ultraconserved non-coding RNAs are involved in human hepatocellular cancer growth (2010) (0)
Bc12 Is the Guardian of Microtubule Integrity1 (2006) (0)
MicroRNA miR-30 family regulates non-attachment growth of breast cancer cells (2013) (0)
Suppression of T\imorigenicity of Breast Cancer Cells by Microcell-mediated Chromosome Transfer: Studies on Chromosomes 6 and II1 (2006) (0)
Reduction of the most common fragile site tumor suppressor proteins in cervical cancer (2010) (0)
Structure beyond sequences: miRNAs a rich variety of conformations (2018) (0)
Abstract C17: Role of miR-135b in gemcitabine sensitivity for metastatic breast cancer patients (2015) (0)
IMMUNOBIOLOGY Overexpression of miR-155 causes expansion , arrest in terminal differentiation and functional activation of mouse natural killer cells (2013) (0)
I s m iR-2 9 an oncogene or tum or suppressor in CLL ? (2010) (0)
Transcriptomic analysis of collecting duct carcinoma of the kidney (2016) (0)
PROGNOSIS AND TREATMENT OF GASTRIC CANCER (2017) (0)
tRNA-derived fragments (tRFs) in cancer (2022) (0)
Clinical and Therapeutic Applications of MicroRNA in Cancer (2017) (0)
OP63 MicroRNA gene and cancer (2007) (0)
Abstract LB-351: miR-221&222 regulate cell motility in glioma cell lines targeting the protein phosphates PTPμ (2010) (0)
Abstract 1383: Histone H3 lysine 9 methyltransferase SUV39H1 is associated with clinical outcome of renal clear cell carcinoma patients (2017) (0)
Non coding RNAs: reprogramming of miRNAs network in cancer and highly specific transcribed ultraconserved regions in human normal tissues and pluripotent stem cells (2011) (0)
The authors reply [12] (2006) (0)
Abstract IA22: miRNA and lung cancer: Early detection in high-risk subjects (2012) (0)
Methods and compositions based on microRNAs for diagnosis and treatment of solid cancers (2007) (0)
Brief report IRF4 mutations in chronic lymphocytic leukemia (2011) (0)
Abstract 1417: Development of a miRNA-based prediction tool to discriminate cutaneous blastic plasmacytoid dendritic cell neoplasm from cutaneous myeloid sarcoma (2020) (0)
Cancer by Targeting the Antiapoptotic Protein PED Small Cell Lung − Apoptosis-Inducing Ligand Sensitivity in Non Related − miR-212 Increases Tumor Necrosis Factor (2010) (0)
Abstract 5032: New insights of miR-221 and miR-222 cluster functions in Burkitt lymphoma. (2012) (0)
Abstract #4723: MicroRNA-221/222 confer breast cancer resistance to fulvestrant by targeting multiple oncogenic activities (2009) (0)
Phosphorylated bcl-2 - A signal for apoptotic death (1996) (0)
Procedures based miRNA and compositions for the diagnosis and treatment of diseases related to colon (2007) (0)
Abstract LB-166: miRNA editing in seed region is in synergy with cellular changes in hypoxic conditions (2016) (0)
Cancer esearch cular and Cellular Pathobiology enetically Deregulated microRNA-375 Is Involved in a itive Feedback Loop with Estrogen Receptor α in R ast Cancer Cells (2010) (0)
Abstract LB-245: Multiple DNA-damage response pathways are modulated by RANBP9 protein in NSCLC (2018) (0)
MicroRNAs expression in acute promyelocitic leukemia upon ATRA treatment (2006) (0)
Detection of Minimal Residual Disease in Leukemic Patients with the t ( 10 ; 14 ) ( q 24 ; qll ) Chromosomal Translocation 1 (2006) (0)
POZ-, AT-hook-, and zinc finger-containing protein (PATZ) interacts with the human oncogene B cell lymphoma 6 (BCL6) and is required for its negative autoregulation. (2017) (0)
Retraction: Haploinsufficiency of the Hmga1 Gene Causes Cardiac Hypertrophy and Myelo-Lymphoproliferative Disorders in Mice. (2018) (0)
Genechip Microarray analysis of pituitary adenomas developed by HMGA transgenic mice (2006) (0)
Heterozygosity at Chromosome 1 p in Breast Cancer Detection and Cloning of a Common Region of Loss of Updated (2006) (0)
Abstract 966: Circulating exosomal miRNAs as potential biomarker in liposarcoma (2016) (0)

This paper list is powered by the following services:

Other Resources About Carlo M. Croce

en.wikipedia.org

What Schools Are Affiliated With Carlo M. Croce?

Carlo M. Croce is affiliated with the following schools:

Image Attributions

Image Source for Carlo M. Croce